Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Содержание

ᐅ Hitachi R-WB 552 PU2 GBW отзывы — 16 честных отзыва покупателей о холодильнике Hitachi R-WB 552 PU2 GBW

Самые выгодные предложения по Hitachi R-WB 552 PU2 GBW

 
 

Букин Александр, 26.11.2018

Достоинства:
Красив! Функционален! Прост! Качественный внутри отделкой! В меру широк и глубок))

Недостатки:
Гудит, клокочет, тарахтит, газует) записал видео с лязгом и цокотанием. Могу скинуть кому надо для вдохновения.

Комментарий:
Купил из за достойного бренда, красоты и функционала. 35 раз спросил - будет гудеть? Оператор на телефоне заверил что нет, те кто доставлял товар сказали - надо выставить по уровню и дать отстоятся перед включением. Выставил, сутки стоял не велюченным, сутки намораживал. Гудел и цокотал. Я обратился в контору кот продавала. Оператор сказал еще надо подождать 3 дня. Клокотание не исчезло и даже появились новые звуки. Более громкие.

Решил поменять по обмену/возврату 7 дней на такой же в надежде на чудо. )))

юрий, 26.06.2018

Плюсы:
все не перечислишь

Минусы:
боксы для яиц не продумали.неудобно

Пользуемся 2й год,довольны.Твердая 4.

комарова алия, 22.01.2018

Самая порядочная компания, которая при страшном ажиотаже выполнила все свои обязательства. Спасибо огромное, думаю на

Ильина Лариса, 18.03.2017

Достоинства:
огромный (просто бездонный какой-то), удобные полочки, особенно в дверцах (можно ставить 2-х литровые бутылки), морозит отлично, стильный
Недостатки:
шумноват. дверцы выполнены из стекла, сильно заляпываются пальцами. На коричневом их очень-очень видно((( Морозильная камера представлена глубоким поддоном и поддоном поменьше - не хватает полочек, продукты лежат друг на друге и рыться там не совсем удобно.

Комментарий:

мне холодильник нравится. Мой отец, увидев эту махину, сказал "да тут еды можно на месяц натолкать"))) Морозилка огромная (но и в ней есть недостатки). А еще мне лично не хватает автоматического ледогенератора, в этой модели ручной, не очень удобно с ним возиться. Но в целом покупка этого холодильника решила проблему размещения продуктов "на неделю".

Аноним, 31.01.2017

Холодильник шикарный, реально места много. Очень устойчивый, дизайн супер, но..... шумит..... вот не ожидал от инвертора, не ожидал.

Elena Павл, 17.12.2016

Достоинства:
Вместительность, качество сборки
Недостатки:
Холодильник оооочень шумный!!! В тишине это просто трансформаторная будка, рядом находиться не реально, начинает болеть голова. Вызывали мастера из сервиса в первые 14 дней после покупки. Пришел и намерил 42дб, сказал, что это норма, привыкнете, притреться и будет потише, но прошло два месяца, гудеть стал кмк еще длительнее и громче. Перерыв на тишину практически не заметен. И это инвертор, который должен тихо работать!!!

Комментарий:

Уже ненавижу его. За 56 000 поимели головную боль.

Че Ксения, 26.07.2016

Достоинства:
Вместительный, дверцы и полки удобные. Дизайн внешнего вида, также радует
Недостатки:
Шумно работает

Комментарий:

Холодильник лучше ставить в очень-очень дальнюю комнату:) чтобы не было так слышно и не мешал спать.

Татьяна, 31.12.2015

Использую холодильник с декабря 2014 года. Полет нормальный. Основная претензия - шум. Очень хорошо, что в совмещенной гостинной-кухне никто постоянно не живет, т.к. для сна его шум является явной проблемой (хотя, конечно, проблема может касается именно нашего конкретного зкземпляра). Т.к. холодильник - инвертор, мы абсолютно не ожидали, что у него будут ярковыраженные шумные периоды работы и нешумные периоды простоя (т.к. интвертор подразумевает постоянную работу, но на разной мощности). Теперь мы знаем, что у нашего холодильника есть четыре разных рабочих звука + тишина 🙂 а еще, что на ночь гостей лучше размещать в других комнатах 🙂 В обычной жизни его шум почти не напрягает (дело привычки), но, когда он перестает шуметь на какое-то время, сразу это слышишь, кончено... Все остальное - отлично!

жуков олег, 19.11.2015

Достоинства:
огромный обьем,внешний вид.
Недостатки:
иногда в морозильнике перекашивает верхнию полку

Комментарий:

удобный,вместительный,красивый,вот не полный список достоиств этого холодильника.На счет шумности,ну не знаю,стоит на кухне,а там я не сплю.Выполняет свою работу на 100%

Ольга, 16.09.2015

Согласна с Татьяной. У нас такая же ситуация с холодильником. Находится в кухне -гостиной, где никто не спит. Удобный, красивый, функциональный, хорошо моется, много замечательных опций у этого агрегата. Вообщем, во всем устраивает,но тоже на удивление, шумный. Мы ожидали более тихую его работу.

 

Андрей, 29.07.2015

Покупкой очень не доволен. Вентиляторы загрохотали уже через неделю.Гарантийный ремонт только в мастерской.Охать на счет дизайна-последнее дело,это-же не шкаф!

Алла, 03.02.2015


Купили неделю назад, пока очень довольны. В реале смотрится намного красивее. Работает тихо, широкий диапазон температур. Очень вместительный. Полностью довольны

Надежда Н., 19.12.2014

Объемный и удобный холодильник, покупался три месяца назад и до сих пор не возникло никаких проблем в эксплуатации) Мне лично очень нравятся его полки, все пространство внутри продумано до мелочей, на дверце целых семь полочек, можно спокойно разместить пластиковые бутылки с газировкой, упаковки с соками, молоко и не переживать, что они при открытии дверцы упадут) Морозит просто отлично, температура легко регулируется и никогда сама по себе не меняется. Ноу-Фрост - просто спасение, никаких тебе ледовых корок на продуктах или на задней стенке, размораживать его тоже не нужно)) Температуру как в самом холодильнике, так и в морозилке всегда видно на дисплее. Холод он распределяет равномерно, муж объяснил, что там специальный вентилятор находится, поэтому о продуктах не переживаю, овощи в целости и сохранности, приготовленные блюда в посуде сохраняются свежими достаточно долго. Еще прикольная фишка - защита от детей, выставили ее от нашего четырехлетнего шалуна сразу же и всякий раз она безотказно срабатывает)) Пожалуй, один из лучших холодильников, которые у нас когда-либо были, на его фоне обычные варианты просто блекнут))

Фролов Константин, 22.10.2014

Достоинства:
Объёмный и очень красивый. Всем, кто приходит в гости он нравится.

Недостатки:
Практически нет (такие незначительные, что не хочется писать).

Комментарий:
Насчёт того, что быстро заляпываются двери, то это просто ахинея. Красивый фасад под стекло тёмно-коричневого цвета предполагает иногда протирку отпечатков жирных пальцев любителей не мыть руки после еды.

МАСТЕР, 09.10.2014

когда начнет выделываться и прийдется менять плату выбудете в шоке от ее цены

Аноним, 14.07.2014

просто безобразное качество сборки, за месяц 4 раза ремонтируем, заправляем.
рвет у него испаритель( аллюминевый и очень тонкий)
не советую никому

Холодильник Hitachi R-M702 PU2 GS

Гарантия 1 год
Габариты (ВхШхГ) 177.5 х 92 х 76.5
Высота, см 1775
Автономное сохранение холода, ч
18 ч
Напряжение, В 220-240
Количество дверей 3
Количество камер 3
Частота тока (Гц) 50
Общий объем 600 л
Глубина 76.5
Ширина, см 920
Габариты (ШxГxВ) 92x76,5x177,5 см
Класс энергопотребления A++
Размораживание морозильной камеры No Frost
Размораживание холодильной камеры No Frost
Хладагент R600a (изобутан)
Морозильная камера Side by Side (сбоку)
Вид Side-by-Side
Дизайн Side-by-Side
Климатический класс T
Генератор льда в комплекте
Защита от детей да
Дисплей да
Вентиляция Да
Внутреннее освещение морозильной камеры Да
Компрессор Компрессор с пониженной вибрацией 1 компрессор
Дополнительные возможности Независимое отделение для овощей с отдельной дверцей Система охлаждения Dual Fan Cooling Инвертерный компрессор Фильтр Nano-Titanium Система E-control Дверцы с покрытием из серебристого закаленного стекла
Тип отдельностоящий
Внутреннее освещение холодильной камеры Светодиодные колонны
Цвет Серебристый
Цвет / Материал покрытия серебристый/ пластик/металл
Индикация температуры холодильного отделения включения питания режим SuperCool режим SuperFrost защита от детей температуры морозильного отделения отключения питания
Система охлаждения циркуляционная
Система управления электронная

Холодильник Hitachi R-WB 482 PU2 GS

Общий полезный объем 456 л
Объем холодильной камеры 382 л
Объем морозильной камеры 84 л
Расположение морозильной камеры внизу
Управление электронное
Дисплей да
Контроль управления внешний
Количество компрессоров 1 шт.
Класс энергопотребления A
Размораживание холодильной камеры No Frost
Размораживание морозильной камеры No Frost
Наличие морозильной камеры да
Зона свежести нет
Перевешиваемые двери нет
Мощность замораживания 10 кг/cутки
Суперзаморозка нет
Фасад дверей краска
Количество камер 2
Количество дверей 3
Защита от детей нет
Минибар нет
Диспенсер нет
С ледогенератором нет
Линейный компрессор нет
Инверторный нет
Уровень шума 42 дБ
Тип хладогента R600a
Климатический класс T
Материал полок стекло
Автономное сохранение холода 12
Индикация температуры да
Индикация открытой двери звуковая
Количество полок 4
Количество ящиков в морозильной камере 2
Размеры (ВхШхГ) 178x68x75.5 см
Цвет cеребристый
Вес нетто 90 кг
Производство Таиланд
Гарантия 12 мес
EAN 8850207462130

Холодильник Hitachi R-M 702 PU2 GBK

Большой 3-х дверный холодильник объемом 600 литров включает в себя морозилку общим объемом 228 литров с удобными полками и выдвижными ящиками для хранения замороженных и готовых блюд, и холодильное отделение, разделенное на 2 изолированных отсека. Холодильник оборудован инвернорным двигателем, сенсорным управлением, системой сигнализации открытой двери, мягким LED освещением внутренних камер, экосенсором температуры, системой NoFrost, уплотнителем двери с защитой от плесени.

 

Ключевые характеристики модели:

  • ширина 92 см / высота 172 см
  • цвет - черное стекло
  • 3-х дверный
  • общий объем 600 литров
  • объем холодильной камеры 372 литра
  • объем морозильной камеры 228 литров
  • система NoFrost
  • инверторный компрессор
  • система Dual Fan Cooling
  • экосенсор температуры
  • сенсорная панель управления
  • фильтр Nano Titanium
  • уплотнитель двери с защитой от плесени
  • длительное сохранение холода - 12 часов

 

Отличительные особенности  

Холодильник работает без стабилизатора напряжения

Эта модель холодильника может работать без стабилизатора напряжения. Широкий диапазон (от 130 до 300 В.) в котором работает этот прибор, позволяет вам не бояться перепадов электроэнергии и не покупать отдельно стабилизатор. Теперь вы можете не бояться низкого или слишком высокого напряжения в вашем доме, которое негативно влияет на работу электроприборов, вызывая поломки двигателя и перегрев оборудования в целом.

 

Внутреннее устройство камер холодильника 

включает в себя:

  • 4 полки из закаленного стекла
  • карман для молочных продуктов
  • поддон для яиц
  • светодиодное освещение

 

включает в себя:

  • 5 полок из закаленного стекла
  • 2 выдвижные секции
  • светодиодное освещение

 

 

 - это специальное отделение с технологией Clean для свежих овощей

Эффективное непрямое охлаждение в каждом контейнере с крышкой сохраняет влажность на оптимальном уровне – около 90%, надолго сохраняя свежесть овощей и фруктов. Полностью изолированное отделение для овощей всегда наполнено чистым воздухом, пропущенным через фильтр Nano Titanium. Сюда не могут проникнуть запахи из других отделений.

Система охлаждения с превосходной энергоэффективностью

Новая система охлаждения сочетает в себе две энергосберегающие технологии: инверторный компрессор*,  регулирующий мощность охлаждения, и систему Dual Fan Cooling*, контролирующую объем подачи холодного воздуха во внутренние камеры холодильника. Таким образом обеспечивается чрезвычайно эффективная работа без потерь энергии. Даже если окружающая температура достигнет 60 градусов, каждый уголок внутри вашего холодильника будет тщательно охлажден.

*Инверторный компрессор регулирует мощность охлаждения в широком диапазоне – от самой низкой до максимально высокой. В отличие от  обычных компрессоров, которые охлаждают с фиксированной мощностью путем попеременного включения и отключения, инверторный компрессор способен осуществлять сверхмощное охлаждение путем подачи большого объема холодного воздуха в камеры холодильника и ВТО же время компрессор может функционировать в режиме низкой, не менее эффективной мощности охлаждения. Условия внутри и снаружи холодильника четко отслеживаются экосенсором температуры, и, в случае изменений, специальный микрокомпьютер корректирует мощность охлаждения для создания оптимальных условий в любой момент времени. Автоматически управляя двигателем, инверторная технология обеспечивает оптимальную работу оборудования с наименьшим расходом энергии и сокращает вредное воздействие на окружающую среду

*Система охлаждения Dual Fan Cooling – это два отдельно управляемых вентилятора, один для холодильной камеры и второй для морозильной, каждый из которых независимо друг от друга охлаждают их. Таким образом, охлажденный воздух может подаваться только в холодильную или морозильную камеру, или в обе камеры одновременно, что не возможно в обычных моделях с одним вентилятором. Кроме того, вентиляторы регулируют объем воздушного потока, чтобы при необходимости обеспечивать еще более мощное и эффективное охлаждение.

Сенсорная панель управления

Элегантная панель управления, встроенная в дверь холодильника, разработана с использованием самых инновационных технологий. Плоский стеклянный сенсорный дисплей позволяет меня настройки одним касанием. Поверхность панели выполнена из закаленного стекла, поэтому для очистки ее достаточно слегка протереть сухой тканью.

Яркое и экономичное светодиодное освещение

Все отделения оборудованы светодиодным освещением, которое служит дольше и потребляет меньше электроэнергии, чем обычные лампы накаливания.

Воздушный фильтр Nano Titanium

Nano Titanium – это новейшая технология на основе каталитического нейтрализатора TiO2, обеспечивающего мощный антибактериальный эффект. Этот фильтр не нуждается в обслуживании и не потребляет энергию.

Система NoFrost, быстрая заморозка и быстрое охлаждение продуктов

Холодильник оборудован системой NoFrost (дословный перевод - "без инея"). Охлаждение внутренних камер холодильника происходит за счет сухого холодного воздуха, вся лишняя влага выводится за пределы камер и испаряется в процессе работы прибора. Никакого инея внутри камер и на продуктах. Достаточно только гигиенической чистки раз в год.

При работе системы NoFrost, воздух перемещается по камерам с помощью встроенного вентилятора. Такая принудительная вентиляция позволяет быстрее охлаждать и замораживать "вновь поступившие" продукты.

*************************************************************************************************************

Наши рекомендации по монтажу

После транспортировки, перед подключением, следует оставить прибор в вертикальном положении в течение 2 часов. Установка прибора следует производить в вентилируемые ниши, с учетом указанных расстояний до ближайших поверхностей.Рекомендуется устанавливать холодильник / морозильник на удалении от нагревающихся приборов, чтобы сократить частоту включения компрессора и продлить срок службы прибора.

Гарантия

Гарантийный срок для этого прибора составляет 12 месяцев (1 год) и предоставляется производителем с момента покупки. При возникновении проблем в период гарантийного срока или позднее - просьба обращаться в специализированные центры Mitsubishi Electric.  Обращение к специалистам поможет быстро и без лишних затрат решить возникающие проблемы. 

 
Техническая документация холодильника R-M 702 PU2

 

 

ИНСТРУКЦИЯ по эксплуатации R-M 702 PU2

 

* Вся информация о товаре, характеристики и описание не являются публичной офертой. Производители техники могут без уведомления менять комплектацию, дизайн и функционал моделей. Пожалуйста, уточняйте данные о товаре у консультантов.

HITACHI R-S702 PU2 GS. Честные отзывы. Лучшие цены.

На этой странице вы найдёте описание, продавцов и цены, чтобы купить дешевле, видеообзоры и отзывы владельцев о холодильнике HITACHI R-S702 PU2 GS. И можете оставить своё мнение о модели в комментариях.

Быстрый Переход к Нужному Месту:

Технические характеристики

Общий полезный объем605 л
Объем холодильной камеры377 л
Объем морозильной камеры228 л
Расположение морозильной камерыслева
Управлениеэлектронное
Дисплейда
Контроль управлениявнешний
Количество компрессоров1 шт.
Класс энергопотребленияA
Размораживание холодильной камерыNo Frost
Размораживание морозильной камерыNo Frost
Наличие морозильной камерыда
Зона свежестида
Перевешиваемые дверинет
Мощность замораживания11 кг/cутки
Фасад дверейкраска
Количество камер2
Количество дверей2
Защита от детейнет
Минибарнет
Диспенсернет
С ледогенераторомда
Линейный компрессорнет
Инверторныйда
Уровень шума41 дБ
Тип хладагентаR600a
Климатический классT
Материал полокстекло
Автономное сохранение холода18
Индикация температурыда
Индикация открытой дверизвуковая
Количество полок5
Количество ящиков в морозильной камере2
Функция «Суперзаморозка»да
Размеры (ВхШхГ)177.5х92×76.5 см
Цветсеребристый
Вес нетто115 кг
ПроизводствоТаиланд
Гарантия12 мес
EAN8850207464776

Видео


Отзывы и обзоры

Смотрите видео (выше) и обзоры (ниже), они часто лучше текстовых отзывов. Прочитать больше отзывов или оставить свой вы можете в комментариях к этой странице. Спасибо за ваш отзыв или оценку!

Сергей

Холодильник хороший. Работает без проблем, морозит как надо, места нам тоже на все хватает. Почти год как купили и ни разу не пожалели о своем выборе.

Цены и продавцы

Экспрессия и регуляция рецептора нейропептида Y Y2 в сенсорных и вегетативных ганглиях

Подтип Y2 рецепторов нейропептида тирозина (Y2R) и некоторые нейропептиды были изучены с помощью гибридизации in situ в сенсорных и вегетативных нейронах крыс и крыс. обезьяна. От 10% до 20% нейронов ганглия (DRG) ганглия (DRG) содержат мРНК Y2R у крысы и обезьяны. В DRG крыс мРНК Y2R экспрессируется в нейронах среднего и большого размера, положительных по отношению к пептиду, связанному с геном кальцитонина (CGRP), что является комплементарным по отношению к Y1R, который расположен в небольших нейронах CGRP.В DRG обезьян мРНК Y2R экспрессируется в основном в небольших нейронах. Периферическая аксотомия активирует Y2R в малых и больших нейронах DRG у обоих видов. Y2R и NPY мРНК совместно локализованы во многих крупных нейронах аксотомированных DRG крыс. МРНК Y2R экспрессируется в 50% НЧ узлового ганглия с умеренным увеличением после аксотомии. МРНК Y2R обнаруживается в нескольких НЧ в верхних шейных ганглиях нормальных крыс с заметным увеличением после перерезки сонных нервов. Нет Y2R-позитивных по мРНК, но много (≈30%) слабо Y1R-позитивных по мРНК NPs были обнаружены в сфенопалатиновом ганглии.Наконец, уровни мРНК Y2R увеличиваются в спинномозговых мотонейронах крыс после аксотомии. Таким образом, при нормальных обстоятельствах NPY может действовать на Y1 и Y2R, экспрессируемые, соответственно, в малых и больших CGRP-положительных нейронах DRG крысы. Y2R может быть важным рецептором висцеро-сенсорных нейронов. Y2R могут быть особенно важны после аксотомии, выступая в качестве пресинаптических и / или ауторецепторов на DRG крыс, верхних шейных ганглиях и нейронах узловых ганглиев, а также в качестве пресинаптических рецепторов в нейронах DRG обезьян.

Нейропептид тирозин (NPY), выделенный из бычьего мозга Tatemoto et al. (1), имеет широкое распространение в нервной системе и, по-видимому, участвует во многих периферических и центральных функциях (2, 3). На основании фармакологических исследований и исследований связывания с использованием пептидных фрагментов были представлены доказательства существования множества подтипов рецепторов NPY (4, 5). Ранее были выявлены два основных подтипа, рецепторы Y1 и Y2 (Y1Rs, Y2Rs), которые, как считалось, представляют в основном постсинаптические и предсинаптические рецепторы соответственно (6, 7). Y1R (8–10) и Y2R (11–13) были клонированы, и может существовать еще пять подтипов рецепторов NPY (5).

Имеются данные о том, что NPY может играть роль на уровне позвоночника. Таким образом, NPY-положительные локальные нейроны присутствуют в дорсальном роге (14), но в нейронах ганглия задних корешков (DRG) NPY в нормальных условиях не обнаруживается или присутствует на очень низких уровнях (15). Резкое повышение регуляции этого пептида происходит в нейронах DRG после повреждения периферических нервов, прежде всего в крупных нейронах (16). Авторадиографические исследования связывания лиганда продемонстрировали сильное связывание NPY в дорсальном роге спинного мозга (17, 18), которое снижается после дорсальной ризотомии (17), что позволяет предположить наличие сайтов связывания на нейронах DRG.Фактически, высокая аффинность 125 I-меченных сайтов связывания NPY была продемонстрирована на волокнах культивируемых нейронов DRG (19). Также висцеральные первичные афферентные нейроны в узловых ганглиях кролика (NG) экспрессируют связывание лигандов Y1 и Y2 (20). Связывание Y2R на сенсорных нейронах увеличивается после периферической аксотомии (Axo) (18). Используя гибридизацию in situ , мРНК Y1R была обнаружена в популяции в основном небольших нейронов DRG, также содержащих пептид, связанный с геном кальцитонина (CGRP) и вещество P (SP) (21), но этот рецептор, по-видимому, не переносится центробежно, таким образом представляя чисто соматический рецептор (22).Более того, после периферической Axo уровни мРНК Y1R уменьшались в малых, но увеличивались в больших нейронах DRG (21). В вегетативной нервной системе NPY сосуществует с норадреналином в симпатических нейронах (23) и с ацетилхолином в парасимпатических нейронах (24).

В настоящем исследовании мы использовали гибридизацию in situ и для анализа экспрессии и регуляции мРНК Y2R как в DRG крысы и обезьяны, так и в верхних шейных ганглиях (SCG), NG и сфенопалатиновых ганглиях (SPG) крыс при нормальных условиях. условиях и после Axo (DRG у крыс и обезьян и SCG и NG у крыс).

МАТЕРИАЛЫ И МЕТОДЫ

Препарат ткани.

Пятнадцать взрослых самцов крыс Sprague – Dawley (масса тела 200–250 г) и 3 самцов обезьян ( Macaca mulatta ) (3–4 кг) были глубоко анестезированы, и левый седалищный нерв был рассечен над большим вертелом. Крысам давали выжить в течение 2 (3 крысы), 7 (3 крысы), 14 (6 крыс) или 21 (3 крысы) дней, а обезьянам - 14 дней. Восемнадцать крыс подверглись глубокой анестезии, и левый внутренний и внешний сонные нервы были пересечены на расстоянии 2 мм от SCG.Крыс умерщвляли через 2, 7 или 14 дней (по шесть в каждой группе). Еще у девяти крыс был рассечен левый блуждающий нерв на 20 мм ниже NG. Крыс умерщвляли через 2, 7 или 14 дней (по три в каждой группе). Эксперименты на крысах были одобрены Stockholms norra djurförsöksetiska nämnd (местным этическим комитетом), а на обезьянах - Китайским национальным комитетом по использованию экспериментальных животных в медицинских целях, филиал Шэньси.

Оперированных животных, а также контрольных животных подвергали глубокой анестезии, и поясничный (L) спинной мозг (L4 – L5), L4 и L5 DRG, SCG, NG и SPG вырезали, замораживали и разрезали на 5 или 14 мкм. в криостате и обработаны для гибридизации in situ (21).Девять крыс с перерезанными сонными нервами (как указано выше) и три контрольных животных анестезировали и фиксировали перфузию формалином. SCG были постфиксированы, разрезаны на 14 мкм в криостате и обработаны для иммуногистохимии (15).

Подготовка зондов и процедура гибридизации.

были использованы

Смесь из трех коммерчески приобретенных олигонуклеотидных зондов (Скандинавский ген синтеза, Köping, Швеция): ( я ) TGCTTGGAGATCTTGCTCTCCAGGTGGTAGACAATGCAAC, ( II ) TGTGCCTTCGCTGATGGTAATGGTCACTTGCAGCTCCAGGAC и ( III ) GAGTTTGTACTCCTTCAGGTCCAGGACATGGCTGTCGA комплементарной нуклеотидной последовательности внутриклеточных петель 2 и 3, и внеклеточная петля 3 крысы Y2R соответственно (25).Зонд для мРНК NPY Y1R комплементарен нуклеотидам 546–585 крысиного NPY Y1R (10), а мРНК NPY Y5R - нуклеотидам 1542–1580 крысиного Y5R (26). Последовательности нейропептидных зондов были комплементарны нуклеотидам 1671–1714 крысиного NPY (27), нуклеотидам 664–698 крысиного CGRP (28) и нуклеотидам 145–192 крысиного SP (29). Олигонуклеотидные зонды метили на 3'-конце [α- 35 S] dATP (New England Nuclear) и очищали, как описано (21). DTT добавляли до конечной концентрации 10 мМ (удельная активность 1–4 × 10 6 имп / мин / нг на олигонуклеотид).Процедура гибридизации in situ следовала опубликованным протоколам (21). После гибридизации срезы промывали, обезвоживали, сушили, погружали в эмульсию ядерных треков NTB2 (Kodak), экспонировали при 4 ° C в течение 2–4 недель, проявляли, фиксировали, промывали и анализировали в микроскопе Nikon Microphot-FX, оборудованном конденсатор темного поля или окрашенный крезиловым фиолетовым и установленный для просмотра в ярком поле. Контрольные гибридизации с избытком холодного зонда (в 100 раз) отменяли все сигналы.

Иммуногистохимия.

Срезы инкубировали с антисывороткой против NPY [1: 800; J. Walsh, Центр исследований и образования язв (CURE), Лос-Анджелес], обработал для метода ABC (Vector Laboratories) и исследовал описанное (15). Для контроля антисыворотку против NPY предварительно абсорбировали синтетическим NPY (Peninsula Laboratories) в концентрации 10 -6 М, который полностью блокировал окрашивание.

Количественная оценка.

Процент меченых профилей нейронов (NP) подсчитывали на окрашенных крезиловым фиолетовым срезах в микроскопе Nikon (21).Каждый четвертый раздел серии (всего 5–8 разделов каждой L5 DRG), или каждый третий раздел серии (всего 5-7 разделов из каждой SCG или NG), или каждый четвертый раздел серии (всего Были отобраны 10 срезов каждого спинного мозга от трех подвергнутых аксотомии животных и трех травмированных животных в каждый момент времени. Всего было проанализировано 912-1297 NP от каждой DRG крыс, 1281-1742 NP от каждой DRG обезьян, 958-1414 NP от каждой SCG или NG крысы и 74-123 профиля мотонейронов крысы из обоих вентральных рогов спинного мозга. .Количество меченых НЧ делили на общее количество НЧ.

Размер NP в DRG, интенсивность мечения мРНК Y2R в DRG и интенсивность мечения мРНК NPY в SCG измеряли, как описано (21), с использованием программного обеспечения для изображений Национального института здравоохранения (любезно предоставлено W. Rasband, Национальный институт психического здоровья). Измеряли размер 200 NP, содержащих мРНК Y2R, и 400 NP с мРНК Y2R или без нее из контрольных и ипсилатеральных DRG крыс и обезьян через 14 дней после одностороннего Axo.Измеряли уровни относительной плотности мечения мРНК Y2R в DRG трех контрольных и трех подвергнутых аксотомии (14 дней) животных и мРНК NPY в SCG трех контрольных и трех аксотомированных (7 дней) крыс. Измеряли пятьдесят NP от каждой DRG или SCG каждого животного. Каждое изображение было оцифровано с 256 уровнями серого для каждого элемента изображения. Данные оценивались с помощью непарного двустороннего теста t .

РЕЗУЛЬТАТЫ

DRG Крысы и Обезьяны.

В DRG L4 и L5 нормальных крыс 15-20% всех NP были Y2R-положительными по мРНК (мРНК + ) (рис. 1 a и e и 2 a ), с диапазоном 400-2700 мкм 2 (большинство 900-1800 мкм 2 ) (рис. 2 b ), что в основном представляет собой крупные нейроны. После Axo наблюдалось сильное увеличение процента мРНК Y2R + NP в ипсилатеральных DRG (фиг. 1 b и f , и 2 a ).Через 7, 14 и 21 день после Axo ≈35% всех НЧ были положительными с небольшим снижением на противоположной стороне (рис. 2 a ). Размер Y2R мРНК + NPs после Axo находится в диапазоне от 300 до 1500 мкм 2 , что представляет собой сдвиг в сторону более мелких нейронов (рис. 2 c ). Также интенсивность сигнала мРНК увеличивалась после Axo (средний уровень серого мечения ± SEM: 15,0 ± 1,5 у контрольных крыс по сравнению с 24,2 ± 1,7 через 14 дней после Axo; n = 3, P <0.05).

Темные ( a - d ) и яркие ( e - m ) микрофотографии контрольного поля ( a , c , e , g и i - k ) и ипсилатеральные ( b , d , f , h , l и m ) L5 DRG крысы ( a , b , e , f и i - m ) и обезьяна ( c , d , g и h ), гибридизированные с зондами для Y2R ( a - i и l ), мРНК CGRP ( j ), Y1R ( k ) и NPY ( m ) через 14 дней после одностороннего перерезания седалищного нерва.( a - h ) Сильное мечение мРНК Y2R наблюдается во многих крупных нейронах DRG (стрелки в a и e ) и некоторых нейронах DRG среднего размера (стрелки на a и e ) в обычных DRG крыс. После Axo количество нейронов мРНК Y2R + увеличивается в ипсилатеральных DRG крысы (b ). Более мелкие (изогнутые стрелки), средние (стрелки) и большие (стрелки) нейроны экспрессируют мРНК Y2R ( b и f ).В нормальных DRG обезьян только несколько маленьких нейронов экспрессируют мРНК Y2R (стрелки в c и g ). Количество Y2R мРНК + малых (стрелки на d и h ) и больших (стрелки на h ) нейронов заметно увеличивается в ипсилатеральных DRG обезьяны через 14 дней после Axo. ( i - k ) Три смежных участка толщиной 5 мкм нормального DRG крысы показывают, что Y2R экспрессируется в мРНК CGRP + среднего и большого (стрелки) нейронов; однако маленькие нейроны, экспрессирующие Y1R и CGRP, не имеют Y2R (стрелки).( l и m ) Два смежных участка DRG ипсилатеральной крысы через 14 дней после Axo демонстрируют совместную локализацию мРНК Y2R и NPY во многих нейронах DRG большого и среднего размера (стрелки). Имеются некоторые мРНК NPY + больших нейронов, лишенные мРНК Y1R (стрелки на l и m ). (Полосы = 200 мкм в и - , d и 50 мкм в и - м .)

Процент мРНК Y2R + NP в контрольных, ипсилатеральных и контралатеральных DRG крыс через 2, 7, 14 и 21 день ( и ) после и у обезьян через 14 дней после перерезания седалищного нерва ( d ).Диапазон размеров мРНК Y2R + NP у крыс ( b ) и обезьян ( e ) контрольных DRG и у крыс ( c ) и обезьян ( f ) DRG через 14 дней после Axo. Данные представлены как среднее ± стандартная ошибка среднего. ∗, P <0,05; ∗∗, P <0,01 по сравнению с контролем.

В DRG нормальных обезьян ≈10% всех НЧ составляли мРНК Y2R + (рис.1 c и g и 2 d ), с резким увеличением после Axo (до 60%) (рис. .1 d и h и 2 d ). В нормальных DRG большинство НЧ мРНК Y2R + имели небольшой размер (500–1400 мкм 2 , пик на 700 мкм 2 ), в значительной степени перекрывающийся с распределением всех НЧ (рис. 2 и ). . После Axo произошел сдвиг в сторону более крупных Y2R мРНК + NP (рис. 2 f ). Только одиночные Y1R мРНК + NPs можно было наблюдать в нормальных и подвергнутых аксотомии DRG (данные не показаны).

В соседних срезах нормальных DRG толщиной 5 мкм мРНК Y2R наблюдалась в мРНК CGRP + средних и крупных НЧ (рис.1 i и j ) (34,2% НЧ содержали мРНК Y2R плюс CGRP, 0% только мРНК Y2R и 65,8% только мРНК CGRP; n = 82). Меньшее количество NP экспрессировало мРНК Y2R плюс SP, чем мРНК Y2R плюс CGRP (12,6% содержали мРНК Y2R плюс SP; 21,4% только мРНК Y2R; 66% только мРНК SP; n = 103). Колокализация мРНК Y2R и Y1R не наблюдалась ( n = 60) (рис. 1 i , j и k ). В ипсилатеральных DRG через 14 дней после Axo многие крупные NPs экспрессировали мРНК NPY и 41.8% подсчитанных мРНК NPY + содержали мРНК Y2R (рис.1 i и m ) (35,0% содержали мРНК Y2R плюс NPY; 16,3% только мРНК Y2R; 48,7% только мРНК NPY; n = 80). Иногда мРНК Y2R и Y1R можно было наблюдать в одних и тех же НЧ (2,4% содержали мРНК Y2R плюс Y1R; 55,4% только мРНК Y2R; 42,2% только мРНК Y1R; n = 83).

Вегетативные ганглии крыс.

МРНК

Y2R экспрессировалась в 0,5% НЧ в нормальных SCG (рис.3 a и d , и 4 a ). Через два дня после перерезки внутренних и наружных сонных нервов количество НЧ Y2R мРНК + заметно увеличилось ипсилатерально (рис.3 b и 4 a ) и достигло 40% всех НЧ через 7 дней после Axo (рис. . 3 c и e и 4 a ). Никаких заметных изменений в контралатеральных SCG обнаружено не было (рис. 4 и ). МРНК Y1R не была обнаружена в SCG нормальных крыс и / или после перерезки сонного нерва (данные не показаны).

Темный - ( a - c , f , g , l и m ) и светлый - ( d , e , h - k , n и o ) полевые микрофотографии контроля ( a , d , f , h , j , l , n и o ) и ипсилатеральные ( b , c , e , g , i , k и m ) SCG ( a - k ), NGs ( l - n ), и SPG ( o ) крыс, гибридизированных с зондами для Y2R ( a - e и l - n ), Y1R ( o ) и NPY ( f - i ). ) мРНК или иммуномеченых для NPY ( j и k ) 2 ( b ) или 7 ( c , e , g , i , k и м ) дней после односторонней перерезки обоих сонных нервов.Немногие нейроны содержат мРНК Y2R в нормальном SCG (стрелки в a и d ) с небольшим увеличением через 2 дня (стрелки в b ) и заметным увеличением через 7 дней после Axo (стрелки в c и e. ). Большинство нейронов в нормальных SCG содержат мРНК NPY (стрелки в f и h ) и NPY-подобную иммунореактивность (стрелки в j ). Интенсивность мечения мРНК NPY снижается в нейронах (стрелки в g и i ) в ипсилатеральном SCG через 7 дней после Axo.Количество нейронов NPY + в ипсилатеральном SCG заметно снижено (стрелки в k ). Многие нейроны в нормальном NG экспрессируют мРНК Y2R (стрелки на l и n ). Больше нейронов NG представляют собой мРНК Y2R + через 7 дней после Axo (стрелки на м ). МРНК Y1R экспрессируется в нейронах SPG (стрелки в o ). (Полосы = 200 мкм в a - c , f , g , l и m ; 50 мкм в d , e и h - l ; и 20 мкм в n и o .)

Процент мРНК Y2R + и мРНК NPY + NP ( a ) и серые уровни маркировки мРНК NPY ( b ) в SCG контрольных крыс и в ипсилатеральных и контралатеральных SCG 2, 7 и 14 после одностороннего перерезания сонного нерва. Процент мРНК Y2R + НЧ в NG ( c ) и в вентральных рогах спинного мозга ( d ) ипсилатеральной и контралатеральной стороны. Данные представлены как среднее + SEM. ∗, P <0.05; ∗∗, P <0,01 по сравнению с контролем.

В нормальных SCG 74% подсчитанных НЧ содержали мРНК NPY (Фиг.3 f и h , и 4 a ), со значительным увеличением (до 85%) через 7 дней после Axo (Фиг.3 g и i и 4 a ). Однако интенсивность мечения заметно снизилась (рис. 3 g и i и 4 b ). Это сопровождалось снижением NPY-подобной иммунореактивности, что привело к явному снижению количества положительных NP в ипсилатеральных SCG (рис.3 j и k ).

В нормальных NG около 50% всех НЧ экспрессировали мРНК Y2 (рис.3 -1 и n ), и небольшое увеличение наблюдалось через 7 (рис.3 m ) и 14 дней после Axo (рис.4 ). c ). В SPG 32,3% НЧ были мРНК Y1 + (фиг. 3 o ), но мРНК Y2 обнаружить не удалось (данные не показаны).

Спинальные мотонейроны крыс.

МРНК

Y2R была обнаружена в 15% подсчитанных профилей мотонейронов в нормальном спинном мозге (рис.4 д ). После седалищного разреза заметное увеличение количества профилей мотонейронов Y2R mRNA + наблюдалось ипсилатерально во всех исследованных временных интервалах (Фиг.4 , и 5).

Микрофотография вентрального рога спинного мозга крысы через 14 дней после Axo показывает мРНК Y2R + мотонейронов (стрелки). Стрелки указывают на мРНК-отрицательные мотонейроны Y2R. (Бар = 50 мкм.)

мРНК Y5.

МРНК

Y5 не была обнаружена в L5 DRG, SCG, SP, NG или спинном мозге крысы при нормальных обстоятельствах или после Axo (DRG, SCG и NG; данные не показаны).Однако этот зонд показал сигнал в нескольких областях мозга, включая гиппокамп.

ОБСУЖДЕНИЕ

Настоящие результаты демонстрируют, что субпопуляция в основном крупных нейронов в DRG крыс, составляющая около 15-20% всех NP, экспрессирует определяемые уровни мРНК Y2R при нормальных обстоятельствах в соответствии с предварительным отчетом Gustafsson et al . (30). Соответствующий показатель для НГ составляет около 50%. В SCG, преимущественно норадренергическом симпатическом ганглии, уровни Y2R при нормальных обстоятельствах очень низкие.Сигнал мРНК Y2R не обнаруживается в нормальном парасимпатическом SPG. У обезьяны 10% NP DRG представляют собой мРНК Y2R + , но подавляющее большинство является небольшим. В некоторых ганглиях Axo вызывает заметную повышающую регуляцию уровней мРНК Y2R с удвоением в НЧ DRG крыс, 6-кратным увеличением НЧ DRG обезьян и в SCG крыс около 40% НЧ теперь экспрессируют рецептор (вверх). от 0%). Также увеличивается мРНК Y2 в мотонейронах крыс (с 15 до 35% НЧ). Однако рост числа НГ был незначительным.Более того, во всех случаях уровни мРНК в отдельных нейронах повышены, что свидетельствует об увеличении синтеза и уровней рецепторного белка. Следует подчеркнуть, что наша методология может быть недостаточно чувствительной для обнаружения низких уровней мРНК Y2R, и поэтому мы недооцениваем возникновение Y2R. Настоящие результаты вместе с ранее опубликованными данными представлены в Таблице 1.

Рецепторы NPY в сенсорных и вегетативных ганглиях

Сенсорные ганглии.

В предыдущем исследовании на крысах периферический Axo вызывал заметное увеличение связывания 125 I-меченного пептида тирозин тирозина (PYY) над дорсальными корнями, а также над поверхностным и глубоким слоями дорсального рога (18). Конкурентные эксперименты показали, что это связывание в основном представляет собой Y2R. Эти находки и тот факт, что маленькие и большие нейроны проецируются, соответственно, в поверхностные и более глубокие пластинки дорсального рога, согласуются с настоящими результатами, показывая, что мРНК Y2 после Axo активируется как в малых, так и в больших нейронах.

Настоящие и предыдущие результаты показывают, что нейроны CGRP можно подразделить на две комплементарные субпопуляции: малые нейроны CGRP, экспрессирующие Y1R (21), и большие нейроны CGRP, экспрессирующие мРНК Y2 (настоящие данные). После Axo мы часто обнаруживали мРНК Y2R в крупных нейронах, также содержащих мРНК NPY. Также Y1R активируется в крупных нейронах после повреждения нерва (21). Однако четкое различие между этими двумя рецепторами состоит в том, что Y1R остаются в теле клетки в качестве соматических рецепторов (22), тогда как Y2R транспортируются централизованно к спинному рогу в больших количествах, особенно после Axo (18), что согласуется с их постулируемые роли в качестве пост- и пресинаптических рецепторов соответственно (6).Таким образом, после Axo Y2Rs могут действовать как ауторецепторы на первичных афферентах в дорсальном роге, помимо активации NPY, высвобождаемого из локальных нейронов дорсального рога (14). Сообщалось, что NPY ингибирует приток Ca 2+ в культивируемые нейроны DRG крысы через Y2R (31, 32) и ингибирует высвобождение SP с концов как in vitro , так и in vivo (19, 33). Спинальное введение NPY вызывает антиноцицептивные эффекты (34) и двухфазные эффекты на ноцицептивный сгибательный рефлекс (35).Ингибирующие эффекты NPY, возможно, могут быть усилены после Axo, потому что на сенсорных нейронах должно быть доступно больше рецепторов.

В настоящем исследовании наблюдались некоторые видовые различия между крысами и обезьянами. Y1R вряд ли нормально синтезируется в DRG обезьян или после Axo. Однако Y2R экспрессируется в небольших нейронах DRG, которые часто содержат CGRP и SP у нормальных обезьян (36). После Axo повышающая регуляция Y2R происходит как в малых, так и в крупных нейронах, и это более выражено у обезьян, чем у крыс.Это согласуется с результатами исследования связывания рецепторов, показывающими, что Y2R являются основными сайтами связывания NPY в поверхностном дорсальном роге спинного мозга нормальных обезьян и после Axo (18). NPY не был обнаружен в DRG нормальных обезьян, и только 2% нейронов экспрессируют NPY после Axo (36). Таким образом, у обезьян локальные нейроны в поверхностном дорсальном роге могут быть основным источником NPY, действующего на первичные афферентные терминалы, содержащие Y2Rs.

Автономные ганглии.

Настоящее исследование показывает, что Y2R обычно экспрессируется только на очень низких уровнях в SCG, предполагая, что этот пресинаптический ауторецептор (6) имеет лишь небольшое функциональное значение, и что NPY, высвобождаемый из симпатических нервных окончаний, может в основном действовать на постсинаптические рецепторы. Интересно, что в SPG не наблюдалось сигнала мРНК Y2R, которые вместо этого демонстрировали низкую экспрессию мРНК Y1R во многих нейронах.

Заметное увеличение мРНК Y2R наблюдалось в симпатических ганглиях после Axo рядом с телами клеток, параллельно со сниженными уровнями NPY.Кроме того, хотя большее количество нейронов продуцировало пептид NPY, уровни в отдельных нейронах снижались, о чем также сообщали другие (37). Функциональное значение увеличения «предсоединительных» рецепторов или симпатических нейронов после Axo неясно. Было показано, что NPY способствует периферической гипералгезии, воздействуя на предсоединительные Y2R на постганглионарных симпатических окончаниях (38), которые могут присутствовать в высоких уровнях на симпатических волокнах, регенерирующих после Axo.

В заключение, настоящие данные подтверждают мнение, что Y2R-опосредованные эффекты могут усиливаться после повреждения нерва.Это может предложить новые подходы к лечению, например, боли с помощью агентов, действующих на Y2R.

Благодарности

Мы благодарим докторов наук. J. Walsh и H. Wong (Центр исследований и образования язвы / Калифорнийский университет, Лос-Анджелес; при поддержке Национального института здравоохранения, грант DK 17294) за щедрое пожертвование антисыворотки к NPY. Эта работа поддержана Шведским советом по медицинским исследованиям (04X-2887), Марианн и Маркусом Валленбергами Штифтелсе, Густавом Висом и Дроттнингом Викториасом Штифтелсе, Astra Pain Control AB и Китайским фондом естественных наук (гранты 39525010 и 39500045).

Сноски

  • ↵ Кому запросы на переиздание следует направлять по адресу: Отдел неврологии / гистологии, Каролинский институт, 171 77, Стокгольм, Швеция. электронная почта: Tomas.Hokfelt neuro.ki.se.

  • Томас Хёкфельт

  • Сокращения: Axo, аксотомия; CGRP, пептид, родственный гену кальцитонина; DRG, ганглий дорзального корня; L, поясничный; мРНК + , мРНК-положительная; NP, профиль нейрона; NPY, нейропептид тирозин; Рецепторы YIR и Y2R, NPY1 и -2; СП, вещество Р; НГ, узловатые ганглии; SCGs, верхние шейные ганглии; SPGs, клиновидно-небные ганглии.

  • Принято 18 ноября 1996 г.
  • Авторские права © 1997, Национальная академия наук США

Коэффициенты корреляции

Коэффициенты корреляции Вернуться к содержанию

Прикладная статистика - Урок 5

Обзор урока

Корреляция

Распространенное использование слова корреляция относится к отношения между двумя или более объектами (идеи, переменные...). В статистике слово корреляция относится к соотношению между двумя переменными. Мы хотим иметь возможность количественно определить этих отношений, измерить их силы, разработайте уравнение для прогнозирования оценок и, в конечном итоге, делают проверяемый вывод о родительской популяции. Этот урок посвящен измерению его силы, с уравнением из следующего урока, и проверка выводов намного позже.

Примеры: одна переменная может быть количеством охотники в регионе, а другой переменной может быть популяция оленей.Возможно, с увеличением числа охотников популяция оленей уменьшается. Это пример отрицательной корреляции : как одна переменная увеличивается, другой уменьшается. Положительная корреляция - это то место, где две переменные реагируют одинаково, увеличиваясь или уменьшаясь вместе. Температура в градусах Цельсия и Фаренгейта имеет положительную корреляцию.

Pearson Product Moment

Как узнать, есть ли корреляция? Наблюдая за графиками, человек может определить, существует ли корреляция, по тому, как данные напоминают линию.Если точки разбросаны, то может быть , нет корреляции . Если точки будут точно соответствовать квадратное или экспоненциальное уравнение, и т. д. , тогда у них есть нелинейная корреляция . В этом курсе мы ограничимся линейными корреляциями и, следовательно, линейная регрессия. Поскольку данные почти линейны, их можно заключить в эллипс. Большая ось (длина) эллипса относительно малой оси (ширина) эллипса, являются показателем степени корреляции.

Как при осмотре определить тип корреляции?
Если график переменных представляет собой линию с положительным наклоном, то существует положительная корреляция ( x увеличивается по мере увеличения y ). Если наклон линии отрицательный, значит, имеется отрицательная корреляция. (поскольку x увеличивается, y уменьшается).

Важным аспектом корреляции является то, насколько сильное . Сила корреляции измеряется корреляцией коэффициент r .Другое название для r - корреляция момента произведения Пирсона . коэффициент в честь Карла Пирсона, который разработал его около 1900 года. Обычно используются как минимум три разные формулы чтобы вычислить это число и эти разные формулы несколько представляют разные подходы к проблеме. Однако такое же значение для r получается с помощью любой из различных процедур. Сначала мы приводим формулу необработанной оценки . n имеет обычное значение того, сколько упорядоченных пар находятся в нашей выборке. Также важно распознать разница между суммой квадратов и квадраты сумм!

Далее мы представляем формулу оценки отклонения . Эта формула ближе к истории развития поскольку он дает среднее перекрестное произведение стандартные оценки двух переменных, но в в вычислительном отношении более простой формат.

r = xy
sqrt ( x 2 y 2 )

Нам нужно сделать несколько замечаний относительно обозначений, поскольку x и y переменных в приведенной выше формуле были преобразованы из исходных переменных вычитая их средства.

Наконец, мы представляем ковариационную формулу , что является еще одним подходом.Ковариации обычно дается между двумя переменными, и это одна из причин, почему. (Следует отметить, что размер ковариации зависит от об единицах измерения, используемых для каждой переменной. Однако коэффициента корреляции нет.)

r = s xy
с x с y

r часто обозначается как r xy чтобы выделить две рассматриваемые переменные.Для выборок коэффициент корреляции представлен как r . а коэффициент корреляции для популяций обозначен греческой буквой ро (которая может выглядеть как p ). Имейте в виду, что коэффициент корреляции Спирмена ро также использует греческую букву ро, но обычно применяется выборкам и данным ранжируются (порядковые данные).

Чем ближе r к +1, тем сильнее положительная корреляция. Чем ближе r к -1, тем сильнее отрицательная корреляция.Если | r | = 1 точно, две переменные идеально коррелированы ! Температура в градусах Цельсия и Фаренгейта прекрасно коррелирует.

Формальная проверка гипотез может быть применена к r чтобы определить, насколько значим результат. Это тема Хинкля главы 17 и этот урок 12. Распределение Student t с n -2 степени свободы.

Помните, что корреляция не подразумевает причинно-следственной связи.

Нулевое значение для r не означает, что корреляции нет, может быть нелинейная корреляция. Также могут быть задействованы смешивающие переменные . Предположим, вы обнаруживают, что у майнеров скорость выше среднего рак легких. У вас может возникнуть соблазн немедленно заключить что их занятие является причиной, в то время как, возможно, регион имеет большое количество утечек радиоактивного газа радона из субземных регионов и все люди в этой области затронуты.А может, они заядлые курильщики ....

r 2 часто используется и называется коэффициент детерминации . Это доля вариации значений и . это объясняется регрессией наименьших квадратов y на x . Об этом мы поговорим подробнее в уроке 6. после введения наименьших квадратов.

Коэффициенты корреляции, величина которых находится в пределах от 0.9 и 1.0 указывают переменные, которые можно считать очень сильно коррелированными. Коэффициенты корреляции от 0,7 до 0,9 указывают переменные, которые можно считать сильно коррелированными. Коэффициенты корреляции от 0,5 до 0,7 указать переменные, которые можно считать умеренно коррелированными. Коэффициенты корреляции от 0,3 до 0,5 указывают переменные, которые имеют низкую корреляцию . Коэффициенты корреляции, величина которых меньше 0,3 имеют небольшую (линейную) корреляцию. Мы легко видим, что 0,9 < | r | <1,0 соответствует 0,81 < r 2 <1,00; 0,7 < | r | <0,9 соответствует 0,49 < r 2 <0,81; 0,5 < | r | <0,7 соответствует 0,25 < r 2 <0.49; 0,3 < | r | <0,5 соответствует 0,09 < r 2 <0,25; и 0,0 < | r | <0,3 соответствует 0,0 < r 2 <0,09.

Копейщик Ро для ранжированных / порядковых данных

Часто бывает так, что данные, которые мы хотим измерить, корреляцию для не является интервалом или уровнем отношения измерения. Был разработан коэффициент корреляции Спирмена ро. чтобы справиться с этой ситуацией.Это досадное исключение из общего правила, что Греческие буквы являются показателем численности населения! Есть и другие.

Формула для расчета ро Спирмена коэффициент корреляции следующий.

rho (p) = 1- 6 d 2
n ( n 2 -1)

n - количество парных рангов и d - разница парных рангов.Если нет равных баллов, коэффициент корреляции Спирмена ро будет еще ближе к коэффициенту корреляции момента произведения Пирсона. Также обратите внимание, что эту формулу можно легко понять, если Вы понимаете, что сумма квадратов от 1 до n может быть выражено как n ( n + 1) (2 n + 1) / 6. Отсюда можно реализовать наименьшую сумму d 2 равно нулю, а наибольшая сумма d 2 равна удвоенная сумма квадратов нечетных целых чисел до n /2, а затем масштабирует такую ​​сумму от -1 до +1.

Пример: Предположим, у нас есть результаты тестов. из 110, 107, 100, 96, 89, 78, 67, 66 и 49. Они соответствуют рангам с 1 по 9. Если бы были дубликаты, то пришлось бы найти средний рейтинг для дубликатов и замените это значение на наши ряды. Соответствующие итоговые оценки первой страницы были: 29, 32, 27, 29, 25, 25, 21, 26, 22. Таким образом, эти ранги следующие: 2,5, 1, 4, 2,5, 6,5, 6,5, 9, 5, 8. (Обратите внимание, что если мы изменили порядок, присвоение рангов от низкого к высокому вместо высокого к низкому, в результате Коэффициент корреляции Спирмена Ро изменил бы знак на противоположный.)

На основе информации, представленной выше, мы составили таблицу ниже. Мы добавили дополнительные столбцы d и d 2 для простоты расчета Spearman rho. Используя формулу Спирмена ро, получаем 1-6 (24) / (9 (80)) = 0,80.

Итого ( x ) стр. 1 ( y ) x ранг y ранг d d 1 2 9089 9089 x 2 y 2
110 29 1 2.5 -1,5 2,25 3190 12100 841
107 32 2 1 1 1 3424 11449 1024
100 27 3 4 -1 1 2700 10000 729
96 29 4 2.5 1,5 2,25 2784 9216 841
89 25 5 6,5 -1,5 2,25 2225 7921 625
78 25 6 6,5 -0,5 0,25 1950 6084 625
67 21 7 9 -2 4 1407 4489 441
66 26 8 5 3 9 1716 4356 676
49 22 9 8 1 1 1078 2401 484
--- --- ----- ---- ----- ----- ----
762 236 : суммы: 0 24 20474 68016 6286
Мы добавили дополнительные столбцы xy , x 2 , и y 2 , чтобы упростить расчет коэффициент корреляции момента произведения Пирсона.Использование формулы исходной оценки для момента произведения Пирсона коэффициент корреляции получаем (9 × 20474-762 × 236) / sqrt ((9 × 68016-762 2 ) (9 × 6286-236 2 ) = 0,843. r 2 = 0,71 что означает 71% отклонения от до объясняется изменением в x . Также верно и, возможно, более полезно знать, что та же самая корреляция Коэффициент получается при замене x и y .Однако в результате получится другое уравнение. Возможно, имеет смысл использовать результаты первой страницы чтобы предсказать окончательный результат теста, а не наоборот!

Факторы, влияющие на размер

r Мы рассмотрели теперь, как рассчитать r , что означают разные значения, но это тоже важно понять, какие факторы на это влияют. Во-первых, помните, имеет смысл только вычислить коэффициент корреляции, если данные парных наблюдений измерений на интервале или шкала соотношения.Далее, поскольку здесь мы имеем дело только с линейными корреляция, момент произведения Пирсона коэффициент корреляции недооценивает отношения, если есть криволинейные отношения. Перед вычисление любых коэффициентов корреляции, а затем продолжайте, только если корреляция достаточно сильна.

По мере того, как однородность группы увеличивается, дисперсия уменьшается, а величина коэффициент корреляции стремится к нулю.{\ large \ frac {3} {2} \ normalsize}}}} = 2,} \; \; \; \ kern-0.3pt
{R = \ frac {1} {K} = \ frac {1} {2}.}
\]

Пример 3.

Найдите кривизну и радиус кривизны кривой \ (y = \ cos mx \) в точке максимума.

Решение.

Эта функция достигает максимума в точках \ (x = {\ large \ frac {{2 \ pi n}} {m} \ normalsize}, \; n \ in Z. \) По периодичности кривизна вообще Максимум точек одинаков, поэтому достаточно рассмотреть только точку \ (x = 0.{\ large \ frac {1} {2} \ normalsize}}.}
\]

Ограничиваясь первой дугой циклоиды, т.е. интервалом \ (0 \ le t \ le 2 \ pi, \), получаем следующее выражение для радиуса кривизны циклоиды:

\ [R = 4a \ sin \ frac {t} {2}. \]

Отсюда следует, что радиус кривизны имеет максимум в \ (t = \ pi. \) Его значение в этой точке \ ({R _ {\ max}} = 4a. \)

Пример 8.

Определите кривизну кривой \ (y = \ arctan x \) в точке \ (x = 0 \) и на бесконечности.{\ large \ frac {3} {2} \ normalsize}}}}.}
\]

Как видно, в точке \ (x = 0 \) кривизна равна нулю: \ (K \ left (0 \ right) = {K_0} = 0. \)

В этом случае точка \ (x = 0 \) является точкой перегиба функции \ (y = \ arctan x. \) Поскольку вторая производная равна нулю в любой точке перегиба, кривизна здесь также должна быть равна к нулю, что совпадает с полученным решением.

Рассчитайте значение кривизны \ ({K _ {\ infty}} \) в пределе как \ (x \ to \ infty: \)

\ [
{{K_ \ infty} = \ lim \ limits_ {x \ to \ infty} K \ left (x \ right)}
= {\ lim \ limits_ {x \ to \ infty} \ frac {{2x \ left ({1 + {x ^ 2}} \ right)}} {{{{\ left [{{{{\ left ({1 + {x ^ 2}} \ right)} ^ 2} + 1} \ справа]} ^ {\ large \ frac {3} {2} \ normalsize}}}}}
= {\ lim \ limits_ {x \ to \ infty} \ frac {{2 {x ^ 3} + 2x}} {{{{\ left ({{x ^ 4} + 2 {x ^ 2} + 2} \ right)} ^ {\ large \ frac {3} {2} \ normalsize}}}}}
= {\ lim \ limits_ {x \ to \ infty} \ frac {{\ frac {{2 {x ^ 3} + 2x}} {{{x ^ 6}}}}}} {{\ frac {{{{\ left ( {{x ^ 4} + 2 {x ^ 2} + 2} \ right)} ^ {\ large \ frac {3} {2} \ normalsize}}}} {{{x ^ 6}}}}}}
= {\ lim \ limits_ {x \ to \ infty} \ frac {{\ frac {2} {{{x ^ 3}}} + \ frac {2} {{{x ^ 5}}}}} { {{{\ left ({\ frac {{{x ^ 4} + 2 {x ^ 2} + 2}} {{{x ^ 4}}}} \ right)} ^ {\ large \ frac {3} {2} \ normalsize}}}}}
= {\ lim \ limits_ {x \ to \ infty} \ frac {{\ frac {2} {{{x ^ 3}}}} + \ frac {2} {{ {x ^ 5}}}}} {{{{\ left ({1 + \ frac {2} {{{x ^ 2}}}} + \ frac {2} {{{x ^ 4}}}}} \ справа)} ^ {\ large \ frac {3} {2} \ normalsize}}}}}
= {\ frac {0} {1} = 0. {\ frac {3 } {2}}}}}.{\ frac {3} {2}}}}}.} \]

Обратите внимание, что если степень \ (n \) является дробной, основания в параметрических уравнениях (функции синуса и косинуса) должны быть определены положительно. Это накладывает ограничения на параметр \ (t, \), который изменяется в диапазоне \ (0 \ lt t \ lt \ large {\ frac {\ pi} {2}} \ normalsize. \)

Эту задачу предложил Джон Эрбес. Мы очень благодарны за это!

ответов на викторину 1-4

ответов на викторину 1-4

Ответы на викторину 1-4

Вопрос 1. Вектор b представляет собой линейную комбинацию столбцов матрицы A есть и только тогда, когда уравнение Ax = b имеет хотя бы одно решение.

Ответ: Верно. Это два способа сказать одно и то же.


Вопрос 2. Уравнение Ax = b непротиворечиво, если расширенная матрица [A b] имеет позицию поворота в каждой строке.

Ответ: Неверно. Система несовместима, если [A b] имеет стержень в последний («б») столбец.м находится в промежутке столбцов, что является другим способом сказать, что любой b является линейное сочетание столбцов. Тогда уравнение непротиворечиво (см. Вопрос 1).


Вопрос 4 . Если уравнение Ax = b несовместимо, то b не входит в набор, охваченный столбцами A.

Ответ: Верно.


Вопрос 5. Множество решений линейной системы, расширенная матрица которой is [a b c d] то же самое, что и множество решений Ax = d, где A = [a b c].4. Что из следующего верно?

Ответ: Пусть x = x1 + x2. Тогда Ax = A (x1 + x2) = Ax1 + Ax2 = y1 + y2 на дистрибутивность умножения матриц (см. задачу 35). Таким образом, x является решение Ax = y, без дополнительной информации. Однако x не обязательно общее решение, поскольку Ax = y может иметь бесконечное число решений.

Назад к математике 308A, неделя 2, стр.

Функция

mvrnorm | R Документация

Детали

Для обеспечения репликации сделано очень небольшое изменение.Код в MASS :: mvrnorm рисует случайную выборку и заполняет матрицу по столбцу, а затем эта матрица раскладывается. Перемена реализованный здесь заполняет эту матрицу по строкам, и проблема в том, что устранено.

Замечены некоторые особенности при изменении ковариационной матрицы от диагональной матрицы к более общей симметричной матрице (ненулевые элементы недиагональные). Когда ковариация строго диагональ, то только один столбец смоделированной многомерной обычные данные будут реплицированы, а другие - нет.Это очень неприятные последствия для моделирования, которое рисует образцы различных размеров, а затем основывать расчеты на отдельных смоделированных столбцы (т.е. одни столбцы идентичны, другие полностью некоррелированный).

Примеры
  # NOT RUN {
библиотека (МАССА)
библиотека (рокчелк)

set.seed (12345)
X0 <- МАССА :: mvrnorm (n = 10, mu = c (0,0,0), Sigma = diag (3))
## создать меньший набор данных, начиная с той же позиции
set.seed (12345)
X1 <- МАССА :: mvrnorm (n = 5, mu = c (0,0,0), Sigma = diag (3))
## Создайте больший набор данных
набор.семя (12345)
X2 <- МАССА :: mvrnorm (n = 15, mu = c (0,0,0), Sigma = diag (3))
## Первые 5 строк в X0, X1 и X2 не совпадают
X0
X1
X2
set.seed (12345)
Y0 <- mvrnorm (n = 10, mu = c (0,0,0), Sigma = diag (3))
set.seed (12345)
Y1 <- mvrnorm (n = 5, mu = c (0,0,0), Sigma = diag (3))
set.seed (12345)
Y2 <- mvrnorm (n = 15, mu = c (0,0,0), Sigma = diag (3))
# обратите внимание, что результаты в первых 5 строках совпадают:
Y0
Y1
Y2
идентичные (Y0 [1: 5,], Y1 [1: 5,])
идентичные (Y1 [1: 5,], Y2 [1: 5,])

myR <- lazyCor (X = 0,3, d = 5)
mySD <- c (0.5, 0,5, 0,5, 1,5, 1,5)
myCov <- lazyCov (Rho = myR, Sd = mySD)

set.seed (12345)
X0 <- МАССА :: mvrnorm (n = 10, mu = rep (0, 5), Sigma = myCov)
## создать меньший набор данных, начиная с той же позиции
set.seed (12345)
X1 <- МАССА :: mvrnorm (n = 5, mu = rep (0, 5), Sigma = myCov)
X0
X1
## 'set.seed (12345)
Y0 <- rockchalk :: mvrnorm (n = 10, mu = rep (0, 5), Sigma = myCov)
## создать меньший набор данных, начиная с той же позиции
set.seed (12345)
Y1 <- rockchalk :: mvrnorm (n = 5, mu = rep (0, 5), Sigma = myCov)
Y0
Y1

#}
  

Примеры сообщества

Похоже, примеров пока нет.

The SpaceR3

Если три взаимно перпендикулярных копии реальной линии пересекаются в своих началах, любая точка в результирующем пространстве определяется упорядоченной тройной действительных чисел ( x 1 , x 2 , х 3 ). Набор всех упорядоченных троек действительных чисел называется 3-пробел , обозначается R 3 («R три»).См. Рисунок.


Рисунок 1

Операции сложения и скалярного умножения, указанные в R 2 , переносятся на R 3 :

Векторы в R 3 называются 3-векторами (потому что есть 3 компонента), и геометрические описания сложения и скалярного умножения, данные для 2-векторов, также переносятся на 3-векторы.

Пример 1 : Если x = (3, 0, 4) и y = (2, 1, −1), то

Стандартные базисные векторы в R 3 .Поскольку для любого вектора x = ( x 1 , x 2 , x 3 ) в R 3 ,

стандартные базисные векторы в R 3 - это

Любой вектор x в R 3 , следовательно, может быть записан как

См. Рисунок.


Рисунок 2

Пример 2 : Какой вектор нужно добавить к a = (1, 3, 1), чтобы получить b = (3, 1, 5)?

Пусть c - искомый вектор; тогда a + c = b .Следовательно,

Обратите внимание, что c - это вектор ab ; см. рисунок.


Рисунок 3

Перекрестное произведение . До сих пор вы видели, как можно складывать (или вычитать) два вектора и как вектор умножается на скаляр. Можно ли как-то «умножить» два вектора? Один из способов определить произведение двух векторов - который выполняется только с векторами в R 3 - состоит в том, чтобы сформировать их перекрестное произведение .Пусть x = ( x 1 , x 2 , x 3 ) и y = ( y 1 , y 03 2 , 3 ) быть двумя векторами в R 3 . Перекрестное произведение (или векторное произведение ) x и y определяется следующим образом:

Перекрестное произведение двух векторов является вектором, и, возможно, наиболее важной характеристикой этого векторного произведения является то, что оно перпендикулярно обоим факторам .(Это будет продемонстрировано при введении скалярного произведения.) То есть вектор x x y будет перпендикулярен как x , так и y ; см. рисунок. [Здесь есть двусмысленность: плоскость на рисунке, содержащая векторы x и y , имеет два перпендикулярных направления: «вверх» и «вниз». Какой из них выбирает кросс-произведение? Ответ дает правило правой руки : поместите запястье правой руки в общую начальную точку x и y , указав пальцами вдоль x ; когда вы сгибаете пальцы в направлении x , ваш большой палец будет указывать в направлении x x y .Это показывает, что перекрестное произведение антикоммутативно: y x x = - ( x x y ).]


Рисунок 4

Длина вектора x = ( x 1 , x 2 , x 3 ) в R 3 , что обозначается ∥ x ∥ , задается уравнением

результат, который следует из теоремы Пифагора (см. Обсуждение перед рисунком ниже).В то время как направление векторного произведения x и y определяется ортогональностью и правилом правой руки, величина (то есть длина) x x y равна площади параллелограмма, натянутого на векторы x и y .

Так как площадь параллелограмма на рисунке

выполняется следующее уравнение:

, где θ - угол между x и y .


Рисунок 5

Пример 3 : Пусть x = (2, 3, 0) и y = (−1, 1, 4) будут векторами положения в R 3 . Вычислите площадь треугольника, вершины которого являются началом и конечными точками x и y , и определите угол между векторами x и y .

Так как площадь треугольника составляет половину площади параллелограмма, охватываемого x и y ,

Теперь, поскольку ‖ x x y ‖ = ‖ x ‖ · ‖ y ‖ sin θ, угол между x и y равен

Следовательно, θ = sin −1 √233 / 234.


Как выполнить T-тесты в R

Чтобы провести t-тест с одной выборкой в ​​R, мы используем синтаксис t.test (y, mu = 0) , где x - имя нашей переменной. представляет интерес, а mu устанавливается равным среднему значению, заданному нулевой гипотезой.

Так, например, если мы хотим проверить, был ли объем партии пиломатериалов меньше обычного (\ (\ mu_0 = 39000 \) кубических футов), мы должны запустить:

 set.seed (0)
treeVolume <- c (rnorm (75, среднее = 36500, sd = 2000))
т.test (treeVolume, mu = 39000) # Ho: mu = 39000
 
Один образец t-теста

данные: treeVolume
t = -12,2883, df = 74, значение p <2,2e-16
альтернативная гипотеза: истинное среднее не равно 39000
95-процентный доверительный интервал:
 36033,60 36861,38
примерные оценки:
среднее значение x
 36447,49
  

С помощью этих смоделированных данных мы видим, что текущая партия пиломатериалов имеет значительно меньший объем, чем мы обычно видим:

  t = -12,2883, p-значение <2,2e-16  

Парные образцы T- Тесты

Для проведения теста с парными выборками нам нужны либо два вектора данных, \ (y_1 \) и \ (y_2 \), либо один вектор данных со вторым, который служит в качестве переменной двоичной группировки.Затем тест запускается с использованием синтаксиса t.test (y1, y2, paired = TRUE) .

Например, предположим, что мы работаем в крупной клинике и тестируем новый препарат прокардия, предназначенный для снижения гипертонии. Мы находим 1000 человек с высоким систолическим артериальным давлением (\ (\ bar {x} = 145 \) мм рт. Ст., \ (SD = 9 \) мм рт. Ст.), Мы даем им прокардию на месяц, а затем снова измеряем их артериальное давление. Мы обнаружили, что среднее систолическое артериальное давление снизилось до 138 мм рт. Ст. Со стандартным отклонением 8 мм рт. Ст.

Мы можем визуализировать эту разницу с помощью графика плотности ядра как:

Здесь мы бы провели t-тест, используя:

 set.seed (2820)

preTreat <- c (rnorm (1000, среднее = 145, sd = 9))
postTreat <- c (rnorm (1000, среднее = 138, sd = 8))

t.test (preTreat, postTreat, paired = ИСТИНА)
 
Парный t-тест

данные: preTreat и postTreat
t = 19,7514, df = 999, значение p <2,2e-16
Альтернативная гипотеза: истинная разница в средних не равна 0
95-процентный доверительный интервал:
 6.703959 8,183011
примерные оценки:
среднее значение различий
               7,443485
  

Опять же, мы видим, что существует статистически значимая разница в средних для

  t = 19,7514, p-значение <2,2e-16  

Независимые выборки

Тест независимых выборок может принимать одну из трех форм , в зависимости от структуры ваших данных и равенства их дисперсий. Общая форма теста: t.test (y1, y2, paired = FALSE) .По умолчанию R предполагает, что дисперсии y1 и y2 неравны, таким образом, по умолчанию используется тест Велча. Чтобы переключить это, мы используем флаг var.equal = TRUE .

В трех показанных здесь примерах мы проверим гипотезу о том, что жители Кливлендера и Нью-Йорка ежемесячно тратят разное количество еды вне дома. В первом примере предполагается, что у нас есть два числовых вектора: один с расходами Кливлендера, а другой с расходами жителей Нью-Йорка. Во втором примере используется двоичная группирующая переменная с одним столбцом данных о расходах.(То есть есть только один столбец данных о расходах; однако для каждой суммы в долларах в следующем столбце указывается, принадлежит ли он жителю Нью-Йорка или жителю Кливленда.) Наконец, в третьем примере предполагается, что дисперсии двух выборок равны неравно и использует критерий Велча.

t-критерий независимых выборок, где y1 и y2 числовые:

 set.seed (0)

ClevelandSpending <- rnorm (50, среднее = 250, стандартное отклонение = 75)
Нью-Йоркские расходы <- rnorm (50, среднее = 300, стандартное отклонение = 80)

t.test (ClevelandSpending, NYSpending, var.равно = ИСТИНА)

  Двухвыборочный t-критерий

данные: ClevelandSpending и NYSpending
t = -3,6361, df = 98, значение p = 0,0004433
Альтернативная гипотеза: истинная разница в средних не равна 0
95-процентный доверительный интервал:
 -77,1608 -22,6745
примерные оценки:
среднее значение x среднее значение y
 251.		

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *