Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Содержание

Колонки Sven SPS-705 2.0 черный 40Вт

Характеристики

Бренд

SVEN

Объем

0. 029

Вес

6

Колонки 2.0 SVEN SPS-705 / 2×20W / дерево /black (SV-014254)

3 990 руб руб за 1 шт

Способы получения товара:

  • Завтра
  • Завтра с 14:00

Способы оплаты

компьютерная акустика стерео; суммарная мощность 40 Вт; двухполосные колонки; материал корпуса колонок: MDF; диапазон частот 40 – 22000 Гц; Bluetooth; разъем для наушников

Основные характеристики

Диапазон воспроизводимых частот

40-22000 Гц

Материал корпуса фронтальных колонок/сателлитов

MDF

Суммарная мощность

40 Вт

Внимание! Характеристики и комплектация товаров могут быть изменены фирмой-производителем без предварительного уведомления.

Перед покупкой уточняйте важные для Вас технические характеристики и комплектацию у продавца. Если вы заметили ошибку, то пожалуйста, сообщите нам об этом.

Похожие товары

Персональные рекомендации

Плата усилителей акустики Sven SPS-705 | Festima.Ru

Bыcoкоcкoрoстной стабильный бeзлимитный интеpнет 3G 4G LTE Wi-Fi в oфис за гoрод, нa дaчу, в квapтиpу и частный дом кoттeдж Бeзлимитный интернeт Mегафoн, MTС, Билайн, Teлe2 и CУПEPтapифы Бюджeтные тapифы для вceх Bcе вoпрocы обязательнo задaвaйте здеcь на сайтe или в мecсeнджерax, пoмoгу c выбором! Абон плата от 6 р/сут ОФИЦИАЛЬНО подключаем к тарифам для всей РФ дистанционно.  Почему стоит купить у именно меня? 1. Цены ниже чем в магазине 2. Официальный магазин, открыто ИП 3. Бесплатная консультация и поддержка 4. Оплата наличными, картой 5. Работаю с физическими лицами, ИП и ООО 6. Комплект можно установить самостоятельно. 7. Помогу с подбором направления на самую подходящую базовую станцию и выбором оператора.

Мобильный интернет, интернет за город, интернет для видеонаблюдения, интернет в организацию, интернет для ИП Не ловит связь, усилить связь, усиление сотовой связи, мегафон, мтс, билайн, теле2, ростелеком. Связь в подвале, связь на даче, связь на складе, удаленный район, плохое покрытие, не пропускают сигнал КАК ЗАБРАТЬ – самовывоз Ф.Мир, Дом Печати (по звонку/смс/вотсапп 10-22ч без вых) а также по договоренности в центре и других районах ДОСТАВКА – возможна доставка до любого пункта выдачи сдек (более 30 пунктов по городу) или на адрес – также отправка в область и по России, СНГ почтой или транспортной компанией СДЕК, Деловые Линии (стоимость от 150 руб за посылку) КАК ЗАКАЗАТЬ – звоните 10-22ч – пишите SМS или на whаtsарр (в любое время) – пишите сообщение в авито (в любое время) inst: skysim_ Vk: simсаrtаufа установка и настройка 4g интернет, wi fi приемник, точка доступа wi-fi роутер, мощный wifi роутер, интернет провод, комплект спутниковый интернет, интернет центр yоtа, интернет-центр yоtа 2, высокоскоростной интернет на дачу, usb wi fi репитер, wi fi роутер, подключение интернета в частный дом, безлимитный интернет на даче, для ноутбука, усилитель 3 g сигнала интернета для дачи, tеlе2 (теле 2,теле2), провод для интернета, кабель для интернета, безлимитный интернет 4g мегафон (mеgаfоn интернет), купить усилитель сотового и интернет сигнала, йота, LТЕ интернет в частный дом, для телевизора, wi-fi rоutеr, интернет- центр yоtа 2, iр tv, комплекты для 4 g интернета, установка безлимитного интернета, билайн (bееlinе),мтс ltе, модуль wi-fi, антенна для интернета 4g для дачи, интернет за городом 4g, усилитель мобильного интернета, проводной интернет, интернет кабель, интернет антена, для смартфона и планшета, подключение интернета на даче, сетевой кабель для интернета, безлимитный интернет мегафон, комплект оборудования для интернета на дачу 4g, вай фай, ви фи, бесшовный wifi для компьютера пк, для видеонаблюдения, спутниковая тарелка интернет, интернет в коттедж, комплект интернет для дачи 3g, безлимитный интернет для модема без ограничения трафика, вай фай адаптер, шнур для интернета, спутниковый интернет мтс, спутниковое тв мтс интернет, оборудование для интернета, направленная антенна wifi, настройка wi fi, триколор интернет, 4g usb модем с безлимитным интернетом, интернет шнур, усилитель сигнала сотовой связи и интернета, комплект wifi интернет антенна, усилитель сотовой связи и интернета, интернет в загородный дом, интернет тв приставка, подключение к интернету, безлимитный интернет, бесплатный интернет

Комьютерные аксессуары и комплектующие

Поляризация человеческих макрофагов интерлейкином-4 не требует АТФ-цитрат-лиазы

Front Immunol. 2018; 9: 2858.

Дмитрий Намгаладзе

1 Медицинский факультет, Институт биохимии I, Университет Гете, Франкфурт, Германия

Свен Зукунфт

2 Центр молекулярной медицины, Институт сосудистых сигналов, Гете- Университет, Франкфурт, Германия

Франк Шнютген

3 Медицинский факультет 2, Центр клеточной и генной терапии LOEWE и Франкфуртский онкологический институт, Университетская клиника Франкфурта, Университет Гете, Франкфурт, Германия

Нина Куррле

3 Медицинский факультет 2, Центр клеточной и генной терапии LOEWE и Франкфуртский онкологический институт, Университетская клиника Франкфурта, Университет Гете, Франкфурт, Германия

Ингрид Флеминг

2 Центр молекулярной медицины, Институт сосудистых сигналов, Гете- Университет, Франкфурт, Германия

Доминик Фурманн

1 Медицинский факультет, Институт Ute of Biochemistry I, Университет Гете, Франкфурт, Германия

Бернхард Брюне

1 Медицинский факультет, Институт биохимии I, Университет Гете, Франкфурт, Германия

4 Проектная группа Трансляционная медицина и фармакология TMP, Институт молекулярной биологии и прикладной экологии им. Фраунгофера, IME, Франкфурт, Германия

1 Медицинский факультет, Институт биохимии I, Университет Гете, Франкфурт, Германия

2 Центр молекулярной медицины, Институт сосудистых сигналов, Goethe-University, Франкфурт, Германия

3 Медицинский факультет 2, Центр клеточной и генной терапии LOEWE и Франкфуртский онкологический институт, Университетская клиника Франкфурта, Университет Гете, Франкфурт, Германия

4 Project Group Трансляционная медицина и Фармакология TMP, Институт молекулярной биологии и прикладной экологии им. Фраунгофера, IME, Франкфурт, Германия 9000 3

Отредактировал: Александр Кортей, Университетская больница Осло, Норвегия

Рецензировал: Тарсио Теодоро Брага, Федеральный университет Параны, Бразилия; Ян Дрансфилд, Эдинбургский университет, Соединенное Королевство; Чарльз Роберт Браун, Университет Миссури, США

Эта статья была отправлена ​​в раздел «Молекулярный врожденный иммунитет» журнала «Границы в иммунологии»

Поступила в редакцию 20 сентября 2018 г . ; Принята в печать 20 ноября 2018 г.

Авторские права © 2018 Намгаладзе, Зукунфт, Шнютген, Куррле, Флеминг, Фурманн и Брюне.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Макрофаги, подвергшиеся воздействию цитокинов Th3, интерлейкина (ИЛ) ИЛ-4 и ИЛ-13, демонстрируют отчетливый транскрипционный ответ, обычно называемый поляризацией М2. Недавно IL-4-индуцированная поляризация макрофагов, происходящих из костного мозга мыши (BMDM), была связана с уровнями ацетил-КоА через активность цитозольного ацетил-КоА-генерирующего фермента АТФ-цитратлиазы (ACLY). Здесь мы изучили, как ACLY регулирует экспрессию генов, стимулированную IL-4, в макрофагах, происходящих из моноцитов человека (MDM).Хотя множественные ингибиторы ACLY ослабляли индуцированную IL-4 экспрессию целевого гена, этот эффект нельзя было воспроизвести путем подавления экспрессии ACLY. Кроме того, ингибирование ACLY не влияло на клеточные уровни ацетил-КоА и ацетилирование гистонов. Мы генерировали макрофаги THP-1 человека с нокаутом ACLY с использованием технологии CRISPR / Cas9. В то время как эти клетки демонстрировали пониженные уровни ацетилирования гистонов, индуцированная IL-4 экспрессия генов оставалась неизменной. Поразительно, но ингибиторы ACLY по-прежнему подавляли индукцию генов-мишеней с помощью IL-4 в клетках, нокаутированных по ACLY, что указывает на нецелевые эффекты этих препаратов.Наши результаты предполагают, что ACLY не может быть основным регулятором нуклеоцитоплазматической ацетил-КоА и поляризации, вызванной IL-4, в макрофагах человека. Кроме того, следует проявлять осторожность при интерпретации влияния фармакологического ингибирования ACLY на экспрессию генов.

Ключевые слова: макрофаг, АТФ-цитратлиаза, ацетил-КоА, интерлейкин-4, ацетилирование гистонов

Введение

Макрофаги реагируют на изменения в окружающей их среде, такие как бактериальная или вирусная инфекция, гормоны, цитокины или питательные вещества, с ремоделированием их транскриптома.Следовательно, они изменяют свой фенотип – реакция, известная как поляризация макрофагов (1). Исторически поляризация макрофагов описывалась дихотомическим образом с провоспалительным ответом на бактериальный липополисахарид в сочетании с цитокиновым интерфероном-γ Th2 (ответ M1) в отличие от противовоспалительного ответа, вызываемого цитокинами Th3 интерлейкина-4 (IL- 4) или IL-13 (ответ M2) (2–4).

Ответы M1 и M2 заметно различаются не только по задействованным сигнальным путям, но и по тому, как они задействуют различные метаболические пути (5).Хотя метаболизм в первую очередь служит источником энергии и субстратов для поддержки функциональных ответов макрофагов, например фагоцитоза, некоторые метаболиты напрямую влияют на транскрипцию через эпигенетические механизмы (6). Ацетил-КоА представляет собой метаболит, играющий особую роль в эпигенетической и транскрипционной регуляции, поскольку он широко используется в качестве субстрата для ацетилирования гистонов и других белков, включая факторы транскрипции (7). Хотя несколько реакций обеспечивают ацетил-КоА для ацетилирования гистонов, считается, что АТФ-цитратлиаза (ACLY) преимущественно вносит вклад в ядерный пул ацетил-КоА (8).Роль ACLY в эпигенетическом контроле была первоначально описана для раковых клеток (9), где ACLY критически поддерживает липогенез de novo и, таким образом, пролиферацию клеток (10, 11). Дальнейшие исследования сообщили об эпигенетической регуляции посредством ACLY в адипоцитах (9, 12) или миоцитах (13).

Недавно было показано, что ACLY регулирует транскрипционные ответы на IL-4 в макрофагах, происходящих из костного мозга мышей (BMDM) (14). IL-4 запускает Akt-опосредованное фосфорилирование серина ACLY, что, как предполагается, увеличивает ферментативную активность ACLY (15, 16). Соответственно, фармакологическое ингибирование Akt или ACLY предотвращало индукцию субнабора IL-4-чувствительных мРНК, что было связано со снижением ацетилирования гистонов на промоторах ACLY-чувствительных генов (14). Как ACLY регулирует реакцию макрофагов человека на IL-4, неизвестно.

Поскольку мы ранее заметили значительные различия в метаболических потребностях макрофагов человека и мыши в отношении поляризации, индуцированной IL-4 (17), мы поставили под сомнение роль ACLY в регуляции ответов макрофагов, происходящих из моноцитов человека (MDM), на IL-4.Наши данные показывают, что ACLY мало влияет на регуляцию транскрипции генов, чувствительных к IL-4. Неожиданно мы наблюдали широко распространенное ингибирование индуцированной IL-4 экспрессии целевого гена фармакологическими ингибиторами ACLY, которое сохранялось в макрофагах THP-1, нокаутировавших ACLY, что предполагает нецелевые эффекты этих веществ.

Экспериментальные процедуры

Культивирование и обработка клеток

Мононуклеарные клетки периферической крови человека были выделены из коммерчески приобретенных лейкоцитов (DRK Blutspendedienst Baden-Württemberg-Hessen, Institut für Transfusionsmedizin und Immunhämatologie, Франкфурт-на-Майне, Германия) с использованием Für Transfusionsmedizin und Immunhämatologie, Франкфурт-на-Майне, Германия). нет. L6115) центрифугирование плотности. Моноциты отделяли от лимфоцитов прикреплением к пластику после 1 ч инкубации в бессывороточной среде и дифференцировали в макрофаги путем культивирования в среде RPMI-1640 (Gibco, каталожный номер 61870), содержащей 3% инактивированных нагреванием AB-положительных людей. сыворотка 7–10 дней. Клетки THP-1 были приобретены в ATCC (каталожный номер TIB-202) и сохранены в среде RPMI-1640, содержащей 10% фетальной бычьей сыворотки, пенициллин и стрептомицин. Клетки THP-1 были дифференцированы в макрофаги посредством 24-часовой обработки 50 нМ форболмиристатацетатом (Sigma-Aldrich, cat.нет. P8139) с последующим культивированием в течение ночи в бессывороточной среде. Если не указано иное, клетки обрабатывали 5 мкМ BMS-303141 (каталожный номер 4609), 25 мкМ SB 204990 (каталожный номер 4962) (оба Tocris), 100 мкМ MEDICA 16 (каталожный номер M5693), 20 мМ гидроксицитрат (номер по каталогу 59847), 5 мМ ацетат натрия (номер по каталогу S2889), 5 мМ октаноат натрия (номер по каталогу C5038), 1,2,3-бензолтрикарбоновая кислота (номер по каталогу 51520). ), Ингибитор CTP (каталожный номер SML0068) (все Sigma-Aldrich), 5 мкг / мл TOFA (каталожный номер 10005263) (Cayman), 20 нг / мл IL-4 (кат.нет. 200-04) или ИЛ-13 (кат. № 200-13) (Peprotech).

Выделение и анализ РНК

Общую РНК из макрофагов выделяли с использованием набора PeqGold RNAPure (каталожный номер 732-3312, PeqLab) с последующей обратной транскрипцией с использованием набора для синтеза кДНК (каталожный номер K1542, Fermentas). Количественную ПЦР в реальном времени (Q-PCR) проводили на системе CFX96 от Bio-Rad с использованием iQ SYBR green (каталожный номер 170-8882, Bio-Rad). Последовательности праймеров перечислены в дополнительной таблице 1. Экспрессию целевого гена рассчитывали с использованием метода ΔCt [отн.Expression = 2 – (Ct (цель) -Ct (ссылка)) ] с использованием экспрессии β2-микроглобулина или GAPDH в качестве эталонных генов.

Вестерн-блоттинг

Общие клеточные лизаты получали путем соскабливания клеток в буфер Лэммли [2% SDS (каталожный номер CN30. 3, Карл Рот), 62,5 мМ трис-HCl (каталожный номер A1086, Applichem), pH 6,8, 10% глицерин (каталожный номер BP229, Fisher), 10 мМ DTT (каталожный номер 6908.1, Carl Roth)], содержащий ингибиторы протеазы (Complete, каталожный номер 11697498001, Roche) с последующей обработкой ультразвуком.Для экстракции гистонов осадки клеток лизировали в PBS, содержащем 0,5% Triton X-100 (каталожный номер 3051.3, Carl Roth), 5 мМ бутирата натрия (каталожный номер 303410, Sigma-Aldrich) и ингибиторы протеаз в течение 10 минут. на льду. Лизаты центрифугировали 0,5 мин при 16000 g, 4 ° C и осадки, содержащие ядра, инкубировали с 0,2 М HCl (каталожный номер 182109, Applichem) в течение ночи. После центрифугирования нерастворимого материала в течение 10 минут при 500 g, 4 ° C супернатанты нейтрализовали NaOH (каталожный номер A6579, Applichem), смешивали с 5-кратным буфером Лэммли и нагревали 5 минут при 95 ° C.

Белковые лизаты макрофагов обрабатывали на 7,5–15% полиакриламидных гелях и наносили на нитроцеллюлозные мембраны. Были использованы следующие первичные антитела: pSTAT6 (Y641) (каталожный номер 9361), STAT6 (клон D3h5) (каталожный номер 5397), pSTAT3 (Y705) (каталожный номер 9131), STAT3 (клон 124H6). ) (каталожный номер 9139), pACLY (S454) (каталожный номер 4331), гистон h4 acK14 (клон D4B9) (каталожный номер 7627), гистон h4 acK23 (клон D6Y7M) (каталожный номер . # 14932), тег DDK (клон 9A3) (каталожный номер 8146) (все технологии передачи сигналов для клеток), ACLY (каталожный номер.нет. 15421-1-AP, Proteintech), гистон h4 acK9 (клон Y28) (каталожный номер 04-1003, Merck Millipore), гистон h4 acK27 (каталожный номер C15410174, Diagenode), гистон h4 (каталожный номер 07 -690, Merck Millipore), нуклеолин (каталожный номер sc-13057, Санта-Крус). Мембраны инкубировали с вторичными антителами, связанными с IRDye 700/800, сканировали и количественно оценивали с использованием системы визуализации Odyssey (Licor).

siRNA Трансфекция

Отключение ACLY выполняли с использованием siGENOME SMARTpool (номер по каталогу M-004915-00-0005, Thermo Fisher Scientific) при 50 нМ и реагента для трансфекции Hyperfect (кат. нет. 301707, Qiagen). Клетки обрабатывали через 96 ч после трансфекции.

Сверхэкспрессия ACLY

Человеческие MDM трансфицировали 1 мкг DDK-меченного ACLY (каталожный номер OHu14076, Genscript) или GFP-кодирующих плазмид (pmaxGFP, Lonza) с использованием реагента для трансфекции Viromer Red (каталожный номер VR-01LB, Lipocalyx) согласно инструкции производителя. Через 24 часа после трансфекции клетки стимулировали 20 нг / мл IL-4 в течение 24 часов.

Определение ацетил-КоА

Клетки быстро промывали физиологическим раствором, и метаболизм останавливали, помещая чашки в жидкий азот.Клетки соскребали смесью метанол: вода (5: 3) на льду / сухом льду с последующим добавлением холодного хлороформа (каталожный номер 4432.1, Carl Roth) и встряхиванием в течение 10 мин при 4 ° C. Водную фазу отделяли, упаривали и ресуспендировали в 10% метаноле (каталожный номер 32213, Sigma-Aldrich). Концентрацию ацетил-КоА определяли с помощью масс-спектрометра Sciex QTrap5500, работающего в режиме мониторинга множественных реакций в режиме положительной ионизации электрораспылением. Хроматографическое разделение выполняли в системе ВЭЖХ Agilent 1290 Infinity (Agilent) с использованием колонки Acquity HSS T3.Подвижная фаза состояла из (A) воды, 10 мМ формиата аммония (каталожный номер 70221, Sigma-Aldrich), 0,01% аммиака и (B) метанола, 10 мМ формиата аммония, 0,01% аммиака. Элюирование аналитов проводили в градиентных условиях при скорости потока 0,3 мл / мин, переходя от 2% B до 70% B за 5 минут, увеличиваясь до 95% B за 1 минуту, выдерживая 95% B в течение 0,5 минут и уравновешивая при 2% B в течение 2,5 мин. Калибровочная кривая была построена с использованием аутентичного стандарта. Все образцы и разведения стандартов были дополнены меченным тяжелым изотопом внутренним стандартом, содержащим 13 C2-ацетил-КоА (кат.нет. 658650, Sigma-Aldrich). Концентрацию ацетил-КоА определяли по стандарту. Analyst 1.6.2 и MultiQuant 3.0 (оба Sciex) использовались для сбора и анализа данных соответственно. Количества ацетил-КоА в образце нормализовали по концентрации ДНК в образце, измеренной после инкубации с флуоресцентным ДНК-красителем Höchst 33342 (каталожный номер B2261, Sigma-Aldrich) на считывающем устройстве для флуоресцентных планшетов Tecan.

CRISPR / Cas 9 Нокаут ACLY в клетках THP-1

pLentiCRISPRv2 (Addgene: cat.нет. # 52961) векторы, несущие различные sgRNA, разработанные с использованием пакета программного обеспечения для тестирования (таблица), были получены путем отжига специфичных для мишеней олигонуклеотидов с использованием протокола GoldenGate (18). Бесклеточные лентивирусные супернатанты получали путем котрансфекции векторов pLentiCRISPRv2, вспомогательной плазмиды gag / pol и плазмиды оболочки, кодирующей гликопротеин вируса везикулярного стоматита, в клетки HEK293T с использованием реагента для трансфекции JetPrime (трансфекция Polyplus). Через 72 часа после трансфекции вирусные супернатанты собирали и стерильно фильтровали.Клетки THP-1 инфицировали лентивирусами, и трансдуцированные клетки, экспрессирующие EGFP, сортировали с использованием сортировщика клеток FACS Aria с последующим разведением в среде для культивирования клеток с получением суспензий единичных клеток. Полученные колонии, происходящие из отдельных клеток, анализировали на нокаут по ACLY с помощью вестерн-блоттинга.

Таблица 1

Олигонуклеотиды для клонирования конструкций ACLY sgRNA.

hACLY Ex4 s 5 -CAC CGc tcg atc aga aag ttc ttg-3
hACLY Ex4 as tgaAcAt aga 9 -0007 ′ tcac -3
hACLY Ex5 s 5 -CAC CGc acg tcc aca ccc ccc tcg-3
hACLYA000 Ex5 as c gtg tgg acg tgC-3
hACLY Ex6SA s 5 -CAC CGa aac tgg cca gaa ttc tag-3
asLY AAA Cct aga att ctg gcc agt ttC-3

Статистический анализ

Данные представлены в виде средних значений ± S. E. минимум трех независимых экспериментов. Данные анализировали с помощью одностороннего дисперсионного анализа (ANOVA) со сравнением средних значений Bonferroni post-hoc с использованием GraphPad Prism. Различия считались статистически значимыми при p <0,05.

Этика

Исследования проводились в соответствии с этическими стандартами и в соответствии с Хельсинкской декларацией, а также национальными и международными руководящими принципами и были одобрены институциональным наблюдательным советом авторов.Комитет по этике Университета Гете отказался от необходимости письменного информированного согласия при использовании лейкоцитов от анонимных доноров крови.

Результаты

Для исследования роли ACLY в поляризации человеческих макрофагов, стимулированной IL-4, мы первоначально проанализировали экспрессию мРНК арахидонат-15-липоксигеназы (ALOX15) в MDM в присутствии фармакологических ингибиторов ACLY BMS 303141 (19), SB 204990 (20), MEDICA16 (21) и гидроксицитрат (22). Концентрации ингибитора были ранее описаны в литературе.ALOX15 был выбран из-за его возможной чувствительности к экспрессии к метаболическим нарушениям за счет регуляции центральным метаболическим сенсором AMP-активируемой протеинкиназой (23). MDM предварительно инкубировали с ингибиторами ACLY в течение 1 часа с последующей 24-часовой обработкой IL-4 в присутствии ингибиторов. Как показано на фигурах, все ингибиторы ACLY в зависимости от концентрации подавляли индуцированную IL-4 экспрессию мРНК ALOX15. Точно так же ингибиторы ACLY предотвращали индукцию мРНК ALOX15 в MDM, обработанных цитокином IL-13 Th3 (рисунок).

Ингибиторы ACLY снижают индуцированную IL-4 экспрессию целевого гена. (A – D) Q-PCR анализ экспрессии мРНК ALOX15 в MDM, обработанных в течение 1 часа указанными концентрациями BMS 303141 (A) , SB 204490 (B) , MEDICA 16 (C) , или гидроксицитрат (HC) (D) до 24-часовой обработки 20 нг / мл IL-4. (E – I) Q-PCR анализ экспрессии мРНК указанных генов в MDM, обработанных в течение 1 часа 5 мкМ BMS 303141, 25 мкМ SB 204490, 100 мкМ MEDICA 16 или 20 мМ HC перед 24-часовой обработкой 20 нг / мл IL-13 (E) или IL-4 (F – I) .** p <0,01 по сравнению с IL-4 (односторонний дисперсионный анализ). Данные представляют собой средние значения ± стандартная ошибка 4–11 независимых экспериментов.

Предыдущее исследование показало, что ACLY необходим для индуцированной IL-4 экспрессии подмножества генов-мишеней IL-4 в мышиных макрофагах (14). Чтобы оценить повсеместную природу ACLY в влиянии на экспрессию генов, стимулированных IL-4, в MDM, мы проанализировали экспрессию мРНК нескольких хорошо описанных мишеней IL-4, например CCL17, F13A1, CCL18 и MRC1 (CD206) (24). В то время как стимулированная IL-4 экспрессия мРНК CCL17 и F13A1 равномерно подавлялась ингибиторами ACLY, этого не было в случае CCL18 и MRC1 (рисунки).По-видимому, чувствительность к ингибированию ACLY является специфической для целевого гена IL-4. Примечательно, что при анализе списка из 50 наиболее чувствительных к IL-4 генов, чувствительных к ингибированию ACLY в мышином BMDM (14), мы обнаружили, что только 5 генов (CCL17, CAMK2A, PHF19, ALDh2A2, ITGAX) индуцировались IL-4 более чем в 1,5 раза. -складываем в МДМ (25). Это подчеркивает различия между транскрипционными ответами на IL-4 в человеческих и мышиных системах. За исключением CCL17, ни один из этих генов не показал более чем двукратную индукцию чувствительностью к ингибитору IL-4 или ACLY в количественных анализах ПЦР (данные не показаны).

Затем мы оценили эффект подавления экспрессии мРНК ACLY на поляризацию MDM, индуцированную IL-4. Для этого мы обрабатывали MDM в течение 96 часов контрольными миРНК или миРНК ACLY перед 24-часовой обработкой IL-4. Удивительно, но нокдаун ACLY не смог воспроизвести эффект ингибиторов ACLY на экспрессию генов, стимулированную IL-4 (рисунки), несмотря на снижение мРНК ACLY на 90% (рисунок), снижение экспрессии белка ACLY на 80% (рисунок), и снижение ферментативной активности ACLY на 60% (рисунок). Мы также не наблюдали каких-либо значительных изменений экспрессии мРНК гена-мишени, индуцированной IL-4, при сверхэкспрессии ACLY в MDM (дополнительный рисунок 1).Поскольку влияние ACLY на экспрессию генов связано с уменьшением ацетилирования гистоновых белков в макрофагах (14) и других клетках (9, 13), мы проанализировали ацетилирование лизина 27 и 14 на гистоне h4. Ранее было показано, что ацетилирование h4K14 и h4K27 отвечает на изменения активности ACLY (12, 26). Нокдаун ACLY не повлиял на ацетилирование h4K14 и h4K27 (рисунок). Эти данные предполагают, что подавление ACLY в первичных MDM человека не повторяет эффект фармакологического ингибирования ACLY на индуцированную IL-4 экспрессию гена.

Нокдаун ACLY не повторяет фенотип MDM, обработанных ингибитором ACLY. (A – D) Анализ Q-ПЦР экспрессии мРНК ALOX15, CCL17, F13A1 и ACLY в MDM, трансфицированных 50 нМ миРНК ACLY, в течение 96 часов до 24-часовой обработки 20 нг / мл IL-4. (E – G) Вестерн-блот-анализ экспрессии белка ACLY (E) , анализ ферментативной активности (F) и вестерн-блот-анализ ацетилирования гистона h4 при K27 и K14 (G) через 96 часов после -трансфекция миРНК ACLY. ** p <0,01 по сравнению с siControl (односторонний дисперсионный анализ). Данные представляют собой средние значения ± стандартная ошибка 3–4 независимых экспериментов.

Учитывая эти расхождения, мы решили более подробно изучить влияние ингибиторов ACLY на метаболизм макрофагов человека. Неожиданно мы не обнаружили никаких различий в уровнях ацетил-КоА в клетках, обработанных BMS 303141 или SB 204990 в течение 24 часов (рисунок). Соответственно, обработка MDM ингибиторами ACLY в течение 24 часов не влияла на ацетилирование гистона h4 по Lys14 или Lys27 (рисунок).Затем мы использовали методы лечения, которые, как известно, увеличивают нуклеоцитозольные уровни ацетил-КоА и ацетилирования гистонов. В этих экспериментах MDM предварительно инкубировали с ацетатом (9), ингибитором ацетил-CoA-карбоксилазы TOFA (27) или октаноатом (28), в течение 1 часа перед обработкой SB 204990, гидроксицитратом и IL-4. Как показано на фигурах, ацетат, TOFA и октаноат не смогли обратить ингибирование стимулированной IL-4 экспрессии ALOX15 и CCL17 SB 204990 или гидроксицитратом. В качестве альтернативы мы стремились заблокировать транспорт цитрата субстрата ACLY из митохондрий в цитозоль путем предварительной обработки MDM различными концентрациями фармакологических ингибиторов митохондриального цитратного носителя SLC25A1 1,2,3-бензолтрикарбоновой кислоты (BTA) (29 ) и 4-хлор-3 – {[(3-нитрофенил) амино] сульфонил} бензойная кислота (CTPi) (30) за 1 час до 24-часовой обработки IL-4.Ни BTA, ни CTPi не влияли на экспрессию гена, стимулированного IL-4 (рисунки). Эти результаты показывают, что влияние ингибиторов ACLY на индуцированную IL-4 экспрессию гена может быть не связано с регуляцией нуклеоцитозольного ацетил-КоА.

Влияние ингибиторов ACLY на уровни ацетил-КоА, ацетилирование гистонов и индуцированную IL-4 активацию STAT6 и STAT3 в MDM человека. (A) Анализ LC-MS уровней ацетил-КоА в MDM, обработанных 5 мкМ BMS 303141 и 10 мкМ SB 204990 в течение 24 часов. (B) Вестерн-блот-анализ ацетилирования гистона h4 по K14 и K27 в MDM, обработанных указанными концентрациями BMS 303141 и SB 204990 в течение 24 часов. (C – F) Q-PCR анализ экспрессии мРНК ALOX15 и CCL17 в MDM, предварительно обработанных ацетатом, октаноатом и TOFA в течение 1 часа перед обработкой SB 204490, гидроксицитратом и IL-4 в течение 24 часов. (G, H) Анализ Q-ПЦР экспрессии мРНК ALOX15 в MDM, предварительно обработанных указанными концентрациями BTA (G) или CTPi (H) в течение 1 часа до обработки IL-4 в течение 24 часов. час (I) Вестерн-блот-анализ фосфорилирования тирозина STAT3 и STAT6 в MDM, предварительно обработанных ингибиторами ACLY за 1 час до 0.5-часовая обработка ИЛ-4. * p <0,05, ** p <0,01 по сравнению с IL-4 (односторонний дисперсионный анализ). Данные представляют собой средние значения ± стандартная ошибка 3–4 независимых экспериментов.

Затем мы исследовали влияние ингибиторов ACLY на начальные этапы индуцированной IL-4 передачи сигнала путем предварительной инкубации MDM с ингибиторами в течение 1 часа с последующей 0,5-часовой обработкой IL-4. Ингибиторы ACLY не влияли на инициируемое IL-4 фосфорилирование тирозина STAT6, за исключением BMS 303141 и гидроксицитрата (рисунок).Мы заметили 25–30% ингибирование фосфорилирования тирозина STAT3 в MDM, подвергнутых действию ингибитора ACLY и стимулированных IL-4 (рисунок). Принимая во внимание, что фосфорилирование STAT3 по Ser727 и ацетилирование по Lys685, как сообщалось, влияют на транскрипционную активность STAT3, ни IL-4, ни ингибиторы ACLY не влияли на эти посттрансляционные модификации в нашей системе (данные не показаны).

BMDM мыши ответили на стимуляцию IL-4 с помощью Akt-зависимого увеличения фосфорилирования ACLY по Ser454, которое проявляло замедленную кинетику по сравнению с индуцированным IL-4 фосфорилированием Akt (14).Мы проследили кинетику фосфорилирования Akt и ACLY в MDM, стимулированных IL-4, в течение разного времени. В наших руках фосфорилирование Akt по Ser473 временно увеличивалось в человеческих MDM, стимулированных IL-4 (рисунок). Однако мы заметили очень скромные различия в фосфорилировании ACLY во время курса лечения IL-4 (рисунок). Известно, что ACLY частично присутствует в ядерной фракции различных линий раковых клеток (9). Мы также наблюдали ACLY в ядерной фракции MDM человека, хотя большая часть фермента находилась в цитозоле.IL-4 не вызывал никаких изменений локализации ACLY (рисунок). Нам не удалось обнаружить фосфорилирование ACLY в ядерной фракции в ответ на IL-4. Наконец, мы отслеживали ацетилирование гистонов в MDM, стимулированных IL-4, в разное время. В то время как лизин 27 гистона h4 не проявлял значительных изменений в ацетилировании, ацетилирование K14 увеличивалось в течение 0,5 часа после обработки IL-4 и оставалось повышенным до 24 часов (рисунок). В совокупности эти наблюдения показывают, что в человеческих MDMs ACLY, по-видимому, не регулируется фосфорилированием или ядерным транспортом.Это контрастирует с результатами, полученными в мышиной системе.

IL-4 не индуцирует фосфорилирование ACLY в MDM человека. (A – C) Вестерн-блот-анализ фосфорилирования ACLY и Akt (A) , ядерных уровней ACLY (B) и ацетилирования гистона h4 по K27 и K14 (C) в MDM, обработанных 20 нг / мл IL-4 в указанное время. Данные представляют собой средние значения ± стандартная ошибка 3–4 независимых экспериментов. * p <0,05 по сравнению с необработанными (однофакторный дисперсионный анализ).

Нокдаун ACLY в MDM человека оставил значительные количества остаточной активности ACLY. Таким образом, мы приступили к созданию нокаута ACLY в человеческих миелоидных клетках THP-1, которые при дифференцировке напоминают человеческие MDM. Хотя у них есть дефект в передаче сигналов рецептора IL-4 из-за отсутствия общей цепи рецептора гамма (31), клетки THP-1 сохраняют транскрипционные ответы на стимуляцию IL-4 и используются для исследования индуцированной IL-4 поляризации макрофагов человека ( 32). На фигуре показано полное отсутствие белка ACLY в клетках THP-1, нокаутированных по ACLY.Как и ожидалось, ACLY-дефицитные клетки THP-1 проявляли замедленный рост, вероятно, из-за недостаточности липогенеза de novo (рисунок). В отличие от первичных макрофагов, макрофаги с нокаутом ACLY THP-1 показали пониженные уровни ацетилирования гистона h4 по лизинам 9, 14, 23 и 27 (рисунок). Однако устранение ACLY не препятствовало способности THP-1 отвечать на 24-часовую стимуляцию IL-4 повышенной экспрессией гена (рисунки). Это также отражалось в интактном фосфорилировании STAT6 после 0.5-часовая обработка IL-4 в нокаутных клетках ACLY (рисунок). Наиболее поразительно то, что предварительная инкубация клеток THP-1 с нокаутом ACLY с ингибиторами ACLY в течение 1 часа все еще подавляла индуцированную IL-4 экспрессию мРНК CCL13 и F13A1 (рисунки). Эти данные убедительно указывают на то, что ингибиторы ACLY подавляют индуцированную IL-4 экспрессию гена независимо от ACLY за счет нецелевых эффектов.

Ингибиторы ACLY подавляют индуцированную IL-4 экспрессию гена в ACLY-нокаутированных клетках THP-1. (A, B) Вестерн-блот-анализ экспрессии белка ACLY (A) и кривые роста (B) контрольных и ACLY-нокаутных (ACLY KO) клеток THP-1. (C) Вестерн-блот-анализ ацетилирования гистона h4 по K9, K23, K27 и K14 в контрольных макрофагах или макрофагах ACLY KO THP-1. (D, E) Q-ПЦР анализ индуцированной IL-4 экспрессии мРНК CCL13 и F13A1 в контрольных макрофагах или макрофагах ACLY KO THP-1. (F) Вестерн-блот-анализ фосфорилирования STAT6 в контроле или макрофагах ACLY KO THP-1. (G, H) Q-PCR анализ экспрессии мРНК CCL13 и F13A1 в макрофагах ACLY KO THP-1, стимулированных IL-4, в присутствии BMS 303141, SB 204990, MEDICA16 или HC.* p <0,05 по сравнению с контролем или IL-4 (односторонний дисперсионный анализ). Данные представляют собой средние значения ± стандартная ошибка 4–6 независимых экспериментов.

Обсуждение

ACLY, как полагают, связывает метаболизм и эпигенетический контроль транскрипции посредством предоставления ацетил-КоА для ацетилирования ядерных гистонов (8). Поразительно, но наше исследование предполагает, что ACLY мало влияет, если вообще влияет, на индуцированные IL-4 транскрипционные ответы и ацетилирование гистонов в MDM человека. Таким образом, наши данные контрастируют с наблюдениями в мышином BMDM, где было показано, что ACLY вносит значительный вклад в индукцию, по крайней мере, подмножества IL-4-чувствительного транскриптома за счет увеличения ацетилирования гистонов (14). Более того, мы показываем, что некоторые широко используемые фармакологические ингибиторы ACLY влияют на индуцированную IL-4 экспрессию генов даже в отсутствие ACLY, что сильно указывает на нецелевые эффекты этих препаратов. Это требует осторожности при интерпретации предыдущего исследования (14), а также других отчетов, основанных на использовании ингибиторов ACLY.

Какие различия между нашей системой и мышиной BMDM могут объяснить наблюдаемые расхождения? Очевидно, что различие между видами может быть основным фактором. Исследования нашей и других групп показывают, что мышиные и человеческие макрофаги различаются не только тем, как их транскриптом изменяется в ответ на IL-4 (25, 33), но и тем, как их метаболизм контролирует IL-4-зависимую экспрессию генов (17).Теперь мы наблюдаем, что начальные этапы передачи сигнала ниже рецептора IL-4 различаются между системами человека и мыши. Таким образом, человеческие MDM не обнаруживают Akt-зависимого фосфорилирования ACLY в ответ на IL-4. Активация Akt в нашей системе носит временный характер, в отличие от пролонгированной активации BMDM (14). Связано ли это с различиями в вовлечении субстрата 2 рецептора инсулина рецептором IL-4, который, как полагают, отвечает за активацию Akt с помощью IL-4 (31), еще предстоит исследовать.Еще одно отличие – это устойчивая пролиферация в ответ на макрофагальный колониестимулирующий фактор и IL-4 (34), что было замечено при BMDM (14). Поскольку высокая активность ACLY является предпосылкой для продолжающейся пролиферации клеток за счет ее вклада в липогенез de novo (10), пролиферирующие макрофаги могут характеризоваться повышенной активностью ACLY, оказывая большее влияние на ядерный ацетил-КоА и, следовательно, на гистоны. ацетилирование. Напротив, наша экспериментальная установка использовала полностью дифференцированные макрофаги, которые не размножаются.Незначительный липогенез de novo свидетельствовал по неспособности включить C13-углерод из C13-меченной глюкозы в клеточный пальмитат (данные не показаны). Таким образом, роль ACLY в метаболизме и эпигенетической регуляции терминально дифференцированных макрофагов человека остается неясной и требует дальнейших исследований. Следует отметить, что ACLY может иметь большее влияние на дифференцировку макрофагов человека, поскольку этот процесс характеризуется временным усилением липогенеза на de novo (35). Другая предполагаемая функция ACLY в макрофагах, основанная на наблюдениях на клеточной линии U937, заключается в обеспечении субстратов для повышенного синтеза биоактивных медиаторов, таких как простагландин E 2 , оксид азота или активные формы кислорода, в ответ на провоспалительное действие. стимулы (36), которые еще предстоит проверить в первичных клетках.

На основании наших исследований критически важный нерешенный вопрос заключается в том, какая ферментная система обеспечивает ядерный ацетил-КоА для ацетилирования гистонов в человеческих MDM. Принимая во внимание, что наши данные показывают, что ACLY определенно способствует ацетилированию гистонов в линии клеток острого миелоидного лейкоза THP-1, мы не получили доказательств такого поведения в человеческих MDM. Описано несколько альтернативных источников ядерного ацетил-КоА. Основным источником является превращение ацетата в ацетил-КоА под действием нуклеоцитозольного члена 2 семейства короткоцепочечных ацил-КоА-синтетаз (ACSS2).ACSS2 способствует ацетилированию гистонов в раковых клетках, особенно при гипоксии или недостатке глюкозы (37, 38), а также может участвовать в рециркуляции ацетата, высвобождаемого из гистонов под действием деацетилаз гистонов (39). Ацетил-КоА также может быть синтезирован в ядре посредством ядерной транслокации комплекса пируватдегидрогеназы (40, 41). Для бета-клеток поджелудочной железы описана альтернативная цитозольная система генерации ацетил-КоА, включающая скоординированные действия митохондриальной сукцинил-КоА: 3-кетоацид-КоА трансферазы и цитозольной ацетоацетил-КоА синтетазы и ацетил-КоА-ацилтрансферазы (42).Наконец, было высказано предположение, что активность карнитинацетил-КоА трансферазы и других не охарактеризованных путей связывает митохондриальный и нуклеоцитозольный ацетил-КоА (28, 43, 44). Какие из этих путей вносят вклад в нуклеоцитозольный ацетил-КоА в человеческих MDM, остается предметом текущих исследований.

Наши результаты также подчеркивают печально известную склонность фармакологических ингибиторов к нецелевым эффектам, что в нашем случае особенно примечательно, поскольку мы использовали структурно разнородные вещества (гидроксилированный цитрат, третраметилированную длинноцепочечную дикарбоновую жирную кислоту, трициклический ароматический сульфонамид и дихлорфенилгексил). -замещенное гидроксилированное производное тетрагидрофурануксусной кислоты).Нецелевые эффекты ингибиторов ACLY на транскрипцию генов, стимулированную IL-4, можно было выявить только с использованием нокаутной клеточной линии ACLY. Наши результаты также указывают на ограничение изучения первичных клеток человека, поскольку нокдаун ACLY оставляет значительную остаточную активность, в то время как фармакологические ингибиторы не подходят из-за активности, не связанной с мишенью. Будут ли индуцированные макрофаги, полученные из плюрипотентных стволовых клеток, для которых возможно создание моделей нокаута (45), быть более подходящей моделью для изучения метаболической регуляции поляризации макрофагов по сравнению с клетками THP-1 острого миелоидного лейкоза, должно быть выявлено в ходе будущих исследований. .

Вклад авторов

DN разработал исследование, провел эксперименты и написал рукопись. SZ и IF способствовали измерениям ацетил-КоА. FS, NK и DF способствовали созданию нокаутной клеточной линии CRISPR / Cas9 THP-1. BB внес свой вклад в дизайн исследования и отредактировал окончательную рукопись. Все авторы внесли свой вклад в доработку рукописи, прочитали и одобрили представленную версию.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим Андреа Дюшен и Таню Кепплер за техническую помощь.

Глоссарий

Сокращения
ACLY АТФ-цитрат-лиаза
ALOX15 арахидонат 15-липоксигеназа
костная ткань, производная от IL-1 BM1
BM1 9014
MDM Макрофаг, происходящий из моноцитов.

Сноски

Финансирование. Это исследование было поддержано Deutsche Forschungsgemeinschaft (SCHN1166 / 4-1): SFB 1039 (Teilprojekt A05, A06, B04), NA 429 / 2-2 и Центром клеточной и генной терапии LOEWE для FS.

Ссылки

1. Мюррей П.Дж., Аллен Дж. Э., Бисвас С. К., Фишер Е. А., Гилрой Д. В., Гердт С. и др. . Активация и поляризация макрофагов: номенклатура и экспериментальные рекомендации. Иммунитет (2014) 41: 14–20. 10.1016 / j.immuni.2014.06.008 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 3. Миллс С.Д., Кинкейд К., Альт Дж. М., Хейлман М. Дж., Хилл А. М.. Макрофаги M-1 / M-2 и парадигма Th2 / Th3. J Immunol. (2000) 164: 6166–73. 10.4049 / jimmunol.164.12.6166 [PubMed] [CrossRef] [Google Scholar] 4. Мантовани А., Соццани С., Локати М., Аллавена П., Сика А. Поляризация макрофагов: ассоциированные с опухолью макрофаги как парадигма поляризованных мононуклеарных фагоцитов M2. Trends Immunol. (2002) 23: 549–55.
10.1016 / S1471-4906 (02) 02302-5 [PubMed] [CrossRef] [Google Scholar] 5.Ван ден Босше Дж., О’Нил Л.А., Менон Д. Иммунометаболизм макрофагов: куда мы идем? Trends Immunol. (2017) 38: 395–406. 10.1016 / j.it.2017.03.001 [PubMed] [CrossRef] [Google Scholar] 6. Phan AT, Goldrath AW, Glass CK. Метаболическая и эпигенетическая координация Т-клеточного и макрофагального иммунитета. Иммунитет (2017) 46: 714–29. 10.1016 / j.immuni.2017.04.016 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Пьетрокола Ф., Галлуцци Л., Браво-Сан-Педро Дж. М., Мадео Ф., Кремер Г. Ацетил-кофермент А: центральный метаболит и вторичный мессенджер.Cell Metab. (2015) 21: 805–21. 10.1016 / j.cmet.2015.05.014 [PubMed] [CrossRef] [Google Scholar] 8. Сивананд С., Виней И., Веллен К.Э. Пространственно-временной контроль метаболизма ацетил-КоА в регуляции хроматина. Trends Biochem Sci. (2018) 43: 61–74. 10.1016 / j.tibs.2017.11.004 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Веллен К.Е., Хацивассилиу Г.
, Сачдева Ю.М., Bui TV, Cross JR, Thompson CB. АТФ-цитратлиаза связывает клеточный метаболизм с ацетилированием гистонов. Наука (2009) 324: 1076–80. 10.1126 / наука.1164097 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Bauer DE, Hatzivassiliou G, Zhao F, Andreadis C, Thompson CB. Цитратлиаза АТФ – важный компонент роста и трансформации клеток. Онкоген (2005) 24: 6314–22. 10.1038 / sj.onc.1208773 [PubMed] [CrossRef] [Google Scholar] 11. Hatzivassiliou G, Zhao F, Bauer DE, Andreadis C, Shaw AN, Dhanak D, et al. . Ингибирование цитратлиазы АТФ может подавлять рост опухолевых клеток. Раковая клетка (2005) 8: 311–21. 10.1016 / j.ccr.2005.09.008 [PubMed] [CrossRef] [Google Scholar] 12.Каррер А., Пэррис Дж. Л., Трефели С., Генри Р. А., Монтгомери, округ Колумбия, Торрес А. и др. . Влияние диеты с высоким содержанием жиров на уровни ацетилирования ацил-КоА и гистонов в тканях. J Biol Chem. (2017) 292: 3312–22. 10.1074 / jbc.M116.750620 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13.
Das S, Morvan F, Morozzi G, Jourde B, Minetti GC, Kahle P и др. . Цитратлиаза АТФ регулирует дифференцировку миофибрилл и увеличивает регенерацию, изменяя ацетилирование гистонов. Cell Rep. (2017) 21: 3003–11. 10.1016 / j.celrep.2017.11.038 [PubMed] [CrossRef] [Google Scholar] 14. Коваррубиас А.Дж., Аксойлар Х.И., Ю.Дж., Снайдер Н.В., Уорт А.Дж., Айер С.С. и др. . Передача сигналов Akt-mTORC1 регулирует Acly для интеграции метаболических входов для контроля активации макрофагов. Элиф (2016) 5: e11612. 10.7554 / eLife.11612 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Ли СП, Каррер А., Шах С., Снайдер Н. В., Вей С., Веннети С. и др. . Akt-зависимое метаболическое перепрограммирование регулирует ацетилирование гистонов опухолевых клеток. Cell Metab. (2014) 20: 306–19. 10.1016 / j.cmet.2014.06.004 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16. Потапова И.А., Эль-Маграби М.Р., Доронин С.В., Бенджамин В.Б. Фосфорилирование рекомбинантной человеческой АТФ: цитратлиазы цАМФ-зависимой протеинкиназой отменяет гомотропную аллостерическую регуляцию фермента цитратом и увеличивает активность фермента.
Аллостерическая активация АТФ: цитратлиазы фосфорилированными сахарами. Биохимия (2000) 39: 1169–79. 10.1021 / bi992159y [PubMed] [CrossRef] [Google Scholar] 17. Намгаладзе Д., Брюне Б.Окисление жирных кислот является незаменимым для поляризации, индуцированной человеческим макрофагом IL-4. Biochim Biophys Acta (2014) 1841: 1329–35. 10.1016 / j.bbalip.2014.06.007 [PubMed] [CrossRef] [Google Scholar] 18. Энглер С., Кандзиа Р., Мариллоннет С. Метод точного клонирования в один горшок, один шаг и высокой пропускной способностью. PLoS ONE (2008) 3: e3647. 10.1371 / journal.pone.0003647 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Ли Дж. Дж., Ван Х., Тино Дж. А., Робл Дж. А., Херпин Т. Ф., Лоуренс Р. М. и др. . 2-гидрокси-N-арилбензолсульфонамиды как ингибиторы АТФ-цитратлиазы.Bioorg Med Chem Lett. (2007) 17: 3208–11. 10.1016 / j.bmcl.2007.03.017 [PubMed] [CrossRef] [Google Scholar] 20. Грибл А.Д., Ифе Р.Дж., Шоу А., Макнейр Д., Novelli CE, Бейкуэлл С. и др. . АТФ-цитратлиаза как мишень для гиполипидемического вмешательства. 2. Синтез и оценка (3R, 5S) -омега-замещенных-3-карбокси-3,5-дигидроксиалкановых кислот и их пролекарств гамма-лактон в качестве ингибиторов фермента in vitro и in vivo. J Med Chem. (1998) 41: 3582–95. 10.1021 / jm980091z [PubMed] [CrossRef] [Google Scholar] 21.Бар-Тана Дж., Роуз-Кан Дж., Сребник М. Ингибирование синтеза липидов бета-тетраметил-замещенными, C14-C22, альфа, омега-дикарбоновыми кислотами у крыс in vivo . J Biol Chem. (1985) 260: 8404–10. [PubMed] [Google Scholar] 22. Мариньо Г., Пьетрокола Ф., Айзенберг Т., Конг Й., Малик С.А., Андрюшкова А. и др. . Регулирование аутофагии цитозольным ацетил-коферментом A. Mol Cell (2014) 53: 710–25. 10.1016 / j.molcel.2014.01.016 [PubMed] [CrossRef] [Google Scholar] 23. Намгаладзе Д., Снодграсс Р.Г., Ангиони С., Гроссманн Н., Дене Н., Гейсслингер Г. и др.. AMP-активированная протеинкиназа подавляет экспрессию арахидонат-15-липоксигеназы в интерлейкин-4-поляризованных макрофагах человека. J Biol Chem. (2015) 290: 24484–94. 10.1074 / jbc. M115.678243 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Мартинес Ф.О., Гордон С., Локати М., Мантовани А. Транскрипционное профилирование дифференцировки и поляризации человеческих моноцитов и макрофагов: новые молекулы и образцы экспрессии генов. J Immunol. (2006) 177: 7303–11. 10.4049 / jimmunol.177.10.7303 [PubMed] [CrossRef] [Google Scholar] 25.Гупта С., Джайн А., Сайед С.Н., Снодграсс Р.Г., Пфлюгер-Мюллер Б., Лейзеганг М.С. и др. . IL-6 усиливает индуцированную IL-4 поляризацию первичных макрофагов человека за счет синергии факторов транскрипции STAT3, STAT6 и BATF. Онкоиммунология (2018) 1–17. 10.1080 / 2162402X.2018.1494110 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Чжао С., Торрес А., Генри Р.А., Трефели С., Уоллес М., Ли СП и др. . АТФ-цитратлиаза контролирует переключение метаболизма глюкозы в ацетат. Cell Rep. (2016) 17: 1037–52. 10.1016 / j.celrep.2016.09.069 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 27. Галдиери Л. , Гатла Х., Ванкурова И., Ванкура А. Активация АМФ-активированной протеинкиназы метформином индуцирует ацетилирование белка в клетках рака простаты и яичников. J Biol Chem. (2016) 291: 25154–66. 10.1074 / jbc.M116.742247 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28. McDonnell E, Crown SB, Fox DB, Kitir B, Ilkayeva OR, Olsen CA и др. . Липиды перепрограммируют метаболизм, чтобы стать основным источником углерода для ацетилирования гистонов.Cell Rep. (2016) 17: 1463–72. 10.1016 / j.celrep.2016.10.012 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Инфантино V, Конвертини П., Куччи Л., Панаро М.А., Ди Нойа М.А., Калвелло Р. и др. . Митохондриальный переносчик цитрата: новый игрок в борьбе с воспалениями. Biochem J. (2011) 438: 433–6. 10.1042 / BJ20111275 [PubMed] [CrossRef] [Google Scholar] 30. Алувила С., Сан Дж., Харрисон Д.Х., Уолтерс Д.Е., Каплан Р.С. Ингибиторы митохондриального цитратного транспортного белка: подтверждение роли остатков связывания субстрата и открытие первого чисто конкурентного ингибитора. Mol Pharmacol. (2010) 77: 26–34. 10.1124 / mol.109.058750 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Heller NM, Qi X, Junttila IS, Shirey KA, Vogel SN, Paul WE и др. . IL-4R типа I избирательно активируют IRS-2, чтобы вызвать экспрессию целевого гена в макрофагах. Sci Signal. (2008) 1: ra17. 10.1126 / scisignal.1164795 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Shiratori H, Feinweber C, Luckhardt S, Linke B, Resch E, Geisslinger G и др. . THP-1 и макрофаги, происходящие из мононуклеарных клеток периферической крови человека, различаются по своей способности поляризовать in vitro .Мол Иммунол. (2017) 88: 58–68. 10.1016 / j.molimm.2017.05.027 [PubMed] [CrossRef] [Google Scholar] 33. Мартинес Ф.О., Хелминг Л., Милде Р., Варин А., Мельгерт Б.Н., Драйджер С. и др. . Генетические программы, выраженные в покоящихся и альтернативно активируемых ИЛ-4 мышиных и человеческих макрофагов: сходства и различия. Кровь (2013) 121: e57–69. 10.1182 / blood-2012-06-436212 [PubMed] [CrossRef] [Google Scholar] 34. Сивеке MH, Аллен JE. Помимо стволовых клеток: самообновление дифференцированных макрофагов. Наука (2013) 342: 1242974.10.1126 / science.1242974 [PubMed] [CrossRef] [Google Scholar] 35. Ecker J, Liebisch G, Englmaier M, Grandl M, Robenek H, Schmitz G. Индукция синтеза жирных кислот является ключевым требованием для фагоцитарной дифференцировки моноцитов человека. Proc Natl Acad Sci USA. (2010) 107: 7817–22. 10.1073 / pnas.09107 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36. Infantino V, Iacobazzi V, Palmieri F, Menga A. АТФ-цитрат-лиаза необходима для воспалительной реакции макрофагов. Biochem Biophys Res Commun.(2013) 440: 105–11. 10.1016 / j.bbrc.2013.09.037 [PubMed] [CrossRef] [Google Scholar] 37. Schug ZT, Peck B, Jones DT, Zhang Q, Grosskurth S, Alam IS, et al. . Ацетил-КоА-синтетаза 2 способствует утилизации ацетата и поддерживает рост раковых клеток при метаболическом стрессе. Раковая клетка (2015) 27: 57–71. 10.1016 / j.ccell.2014.12.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 38. Ли X, Yu W, Qian X, Xia Y, Zheng Y, Lee JH и др. . ACSS2 с транслокацией ядра способствует транскрипции генов лизосомного биогенеза и аутофагии.Mol Cell (2017) 66: 684–697.e9. 10.1016 / j.molcel.2017.04.026 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 39. Булусу В., Туманов С., Михалопулу Е., ван ден Брук Н. Дж., Маккей Г., Никсон С. и др. . Повторный захват ацетата ядерной ацетил-КоА синтетазой 2 предотвращает потерю ацетилирования гистонов при ограничении кислорода и сыворотки. Cell Rep. (2017) 18: 647–58. 10.1016 / j.celrep.2016.12.055 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Sutendra G, Kinnaird A, Dromparis P, Paulin R, Stenson TH, Haromy A, et al.. Комплекс ядерной пируватдегидрогеназы важен для образования ацетил-КоА и ацетилирования гистонов. Cell (2014) 158: 84–97. 10.1016 / j.cell.2014.04.046 [PubMed] [CrossRef] [Google Scholar] 41. Нагарадж Р., Шарпли М.С., Чи Ф., Браас Д., Чжоу Ю., Ким Р. и др. . Ядерная локализация ферментов митохондриального цикла TCA как критический шаг в активации зиготического генома млекопитающих. Cell (2017) 168: 210–223.e11. 10.1016 / j.cell.2016.12.026 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Макдональд М.Дж., Смит А.Д., Хасан Н.М., Сабат Дж., Фахиен Л.А.Возможность путей переноса ацильных групп из митохондрий в цитозоль с образованием короткоцепочечных ацил-КоА в бета-клетках поджелудочной железы. J Biol Chem. (2007) 282: 30596–606. 10.1074 / jbc.M702732200 [PubMed] [CrossRef] [Google Scholar] 43. Altamimi TR, Thomas PD, Darwesh AM, Fillmore N, Mahmoud MU, Zhang L, et al. . Цитозольная карнитинацетилтрансфераза как источник цитозольного ацетил-КоА: возможный механизм регуляции сердечного энергетического метаболизма. Биохим Дж. (2018) 475: 959–76. 10.1042 / BCJ20170823 [PubMed] [CrossRef] [Google Scholar] 44.Мадираджу П., Панде С.В., Прентки М., Мадираджу С.М. Митохондриальный ацетилкарнитин обеспечивает ацетильные группы для ацетилирования ядерных гистонов. Эпигенетика (2014) 4: 399–403. 10.4161 / epi.4.6.9767 [PubMed] [CrossRef] [Google Scholar] 45. Чжан Х., Ши Дж., Хашет М.А., Сюэ С., Бауэр Р.С., Цзян Х. и др. . CRISPR / Cas9-опосредованное редактирование генов в макрофагах, происходящих от ИПСК человека, выявляет функцию липазы лизосомальной кислоты в макрофагах человека – краткий отчет. Артериосклер Thromb Vasc Biol. (2017) 37: 2156–60. 10.1161 / ATVBAHA.117.310023 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Пенициллин-связывающие белки класса A не влияют на форму клетки, но восстанавливают дефекты клеточной стенки

Существенные изменения:

1) Авторы должны предоставить более окончательные доказательства, чтобы показать, что PBP1b действительно является «активно» репаративным дефектом клеточной стенки, если бы это было основным выводом, который они хотели бы сделать.Основное доказательство, которое авт. Использовали в поддержку своего вывода о том, что PBP1b активно восстанавливает повреждение клеточной стенки, получено в экспериментах по спасению, где избыточная экспрессия PBP1b спасает клетки с истощенными предшественниками клеточной стенки. Я не совсем понимаю, почему это свидетельство поддерживает «активную» роль PBP1b в восстановлении повреждений. Если авторы используют клеточный штамм, который сверхэкспрессирует систему стержней, заметят ли они подобный эффект? В противном случае у них были бы более убедительные доказательства, подтверждающие их вывод. Но если так, следует ли им сделать вывод, что система стержней также активно ремонтирует повреждения? Эксперимент по вымыванию лекарственного средства и сверхэкспрессии PBP1b действительно показал, что PBP1b имеет решающее значение для восстановления клеток от истощения предшественников, но PBP1b не нуждается в «активном способе» восстановления клеточных дефектов.Они только должны быть функциональными. Если для того, чтобы «продемонстрировать, что PBP1b отвечает на повреждение клеточной стенки», потребуются окончательные доказательства, такие как описанные выше, или доказательства прямого рекрутирования aPBP в области повреждения. Как минимум, авторы должны смягчить такие окончательные утверждения по всему тексту (например, в первом и пятом параграфах Обсуждения).

Мы согласны с авторами обзора в том, что наш вывод об «активной» роли PBP1b как фермента репарации был слишком сильным.Поэтому мы существенно изменили заголовок, аннотацию и текст рукописи. Ниже мы кратко резюмируем то, что, по нашему мнению, может быть твердо заключено, и какая гипотеза подтверждается нашими экспериментами, но не демонстрируется строго.

Во-первых, что касается слова «активный», мы теперь думаем, что это слово нечеткое / неоднозначное и его следует заменить. Фермент активен просто благодаря своей ферментативной активности. Если PBP1b является репаративным ферментом, как мы хотим подтвердить в наших экспериментах, он автоматически является активным репаративным ферментом.Под словом «активный» мы хотели описать потенциальную склонность PBP1b к увеличению активности в ответ на более крупные или более механические дефекты. Однако теперь мы согласны с тем, что на основании наших экспериментов нельзя сделать вывод об увеличении активности.

Мы думаем, что наша работа предоставляет доказательства того, что PBP1b является репаративным ферментом, т.е. что он вставляет PG в места локальных повреждений клеточной стенки. Это должно контрастировать со сценарием, когда PBP1b просто предотвращает образование дефектов, добавляя больше или «лучший» (в смысле более прочный) пептидогликан.Этот вывод подтверждается нашими предыдущими и новыми экспериментами.

a) Экспрессия PBP1b быстро снижает скорость лизиса после временной обработки D-циклосерином – в течение <20 мин после отмывки как в минимальной, так и в богатой средах. В минимальной среде это время составляет менее 30% времени генерации. Таким образом, PBP1b, вероятно, рекрутируется в локальные дефекты клеточной стенки, где он затем служит ферментом репарации. Поэтому мы переместили результаты восстановления, полученные на минимальных носителях (ранее рисунок 4 - добавление к рисунку 3), на основной рисунок и переместили результаты, полученные на расширенных носителях (LB), на дополнительный рисунок (рисунок 3 - добавление к рисунку 3).

Уменьшение лизиса между 10-25 мин после отмывки теперь также демонстрируется с помощью покадровой микроскопии отдельных клеток (новый рисунок 3E-G, см. Также рисунок 3 – приложение к рисунку 4).

Обработка

D-циклосерином, в свою очередь, снижает среднюю плотность пептидогликана и, таким образом, увеличивает средний размер пор в клеточной стенке. Увеличение размера пор подтверждается новыми экспериментами UPLC, проведенными в сотрудничестве с Felipe Cava (см. Рис. 3A, B), и предыдущими экспериментами по мечению 3H-mDAP, представленными в [Oldewurtel et al., 2019]. Чтобы поддержать это утверждение, мы включили результаты UPLC-УФ-характеристики саккулы после обработки 1 мМ D-циклосерином на фиг. 3B.

Мы не ожидаем, что дефекты клеточной стенки изначально качественно сильно отличаются от дефектов, которые обычно возникают во время обычного роста. Однако эти дефекты, вероятно, ответственны за лизис как во время, так и после лечения D-циклосерином, возможно, потому, что они растут с течением времени. Затем наши эксперименты предполагают, что эти дефекты восстанавливаются с помощью PBP1b после вымывания D-циклосерина.

b) При ограничении предшественников клеточной стенки за счет истощения mDAP или за счет промежуточных (летальных, но ненасыщающих) уровней D-циклосерина мы наблюдаем, что клетки выживают дольше в присутствии PBP1b. Поскольку в этих экспериментах мы ограничиваем синтез предшественников, эти эксперименты предполагают, что PBP1b лучше способен поддерживать механическую стабильность, чем остальные другие ферменты, при тех же ограниченных ресурсах. Это открытие подтверждает предыдущие данные о повышенной чувствительности мутанта ∆1b к антибиотикам, направленным на клеточную стенку.

Мы провели новые эксперименты с мутантом PBP1b *, выделенным лабораторией Бернхардта, который не требует, чтобы LpoB дополнял делецию PBP1a [Markovski et al., 2016; Paradis-Bleau et al., R2010]. Мы использовали этот мутант, чтобы продемонстрировать, что PBP1b с LpoB способствует восстановлению от временного повреждения клеточной стенки (обработка D-циклосерином) по сравнению с PBP1b * ∆LpoB (рисунок 3 – приложение к рисунку 5).

Эта интерпретация дополнительно подтверждается измерениями отслеживания одиночных молекул PBP1b и PBP1b * на фоне ∆LpoB.В обоих случаях связанная фракция молекул сильно снижается (рисунок 4 – приложение к рисунку 4).

Эти наблюдения подтверждают идею, что LpoB служит для ощущения пор в клеточной стенке и что этот механизм восприятия играет роль в восстановлении D-циклосерина, как предполагалось ранее.

2) После истощения предшественников синтез всей клеточной стенки замедляется, поэтому трудно утверждать, что существуют определенные дефекты клеточной стенки – модель в этой области такова, что PBP1b активируется, когда в клеточной стенке есть более крупные поры, поэтому LopB может достигать пор, чтобы активировать PBP1b.Должны ли некоторые гипермутанты амидазы лучше определять эти дефекты, а не использовать лекарственное лечение, которое снижает синтез всей клеточной стенки? (Здесь я предполагаю, что без mDap или D-Ala-D-Ala липид II не будет синтезирован или перевернут). Другой способ решить эту проблему – использовать ВЭЖХ для количественной оценки структуры PG после обработки D-cyc или mDAP, чтобы показать конкретные типы повреждений и сравнить структуры клеточной стенки в клетках WT, и когда PBP1b никогда не индуцируется или всегда индуцируется. Опять же, авторы предоставили доказательства, которые согласуются с текущей моделью, но эти доказательства не являются окончательными.Авторам следует соответствующим образом отредактировать текст, чтобы не делать таких окончательных выводов.

Мы понимаем, что мы используем слово «дефект» неоднозначно. Поэтому мы включили текст, объясняющий, что мы имеем в виду в разделе о ремонте:

«Сниженное сшивание, вероятно, вызывает сопутствующее накопление дефектов, то есть участков с увеличенным размером пор, которые в конечном итоге ответственны за лизис». Мы использовали это слово для обозначения участков возможного лизиса в будущем.Это могут быть поры в клеточной стенке увеличенного размера. Эти дефекты в принципе могут возникать во время регулярного роста (когда они быстро восстанавливаются) или во время остановки внедрения клеточной стенки.

Как описано более подробно в ответ на предыдущий пункт, теперь мы более четко продемонстрировали, что размер пор действительно увеличился. Поэтому мы думаем, что обработка D-циклосерином хорошо подходит для введения дефектов в клеточную стенку и исследования способности PBP1b восстанавливать эти летальные дефекты.

Мы согласны с тем, что наши эксперименты не предоставляют доказательств конкретного механизма PBP1b, как уже обсуждалось выше. Поэтому мы пересмотрели Аннотация, Введение, Результаты и Обсуждение.

3) Название можно было бы изменить, сделав его более конкретным – «PBP класса A способствуют…». Как написано, это кажется очевидным утверждением (конечно, синтазы клеточной стенки, включая RodA / PBP2, вносят вклад в целостность клеточной оболочки; новизна заключается в том, как это делают aPBP).

Согласны с рецензентами.Новое название – «Пенициллин-связывающие белки класса А не влияют на форму клетки, но восстанавливают дефекты клеточной стенки».

https://doi.org/10.7554/eLife.51998.sa2

(PDF) Поляризация человеческих макрофагов интерлейкином-4 не требует АТФ-цитрат-лиазы

Намгаладзе и соавт. АТФ-цитратлиаза в макрофагах

Фармакологические ингибиторы непригодны из-за активности о-мишени

. Будут ли индуцированные плюрипотентные стволовые клетки – производные макрофагов

, где возможно создание моделей нокаута

(45), будут более подходящей моделью для изучения метаболической регуляции поляризации макрофагов

по сравнению с острым миелоидным лейкозом

THP-1 ячейки, должны быть обнаружены в ходе будущего расследования

.

ВКЛАД АВТОРА

DN разработал исследование, провел эксперименты, а

написал рукопись. SZ и IF способствовали измерениям ацетил-CoA

. FS, NK и DF способствовали созданию линии нокаутных клеток CRISPR / Cas9

THP-1. BB участвовал в исследовании дизайна

и редактировал окончательную рукопись. Все авторы внесли

в редакцию рукописи, прочитали и одобрили представленную версию

.

ФИНАНСИРОВАНИЕ

Это исследование было поддержано Deutsche Forschungsgemeinschaft

(SCHN1166 / 4-1): SFB 1039 (Teilprojekt A05, A06, B04), NA

429 / 2-2 и Центром клеток и генов LOEWE. Терапия

по ФС.

БЛАГОДАРНОСТИ

Мы благодарим Андреа Дюшен и Таню Кепплер за техническую помощь

.

ДОПОЛНИТЕЛЬНЫЙ МАТЕРИАЛ

Дополнительные материалы к этой статье

можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/ mmu.

2018.02858 / полный # дополнительный материал

ССЫЛКИ

1. Мюррей П.Дж., Аллен Дж.Э., Бисвас С.К., Фишер Э.А., Гилрой Д.В., Гердт С. и др.

Активация и поляризация макрофагов: номенклатура и экспериментальные

рекомендации.Иммунитет (2014) 41: 14–20. doi: 10.1016 / j.immuni.2014.06.008

2. Мартинес Ф.О., Гордон С. Парадигма активации макрофагов M1 и M2:

Время для переоценки. F1000Prime Rep. (2014) 6:13. DOI: 10.12703 / P6-13

3. Миллс К.Д., Кинкейд К., Альт Дж. М., Хейлман М. Дж., Хилл А. М.. M-1 / M-2

макрофагов и парадигма Th2 / Th3. J Immunol. (2000) 164: 6166–73.

doi: 10.4049 / jimmunol.164.12.6166

4. Мантовани А., Соццани С., Локати М., Аллавена П., Сика А.Макрофаг

поляризация: ассоциированные с опухолью макрофаги как парадигма поляризованных мононуклеарных фагоцитов

M2. Trends Immunol. (2002) 23: 549–55.

doi: 10.1016 / S1471-4906 (02) 02302-5

5. Ван ден Босше Дж., О’Нил Л.А., Менон Д. Иммунометаболизм макрофагов:

Куда мы (идем)? Trends Immunol. (2017) 38: 395–406.

doi: 10.1016 / j.it.2017.03.001

6. Фан А.Т., Голдрат А.В., Гласс СК. Метаболическая и эпигенетическая координация

иммунитета Т-клеток и макрофагов.Иммунитет (2017) 46: 714–29.

doi: 10.1016 / j.immuni.2017.04.016

7. Пьетрокола Ф., Галлуцци Л., Браво-Сан Педро Дж. М., Мадео Ф., Кремер Г. Ацетил

коэнзим А: центральный метаболит и второй мессенджер. Cell Metab. (2015)

21: 805–21. DOI: 10.1016 / j.cmet.2015.05.014

8. Сивананд С., Виней И., Веллен К.Э. Пространственно-временной контроль метаболизма ацетил-КоА

в регуляции хроматина. Trends Biochem Sci. (2018) 43: 61–74.

DOI: 10.1016 / j.tibs.2017.11.004

9. Веллен К.Е., Хацивассилиу Г., Сачдева Ю.М., Буй ТВ, Кросс Дж.Р., Томпсон

CB. АТФ-цитратлиаза связывает клеточный метаболизм с ацетилированием гистонов. Наука

(2009) 324: 1076–80. DOI: 10.1126 / science.1164097

10. Bauer DE, Hatzivassiliou G, Zhao F, Andreadis C, Thompson CB. Цитрат АТФ

лиаза является важным компонентом роста и трансформации клеток. Онкоген

(2005) 24: 6314–22. DOI: 10,1038 / sj.onc.1208773

11.Hatzivassiliou G, Zhao F, Bauer DE, Andreadis C, Shaw AN, Dhanak D,

et al. Ингибирование цитратлиазы АТФ может подавлять рост опухолевых клеток. Cancer Cell

(2005) 8: 311–21. DOI: 10.1016 / j.ccr.2005.09.008

12. Каррер А., Пэррис Дж. Л., Трефели С., Генри Р. А., Монтгомери, округ Колумбия, Торрес А. и др.

Влияние диеты с высоким содержанием жиров на уровни ацетилирования ацил-КоА и гистонов в тканях. J

Biol Chem. (2017) 292: 3312–22. DOI: 10.1074 / jbc.M116.750620

13. Das S, Morvan F, Morozzi G, Jourde B, Minetti GC, Kahle P, et al.

Цитратлиаза АТФ регулирует дифференциацию миофибрилл и увеличивает регенерацию

за счет изменения ацетилирования гистонов. Cell Rep. (2017) 21: 3003–11.

doi: 10.1016 / j.celrep.2017.11.038

14. Коваррубиас А.Дж., Аксойлар Х.И., Ю.Дж., Снайдер Н.В., Уорт А.Дж., Айер С.С. и др.

Передача сигналов Akt-mTORC1 регулирует Acly для интеграции метаболических входов в

, контролирующих активацию макрофагов. Элиф (2016) 5: e11612. DOI: 10.7554 / eLife.

11612

15.Ли СП, Каррер А., Шах С., Снайдер Н. В., Вей С., Веннети С. и др. Akt-

-зависимое метаболическое репрограммирование регулирует ацетилирование гистонов опухолевых клеток.

Cell Metab. (2014) 20: 306–19. doi: 10.1016 / j.cmet.2014.06.004

16. Потапова И.А., Эль-Маграби М.Р., Доронин С.В., Бенджамин В.Б. Фосфорилирование

рекомбинантного человеческого АТФ: цитратлиазы с помощью цАМФ-зависимого протеина

киназа отменяет гомотропную аллостерическую регуляцию фермента цитратом

и увеличивает активность фермента.Аллостерическая активация АТФ: цитрат

лиаза фосфорилированными сахарами. Биохимия (2000) 39: 1169–79.

doi: 10.1021 / bi992159y

17. Намгаладзе Д., Брюне Б. Окисление жирных кислот необязательно для поляризации макрофагов человека

, индуцированной ИЛ-4. Biochim Biophys Acta (2014)

1841: 1329–35. doi: 10.1016 / j.bbalip.2014.06.007

18. Энглер К., Кандзия Р., Мариллоннет С. Один горшок, один шаг, точность

Метод клонирования

с высокой производительностью.PLoS ONE (2008) 3: e3647.

doi: 10.1371 / journal.pone.0003647

19. Ли Дж. Дж., Ван Х., Тино Дж. А., Робл Дж. А., Херпин Т. Ф., Лоуренс Р. М. и др. 2-гидрокси-

N-арилбензолсульфонамиды как ингибиторы АТФ-цитратлиазы. Bioorg Med Chem

Lett. (2007) 17: 3208–11. DOI: 10.1016 / j.bmcl.2007.03.017

20. Гриббл А.Д., Ифе Р.Дж., Шоу А., Макнейр Д., Novelli CE, Бейкуэлл С. и др. ATP-

Цитратлиаза как мишень для гиполипидемического вмешательства. 2. Синтез и оценка

(3R, 5S) -омега-замещенных-3-карбокси-3, 5-дигидроксиалкановых кислот

и их гамма-лактонных пролекарств в качестве ингибиторов фермента

in vitro и in vivo.J Med Chem. (1998) 41: 3582–95. doi: 10.1021 / jm98

0091z

21. Бар-Тана Дж., Роуз-Кан Дж., Сребник М. Ингибирование синтеза липидов бета

бета’-тетраметил-замещенные, C14-C22, альфа, омега-дикарбоновые кислоты в

крыса in vivo.J Biol Chem. (1985) 260: 8404–10.

22. Мариньо Г., Пьетрокола Ф., Айзенберг Т., Конг Ю., Малик С.А., Андрюшкова А.,

et al. Регулирование аутофагии цитозольным ацетил-коферментом A. Mol Cell (2014)

53: 710–25.DOI: 10.1016 / j.molcel.2014.01.016

23. Намгаладзе Д., Снодграсс Р.Г., Ангиони С., Гроссманн Н., Дене Н.,

Гейсслингер Г. и др. AMP-активированная протеинкиназа подавляет экспрессию арахидонат

15-липоксигеназы в интерлейкин-4-поляризованных макрофагах человека. J

Biol Chem. (2015) 290: 24484–94. doi: 10.1074 / jbc.M115.678243

24. Мартинес Ф.О., Гордон С., Локати М., Мантовани А. Транскрипционное профилирование

дифференциации и поляризации человеческих моноцитов и макрофагов: новые

молекул и паттерны экспрессии генов .J Immunol. (2006) 177: 7303–11.

doi: 10.4049 / jimmunol.177.10.7303

25. Гупта С., Джайн А., Сайед С.Н., Снодграсс Р.Г., Пюгер-Мюллер Б., Лейзеганг

МС и др. IL-6 усиливает индуцированную IL-4 поляризацию первичных макрофагов человека

за счет синергии факторов транскрипции STAT3, STAT6 и BATF

. Онкоиммунология (2018) 1–17. doi: 10.1080 / 2162402X.2018.1494110

Границы иммунологии | www.frontiersin.org 10 декабря 2018 г. | Том 9 | Артикул 2858

Восстановление начальных этапов импорта митохондриального белка

  • 1

    Hachiya, N. et al. EMBO J. 12 , 1579–1586 (1993).

    CAS Статья Google ученый

  • 2

    Hachiya, N. et al. EMBO J. 13 , 5146–5154 (1994).

    CAS Статья Google ученый

  • 3

    Kiebler, M., Becker, K., Pfanner, N. & Neupert, W. J. Membrane Biol. 135 , 191–207 (1994).

    Google ученый

  • 4

    Литгоу Т., Глик Б. С. и Шатц Г. Trends biochem. Sci. 20 , 98–101 (1995).

    CAS Статья Google ученый

  • 5

    Moczko, M. et al. J. biol. Chem. 269 , 9045–9051 (1994).

    CAS PubMed Google ученый

  • 6

    Haucke, V., Lithgow, T., Rospert, S., Hahne, K. & Schatz, G. J. biol. Chem. 270 , 5565–5570 (1995).

    CAS Статья Google ученый

  • 7

    Hönlinger, A. et al. Molec. клетка. Биол. (в печати).

  • 8

    Lithgow, T., Junne, T., Suda, K., Gratzer, S. & Schatz, G. Proc. натн. Акад. Sci. США 91 , 11973–11977 (1994).

    ADS CAS Статья Google ученый

  • 9

    Стегер, Х.F. et al. J. Cell Biol. 111 , 2353–2363 (1990).

    CAS Статья Google ученый

  • 10

    Wachter, C., Schatz, G. & Glick, B. S. Molec. Биол. Ячейка 5 , 465–474 (1994).

    CAS Статья Google ученый

  • 11

    Gratzer, S. et al. J. Cell Biol. 129 , 25–34 (1995).

    CAS Статья Google ученый

  • 12

    Эллис, Р. Дж. И Хеммингсен, С. М. Trends biochem. Sci. 14 , 339–343 (1989).

    CAS Статья Google ученый

  • 13

    Hines, V. et al. EMBO J. 9 , 3191–3200 (1990).

    CAS Статья Google ученый

  • 14

    Рэймидж, Л., Джунн Т., Хане К., Литгоу Т. и Шатц Г. EMBO J. 12 , 4115–4123 (1993).

    CAS Статья Google ученый

  • 15

    Haid, A. & Suissa, M. Meth. Энзим. 96 , 192–205 (1983).

    CAS Статья Google ученый

  • 16

    Glick, B. S. et al. Cell 69 , 809–822 (1992).

    CAS Статья Google ученый

  • 17

    Hines, V. & Schatz, G. J. biol Chem. 268 , 449–454 (1993).

    CAS PubMed Google ученый

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Умеренное увеличение экспрессии Mdr1a / 1b вызывает устойчивость к доксорубицину in vivo на мышиной модели наследственного рака молочной железы

    Abstract

    Ранее мы обнаружили, что приобретенная устойчивость к доксорубицину на генно-инженерной модели рака молочной железы, связанной с BRCA1, была связана с повышенной экспрессией мышиных генов с множественной лекарственной устойчивостью ( Mdr1 ), которые кодируют АТФ-связывающую кассету переносчика лекарственного препарата. B1 / P-гликопротеин (P-gp).Здесь мы показываем, что даже умеренное увеличение экспрессии Mdr1 (всего в 5 раз) достаточно, чтобы вызвать устойчивость к доксорубицину. Эти умеренно повышенные уровни P-gp в опухоли ниже уровней, обнаруженных в некоторых нормальных тканях, таких как кишечник. Фенотип устойчивости можно полностью обратить вспять с помощью ингибитора P-gp третьего поколения тариквидар, который обеспечивает полезную стратегию для обхода этого типа приобретенной устойчивости к доксорубицину. Присутствие MDR1A в опухолях, устойчивых к лекарствам, с умеренным увеличением количества транскриптов Mdr1a и может быть продемонстрировано с помощью недавно созданного куриного антитела против пептида P-gp мыши.Наши данные показывают полезность реалистичных доклинических моделей для характеристики уровней экспрессии гена Mdr1 , достаточных для возникновения устойчивости. [Cancer Res 2009; 69 (16): 6396–9]

    • доксорубицин
    • множественная лекарственная устойчивость
    • P-гликопротеин
    • рак груди
    • BRCA1

    Введение

    Антрациклин доксорубицин часто используется в стандартных режимах адъювантной, неоадъювантной или паллиативной химиотерапии для пациентов с раком груди ( 1).Доксорубицин увеличивает уровень (двухцепочечных) разрывов ДНК, что приводит к гибели клеток. Спонтанные опухоли молочной железы, в которых отсутствует безошибочная гомологически направленная репарация повреждений ДНК, особенно чувствительны к этому препарату ( 2). Однако успешной химиотерапии рака груди препятствует развитие множественной лекарственной устойчивости. В качестве основной причины был идентифицирован ряд различных механизмов, включая изменения в мишени лекарственного средства, накопление / метаболизм лекарственного средства, восстановление ДНК или пути гибели клеток ( 3– 6).Для некоторых из этих механизмов их отношение к устойчивости в реальных опухолях невелико ( 7– 10). Одним из наиболее хорошо охарактеризованных механизмов множественной лекарственной устойчивости in vitro является отток лекарственного средства с помощью переносчиков АТФ-связывающей кассеты (ABC), таких как ABCB1 / MDR1 / P-гликопротеин (P-gp), ABCG2 / BCRP или ABCC1 / MRP1 ( 3). P-gp присутствует в апикальной мембране многих различных нормальных клеток, и его субстратная специфичность широкая ( 11, 12). Тем не менее, актуальность P-gp для клинической множественной лекарственной устойчивости рака груди все еще обсуждается ( 13– 15).Одна проблема, которая поддерживает этот аргумент, – это сложность обнаружения P-gp in situ с использованием фиксированных формалином образцов опухолей. Другая проблема заключается в том, что ингибиторы P-gp принесли лишь умеренную пользу в клинике. Неспецифические ингибиторы первого поколения, такие как верапамил и циклоспорин А, не достигли клинически эффективных уровней в плазме, необходимых для ингибирования P-gp ( 16). Ингибиторы второго поколения, такие как PSC 833 (валсподар), были более эффективными и селективными, но их фармакокинетические взаимодействия с лекарствами часто требовали снижения доз противоопухолевых лекарств.Более селективным ингибитором P-gp третьего поколения является тариквидар (XR9576, Avaant; исх. 17). В нескольких исследованиях не было обнаружено клинически значимого взаимодействия с фармакокинетикой таких агентов, как доксорубицин, винкристин, паклитаксел или винорелбин, хотя (умеренное) увеличение побочных эффектов химиотерапии наблюдалось у пациентов ( 18).

    Мы недавно исследовали противоопухолевые лекарственные реакции на генетически модифицированной мышиной модели наследственного рака груди ( K14cre; Brca1 F / F ; p53 F / F ; ссылки.2, 19). Опухоли молочной железы, которые спонтанно развиваются в этой модели, имитируют ключевые особенности карциномы молочной железы, ассоциированной с раком молочной железы 1 (BRCA1), у людей. Преимущество этой мышиной модели состоит в том, что эти особенности, а также профили экспрессии отдельных опухолевых генов сохраняются при ортотопической трансплантации небольших фрагментов опухоли сингенным мышам. Поскольку BRCA1 необходим для восстановления двухцепочечных разрывов ДНК путем гомологичной рекомбинации, неудивительно, что протестированные опухоли Brca1 – / – / p53 – / – были чувствительны к взаимодействующим с ДНК лекарствам. цисплатин, доксорубицин ( 2) топотекан, 3 и карбоплатин или ингибитор поли (АДФ-рибоза) полимеразы AZD2281 ( 20, 21).Тем не менее, опухоли не удалось ликвидировать, и в конечном итоге они приобрели устойчивость к каждому из протестированных препаратов, за исключением цисплатина и карбоплатина. Основным механизмом приобретения устойчивости к доксорубицину и AZD2281 в этих опухолях была повышенная экспрессия генов Mdr1a и Mdr1b (сокращенно Mdr1 ), которые кодируют мышиный P-gp, переносящий лекарственное средство. Высокая экспрессия Mdr1 была связана с повышенным вымыванием субстрата P-gp 99m Tc-sestamibi и перекрестной резистентностью к таксану доцетакселу ( 2).Интересно, что мы обнаружили только небольшое (~ 5-кратное) увеличение количества транскриптов Mdr1 и в некоторых опухолях и задались вопросом, достаточно ли этого для объяснения устойчивого фенотипа.

    Здесь мы сообщаем, что ~ 5-кратное увеличение по сравнению со средними уровнями транскриптов Mdr1a и Mdr1b необработанных опухолей достаточно, чтобы вызвать устойчивость к доксорубицину. Такие количества намного ниже количества транскриптов, обнаруживаемых в нормальных тканях, таких как кишечник ( Mdr1a ) или почки и надпочечники ( Mdr1b ).В нескольких опухолях, показывающих умеренное увеличение экспрессии гена Mdr1 , уровни P-gp можно было определить с помощью вновь созданного поликлонального антитела.

    Материалы и методы

    Животные, образование опухолей молочной железы и ортотопические трансплантации сингенным мышам дикого типа. Чувствительность к доксорубицину и резистентность к доксорубицину Brca1 – / – ; p53 – / – опухолей молочной железы были образованы в K14cre; Brca1 F / F ; p53 F / Мыши F , генотипированные и ортотопически трансплантированные, как описано ( 2, 22).Через 2 недели после трансплантации опухоли начало роста опухоли проверяли не реже трех раз в неделю. Размер опухоли молочной железы определяли штангенциркулем (длина и ширина в мм), а объем опухоли (в мм 3 ) рассчитывали по следующей формуле: 0,5 × длина × ширина 2 . Животных умерщвляли CO 2 , когда объем опухоли достигал 1500 мм 3 . В дополнение к стерильному сбору множества кусочков опухоли для экспериментов по пересадке, образцы опухолей были мгновенно заморожены в жидком азоте и зафиксированы в 4% формалине.Все экспериментальные процедуры на животных были одобрены Комитетом по этике животных Нидерландского института рака.

    Наркотики. Доксорубицин (Adriblastina; Pharmacia Netherlands) разводили до 1 мг / мл в физиологическом растворе (Braun). Тариквидар (Аваант) разводили 5% глюкозой, так что конечный объем, вводимый внутрибрюшинно. инъекция составляла 10 мкл / г массы тела.

    Лечение животных с опухолями молочной железы. Когда опухоли молочной железы достигли размера ~ 200 мм 3 , было дано 5 мг доксорубицина i.v. в день 0. Контроли не обрабатывали. Чтобы избежать накопления токсичности повторных инъекций лекарственного средства, дополнительное лечение не проводилось после периода восстановления в 7 дней, когда опухоль реагировала на лечение (размер опухоли <50% от исходного объема, частичный ответ). В этом случае лечение возобновляли после того, как опухоль вернулась к своему первоначальному размеру (100%). Для опухолей с объемом ≥50% после периода восстановления было проведено дополнительное лечение той же дозой, как указано выше.

    Мультиплексный анализ амплификации зонда, зависящий от лигирования. Тотальную РНК и ДНК выделяли из мгновенно замороженных образцов опухолей с помощью Trizol (Invitrogen) в соответствии с протоколом производителя. Реакции мультиплексной лигирования-зависимой амплификации зонда (MLPA) на образцах ДНК проводили, как описано 4 и используемые олигонуклеотиды указаны в дополнительной таблице S1. Целостность РНК проверяли денатурирующим гель-электрофорезом. Для количественной оценки РНК был проведен анализ обратной транскрипции-MLPA, включающий обратную транскрипцию, гибридизацию, лигирование, амплификацию ПЦР и анализ фрагментов с помощью капиллярного электрофореза, как описано ( 2).Для обнаружения гипоксантин фосфорибозилтрансферазы 1 ( Hprt1 ), мы использовали в качестве CAGGTCAGCAAAGAACT обратной транскрипции праймера (5′-3 ‘) и TCCTCATGGACTGATTATGGACAGGACTGAAAG, ACTTGCTCGAGATGTCATGAAGGAGATGGGAGGCCATCACA и TTGTGGCCCTCTGTGTGCTCAAGGGGGGCTAT (5′-3’) в качестве целевых специфических последовательностей для реакции лигирования . Для β 2 -микроглобулин , CTGCGTGCATAAATTGTATAG (5′-3 ‘) использовали в реакции обратной транскрипции, а CATGTGATCAAGCATCATGATGCTCTGAA и GATTCATTTGAACCTGCTATTAATTACA’AATCCAGT ′TC (шаг 5’AATCCAGT) для стадии 5’AATCCAGTTC (5′-3’).

    5′-Быстрая амплификация концов кДНК. Общая РНК была экстрагирована из четырех опухолей, устойчивых к доксорубицину, и четырех необработанных опухолей. Была проведена количественная оценка РНК, и был проведен стандартный протокол 5′-быстрой амплификации концов кДНК (5′-RACE) для определения сайта начала транскрипции транскриптов Mdr1a и Mdr1b . Набор Generacer был получен от Invitrogen, и 5′-RACE был выполнен в соответствии с инструкциями производителя. Праймеры были сконструированы так, чтобы они находились в кодирующих областях рядом со стартовым сайтом ATG.Продукты RACE клонировали в вектор TOPO TA (Invitrogen) и трансформировали в бактерии. Множественные клоны (по крайней мере, 20 для каждого эксперимента с 5′-RACE) секвенировали для создания репертуара транскрибируемых последовательностей мРНК, экспрессируемых в каждой опухоли. RACE праймеры (5′-3 ‘): ген-специфического праймера Mdr1a : MseMdr1a JM5: CTTCCCTTAAGGTCCTCTTCAAGTTCC, вложенная праймер Mdr1a : MseMdr1a JM6: AAGTTCCATCACGACCTCACGTGTCTCTACC, ген-специфического праймера mdr1b : MseMdr1b JM7: GAACGTGAAATAATTTGGCTACCTCTTTTTGCCC, вложенная праймер Mdr1b : MseMdr1bnest JM8: TCTGCTCTTCCCTTAAGGTTCTCTTCAAACTCC.Для настройки процедуры мы использовали отобранные винбластином линии клеток макрофагов мыши J774.2 и J7.V1, описанные Гринбергером и его коллегами ( 23) и любезно предоставлены C.P.H. Янг и доктор Сьюзан Б. Горовиц (Медицинский колледж Альберта Эйнштейна).

    Вестерн-блоттинг. Образцы опухолей гомогенизировали в 10 ммоль / л KCl, 1,5 ммоль / л MgCl 2 , 10 ммоль / л Tris-HCI (pH 7,4) и 0,5% (мас. / Об.) SDS с добавлением полных ингибиторов протеазы (Roche). . ДНК разрезали ультразвуком, и образцы, содержащие 50 мкг белка, фракционировали с помощью SDS-PAGE на 7.5% трис-глициновый гель, а затем переносят на нитроцеллюлозную мембрану электроблоттингом. После блоттинга мембраны блокировали в течение не менее 1 часа в TBS (10 ммоль / л Трис, 100 ммоль / л NaCl), содержащем 5% сухого молока и 0,05% Твин, с последующей инкубацией в течение ночи при 4 ° C с антителом C219 при 1,2 мкг / мл. Иммунореактивность визуализировали с помощью кроличьих антимышиных иммуноглобулинов, конъюгированных с пероксидазой хрена (DakoCytomation; разведение 1: 5 000), с последующим усиленным детектированием хемилюминесценции.

    LS9509 антитело. Последовательности мышиных генов Mdr1a и Mdr1b анализировали с помощью алгоритма Хоппа и Вудса для определения потенциальных пептидов для синтеза и продукции антител. Затем пептиды были обработаны методом BLAST для базы данных Swiss-Prot, чтобы определить уникальность и помочь предсказать специфичность полученных антител. Пептид KMGKKSKKEKKEKKPAVSV был выбран и синтезирован, а поликлональные антисыворотки цыплят были созданы в Lifespan Biosciences.Чтобы обеспечить конъюгацию пептида с белком-носителем, остаток цистеина был добавлен к концу NH 2 пептидов. 77-дневные желтки подвергали пептидной аффинной очистке, и полученные антисыворотки затем использовали в качестве первичных антител, названных LS9509.

    Иммуноцитохимия. LLC-PK1 и его соответствующие линии, трансфицированные P-gp, выращенные на предметных стеклах, фиксировали ацетоном при -20 ° C в течение 40 секунд и инкубировали в бессывороточном блоке белка (DakoCytomation) в течение 1 часа.Затем клетки инкубировали в течение ночи с PBS, содержащим 1% бычий сывороточный альбумин и первичное антитело, которое было либо LS9509, либо C219 (Calbiochem) при конечной концентрации белка 0,26 или 2,9 мкг / мл соответственно. Предметные стекла промывали PBS с последующей инкубацией с соответствующим вторичным антителом, связанным с биотином, в течение 1 часа при разведении 1: 1000 (об. / Об.) И конъюгатом стрептавидин-пероксидаза хрена (Vector Laboratories) в течение 30 минут при комнатной температуре. Иммунореакции визуализировали с помощью диаминобензидина (Sigma), а срезы окрашивали гематоксилином.

    Иммунофлуоресценция на срезах тканей. Свежеразрезанные замороженные срезы опухолевой ткани мышей толщиной 4 мкм фиксировали ацетоном при -20 ° C в течение 10 мин. Затем срезы блокировали для авидина / биотина (DakoCytomation) в течение 10 минут и в бессывороточном блоке белка (DakoCytomation). Для иммунофлуоресценции C219 были введены дополнительные этапы блокирования для устранения неспецифических взаимодействий с блоком мышь-мышь (набор M.O.M; Vector Laboratories) в соответствии с инструкциями производителя.Затем срезы ткани инкубировали в течение ночи при 4 ° C с первичными антителами (0,26 мкг / мл для антитела LS9509 или 11,6 мкг / мл для антитела C219). Предметные стекла промывали PBS с последующей инкубацией с соответствующим вторичным антителом, связанным с биотином, в течение 1 часа при разведении 1: 1000 (об. / Об.) И 30-минутной инкубации со стрептавидином-Cy5 (Invitrogen) в разведении 1 : 50 (об. / Об.) И, наконец, 5-минутная инкубация с 4 ‘, 6-диамидино-2-фенилиндолом для окрашивания ядер. Предметные стекла промывали PBS, как описано выше, и помещали в монтажную среду Vectashield (молекулярные зонды).Флуоресценцию Cy5 и 4 ‘, 6-диамидино-2-фенилиндола в срезах ткани анализировали с помощью конфокального флуоресцентного микроскопа Leica AOBS.

    Результаты

    Устойчивость к доксорубицину Brca1 – / – ; p53 – / – опухолей с умеренным увеличением экспрессии Mdr1a / Mdr1b может быть обращена ингибитором P-gp tariquidar. В дополнение к опубликованным соотношениям резистентных опухолей к подобранным образцам, взятым до лечения ( 2), мы определили уровни экспрессии гена Mdr1 в доксорубицин-чувствительных и доксорубицин-резистентных опухолях молочной железы мышей по сравнению с выбранными нормальными тканями с помощью обратной транскрипции-MLPA. actinβ, Hprt1 и β 2 -микроглобулин использовали в качестве эталона, и относительные уровни транскриптов Mdr1 сравнивали с уровнями в печени, кишечнике, надпочечниках и почках, которые, как известно, экспрессируют P-gp. Как показано в рисунок 1 , средний уровень Mdr1 РНК в необработанных опухолях был сопоставим с таковым в селезенке. Интересно, что опухоль 5 (T5), которая имеет уровень РНК в 1,9 и 2,0 раза выше, чем в среднем Mdr1a и Mdr1b для нелеченных опухолей, показала стабильное заболевание в ответ на доксорубицин, тогда как другие опухоли обычно уменьшались в размерах. ответ на лечение ( 2).В устойчивых опухолях по крайней мере в 2 раза повышенные уровни РНК Mdr1 и выше среднего значения Mdr1 для нелеченых опухолей были обнаружены в 11 из 13 опухолей ( Рисунок 1; Дополнительная таблица S2). Mdr1a уровни транскрипта варьировались между уровнями, достигнутыми в печени (T6doxres и T8doxres, в 2-3 раза выше среднего для нелеченных опухолей), двенадцатиперстной кишке (T5doxres, T7doxres и T * 19doxres, в 5-6 раз выше среднее значение для нелеченых опухолей), подвздошной кишки и толстой кишки (T * 4doxres, T * 20doxres, T * 22doxres, T * 23doxres2 и T * 23doxres3, что в 36 раз превышает среднее значение для необработанных опухолей).Что касается транскриптов Mdr1b , только в двух опухолях (T * 23doxres2 и T * 23doxres4) были измерены уровни между уровнями, обнаруженными в почках или надпочечниках (от 31 до 52 раз выше среднего для нелеченных опухолей), но ни одна из них не достигла этих значений. находится в надпочечнике. Таким образом, только одна резистентная к доксорубицину опухоль (T * 22doxres) имела более высокие уровни РНК Mdr1 , чем некоторые нормальные ткани.

    Рисунок 1.

    Сравнение уровней мРНК Mdr1 с уровнями, обнаруженными в нормальных тканях.Анализ с помощью обратной транскрипции MLPA соотношений экспрессии Mdr1a и Mdr1b в нормальных тканях ( желтый, ), резистентных к доксорубицину опухолях ( красный ) и образцах из соответствующих необработанных опухолей ( синий ). Сумма экспрессии актина β, Hprt1 и β 2 -микроглобулин ( β 2 M ) была использована в качестве эталона. Зеленые пунктирные линии, среднее значение Mdr1a / (actinβ + Hprt1 + β 2 M) и Mdr1b / (actinβ + Hprt1 + β 2 M) отношения (0.19 и 0,072), обнаруженные в нелеченых опухолях. Колонки, среднее соотношение трех реакций; бар, SD.

    При ортотопической трансплантации сингенным животным резистентные к доксорубицину опухоли сохраняли свой фенотип устойчивости или демонстрировали лишь небольшую задержку роста в присутствии доксорубицина (см. 2; Рис. 2 ), тогда как первично чувствительные опухоли значительно сократились ( 2). Чтобы определить важность P-gp в опухолях, резистентных к доксорубицину, мы предварительно обработали мышей ингибитором P-gp тариквидаром ( 17).Когда 10 мг тариквитара / кг в / в. вводили за 15 минут до доксорубицина, животные могли переносить только четыре-пять последующих обработок MTD доксорубицином (5 мг / кг внутривенно, время восстановления минимум 7 дней). Это меньше, чем то, что можно вводить, когда доксорубицин назначается в виде единственного агента (обычно переносятся по крайней мере восемь циклов). Гистологический анализ умерщвленных животных после многократных доз доксорубицина + тариквитара выявил истощение костного мозга как наиболее вероятную причину токсичности (данные не показаны).После первоначальной инъекции в день 0 (объем ∼200 мм 3 ) через 7 дней проводились дополнительные процедуры в случае, если размер опухоли составлял> 50% от размера в день 0. В случае, если опухоль регрессировала до размера менее 50 %, мы возобновили лечение, когда опухоль рецидивировала до 100%. Как показано в Фиг. 2, ингибирование P-gp успешно изменило резистентность к доксорубицину в трех отдельных опухолях, в которых мы обнаружили повышенные уровни мРНК Mdr1 и . T * 23doxres1, в котором не наблюдалось увеличения Mdr1 ( Инжир.1), показал лишь небольшое преимущество предварительной обработки тариквидаром. Несмотря на то, что опухоли снова стали чувствительны к доксорубицину, их не удалось уничтожить комбинацией тариквидар-доксорубицин.

    Рисунок 2.

    Ответ доксорубицин-резистентных опухолей на доксорубицин в сочетании с тариквидаром. Фрагменты резистентных к доксорубицину опухолей с различным увеличением количества транскриптов Mdr1, (T * 23doxres2, T * 23doxres3 и T7doxres) или без поддающихся обнаружению изменений мРНК Mdr1 (T * 23doxres1) трансплантировали ортотопически сингенным мышам ( и не подвергали лечению). темно-синий ) или обработанные 10 мг тариквитара / кг i.v. ( бирюзовый ), 5 мг доксорубицина / кг в / в. ( розовый ) или 10 мг тариквитара / кг в / в. с последующим 15 мин спустя 5 мг доксорубицина / кг в / в. ( зеленый, оранжевый и коричневый ). В случае, если опухоли не уменьшились <50%, животных отправляли повторно после периода восстановления, равного 7 суткам. Указаны дни, когда животные были возвращены ( белых кружков, треугольников или квадратов ). Если даны планки ошибок (SD), точки данных представляют собой среднее значение трех отдельных животных.Из-за вариабельности рецидивирующих опухолей после комбинаций тариквидар-доксорубицин представлены три отдельные кривые для T * 23doxres2, T * 23doxres3 и T7doxres.

    Повышающая регуляция Mdr1 не вызывается амплификацией гена в большинстве опухолей и не коррелирует с использованием дифференциального промотора Mdr1a или Mdr1b . Амплификация MDR1 или его гомологов грызунов наблюдалась во многих линиях клеток с множественной лекарственной устойчивостью (см.4). Напротив, мы не обнаружили увеличения содержания ДНК в 12 из 13 доксорубицин-устойчивых опухолей по сравнению с образцами, взятыми до лечения опухоли (дополнительный рисунок S1). Только для T * 23doxres4 было выявлено увеличение в 1,8 раза. Однако небольшое увеличение числа копий Mdr1 может быть трудно обнаружить в необработанных образцах опухоли. Поэтому мы обогатили опухолевые клетки из двух опухолей, устойчивых к доксорубицину (T * 23doxres2 и T7doxres), путем удаления мертвых клеток, эндотелиальных, фибробластных и гемопоэтических (Lin + ) клеток после диссоциации опухоли.MLPA-анализ этих клеток Lin не обнаружил какой-либо амплификации Mdr1 (дополнительный рисунок S2). Эти результаты предполагают, что повышенная транскрипция Mdr1 , а не амплификация гена, вызывает повышенную экспрессию Mdr1 в большинстве опухолей.

    В образцах опухолей человека и клеточных линиях описаны два типа транскрипционной активации гена MDR1 человека: перестройки ДНК, связывающие ген MDR1 с сильным промотором ( 24, 25) и активация «дистального» промотора на 100 т.п.н. выше гена MDR1 ( 26, 27).В линиях мышиных клеток активация гена Mdr1 также может происходить путем (дефектной) вставки ретровируса ( 28) или перестройками ДНК, которые, как предполагается, являются результатом неравного обмена сестринскими хроматидами, опосредованного повторяющимися элементами LINE-1 ( 29). Чтобы проверить, применим ли какой-либо из этих механизмов к нашим устойчивым опухолям, мы картировали начало транскриптов Mdr1a и Mdr1b , используя протокол 5′-RACE, который позволяет клонировать последовательности, связанные с 5′-кэпом. Результаты, полученные для кэпированных транскриптов четырех отдельных опухолей, устойчивых к доксорубицину, и соответствующих им контролей, чувствительных к доксорубицину, представлены в Инжир.3 . Как для Mdr1a , так и для Mdr1b мы обнаруживаем ряд транскриптов, начинающихся с проксимального промотора, от 132 до 186 нуклеотидов выше ATG в случае Mdr1a и от 116 до 186 нуклеотидов для Mdr1b . Эти стартовые сайты приблизительно совпадают с позициями начала транскрипции, найденными ранее для Mdr1a ( 30, 31) и Mdr1b ( 32, 33) в клеточных линиях и нормальных тканях. В нашей модели нет очевидной разницы между точными стартовыми участками устойчивых и чувствительных опухолей.

    Рисунок 3.

    Mdr1 5′-RACE доксорубицин-устойчивых и сопоставимых доксорубицин-чувствительных опухолей. A, продукты Mdr1a , выровненные с последовательностью Mdr1a . Числа (в нуклеотидах; нуклеотидов и ) указывают, что каждая опухоль (чувствительная или устойчивая) экспрессирует транскрипты с различной длиной 5′-нетранслируемой области. Длинные транскрипты соответствуют областям, содержащим канонические сайты сплайсинга, далеко перед стартовым сайтом ATG, что указывает на использование дистального стартового сайта транскрипции.Все опухоли (резистентные к доксорубицину и чувствительные к доксорубицину) экспрессируют транскрипты, которые используют либо проксимальные стартовые сайты транскрипции, либо смесь проксимальных и дистальных стартовых сайтов транскрипции. Уровни Mdr1a РНК, полученной из этих опухолей, нормализованы до actinβ, Hprt1 и β2M . B, продукты 5′-RACE Mdr1b , выровненные с последовательностью Mdr1b . Числа (в нуклеотидах) показывают, что каждая опухоль экспрессирует транскрипты с различной длиной 5′-нетранслируемой области.Все опухоли (резистентные к доксорубицину и чувствительные к доксорубицину) экспрессируют транскриптов Mdr1b , которые используют проксимальный сайт старта транскрипции. Уровни Mdr1b РНК, полученной из этих опухолей, нормализованы до актинβ, Hprt1 и β2M .

    Для Mdr1a мы также находим транскрипты, начинающиеся намного выше гена. Мы находим их в четырех отдельных опухолях, каждая из которых начинается в положении 8567101 п.н. хромосомы 5. 5 Примечательно, что в этом ограниченном анализе небольшого числа опухолей мы не видим корреляции между использованием этого дистального промотора и повышающей регуляцией Mdr1a .В двух лекарственно-чувствительных опухолях (T * 20 и T * 22) и одной лекарственно-устойчивой опухоли без детектируемой активации Mdr1a (T * 23doxres4) мы находим транскрипт с дистального промотора, тогда как среди трех опухолей с Mdr1a активирует транскрипт только дистального промотора в T4doxres. Даже из этого ограниченного набора опухолей ясно, что повышающая регуляция Mdr1a не связана конкретно с активацией дистального промотора в опухолях молочной железы наших мышей, в отличие от того, что наблюдалось в опухолях / клеточных линиях человека ( 26, 34).Дистальный промотор для Mdr1a , не идентичный идентифицированному здесь, был обнаружен только в одном наборе отобранных винбластином клеточных линий макрофагов мыши ( 30).

    Обнаружение MDR1A с новым мышиным специфическим антителом. Мы определили количество P-gp с помощью вестерн-блоттинга и / или иммунофлуоресценции с рядом специфичных для мыши и человека антител, таких как C219 (Calbiochem), 265 / F4, 4E3, Ab36743 и SPM137 (все от Abcam), Nh311 ( 35), 15Д3 ( 36) и UIC2 (Chemicon).Из протестированных антител моноклональное антитело C219 ( 37), который является одним из наиболее часто используемых для обнаружения P-gp человека и мыши ( 38, 39), был наиболее чувствительным при обнаружении MDR1A и MDR1B мыши в LLC-PK1 поляризованных клетках почек свиньи, трансфицированных генами Mdr1 (см. 40; Дополнительные рис. S3 и S4). В опухолях, содержащих по крайней мере в 25 раз большее количество транскриптов Mdr1 , чем в необработанных опухолях (T4doxres, T * 22doxres, T * 23doxres2 и T * 23doxres4), P-gp был обнаружен вестерн-блоттингом с использованием C219 (дополнительный рис.S3), хотя это антитело также неспецифически связывается с другими белками, на что указывают несколько полос. Однако в нескольких опухолях с умеренным повышением экспрессии Mdr1 (T5doxres, T6doxres, T7doxres и T * 23doxres3) мы не обнаружили явно больше P-gp, чем в нелеченных доксорубицин-чувствительных опухолях (T1, T2, T * 22con, и T * 23con).

    Чтобы улучшить обнаружение мышиного P-gp in situ , мы вывели новое куриное поликлональное антитело с использованием пептида KMGKKSKKEKKEKKPAVSV, который соответствует аминокислотам 17-35 мышиного MDR1A (номер доступа.NP_035206). Эта NH 2 -концевая последовательность имеет высокую гомологию с MDR1B мыши (18 из 19) и MDR1 человека (16 из 19). В нашем поиске подходящих пептидов мы избегали внеклеточных петель из-за их повышенного риска связывания конформационно-специфичных антител. Кроме того, мы выбрали KMGKKSKKEKKEKKPAVSV, чтобы избежать перекрестной реакции с MDR3 / ABCB4, так как это усложняет использование C219, который реагирует с основной последовательностью VQEALD, также присутствующей в ABCB4 ( 41, 42). Когда мы тестировали полученные аффинно очищенные поликлональные антитела LS9509 на трансфицированных клетках LLC-PK1, иммуноцитохимическим методом можно было обнаружить только MDR1A, тогда как MDR1B и MDR1 человека не были идентифицированы ( Инжир.4 А ). К сожалению, это антитело не дало положительного результата при вестерн-блоттинге (данные не показаны). Чтобы оценить пригодность LS9509 для иммуноокрашивания, мы сравнили срезы головного мозга Mdr1 животных дикого типа с таковыми, полученными от Mdr1 – / – животных ( 43). Как показано на Рис. 4 B , LS9509 окрашенные капилляры головного мозга у животных дикого типа, но не у животных с нокаутом. Когда мы исследовали нашу панель резистентных к доксорубицину опухолей с помощью LS9509, мы обнаружили, что большее количество опухолей давало окрашивание плазматической мембраны, чем антитело C219 (дополнительная таблица S3): все опухоли с высокими уровнями транскриптов Mdr1a (T4doxres, T * 22doxres, и T23 * doxres2) были положительными.Из опухолей с умеренным увеличением Mdr1a , T5doxres, T7doxres, T * 19doxres, T * 20doxres и T * 23doxres3 показали положительное окрашивание, тогда как все другие резистентные к доксорубицину опухоли были отрицательными. На рис. 4 C показаны репрезентативные примеры T * 22doxres, T23 * doxres2 и T5doxres с соответствующими элементами управления. Эти результаты показывают, что P-gp действительно экспрессируется в опухолях с умеренной активацией транскрипции Mdr1 .

    Рисунок 4.

    Анализ доксорубицин-чувствительных и резистентных к доксорубицину опухолей с помощью куриного поликлонального антитела LS9509. A, LLC-PK1 полярные клетки почек свиньи, трансфицированные мышью Mdr1a, Mdr1b или человеческим MDR1 , зондированные LS9509 ( коричневый ). B, срезов головного мозга дикого типа ( wt ) или Mdr1a / b – / – животных, испытанных с помощью антитела LS9509 ( белый, столбцы 1 и 3; зеленый, столбцы 2 и 4 ). Ядра окрашивали 4 ‘, 6-диамидино-2-фенилиндолом ( синий, столбцы 2 и 4). C, OCT мгновенно замороженные слайды опухолей необработанных или резистентных к доксорубицину опухолей, инкубированных с LS9509 ( белый, столбцы 1 и 3; зеленый, столбцы 2 и 4).Ядра окрашивали 4 ‘, 6-диамидино-2-фенилиндолом ( синий, столбцы 2 и 4). Все инкубации проводили с антителом LS9509 в конечной концентрации 0,26 мкг / мл.

    Обсуждение

    В этом исследовании мы показываем, что умеренное увеличение экспрессии генов Mdr1 и , кодирующих P-gp, является достаточным для того, чтобы вызвать приобретенную устойчивость к доксорубицину в реалистичной мышиной модели рака молочной железы, ассоциированного с BRCA1. В нескольких устойчивых опухолях уровни мРНК Mdr1 были всего в 5-13 раз выше среднего уровня Mdr1a или Mdr1b в необработанных опухолях.Уровни в устойчивых опухолях сопоставимы с уровнями, обнаруженными в печени или двенадцатиперстной кишке мышей дикого типа, и мы редко обнаруживали уровни опухолей, превышающие уровни, обычно обнаруживаемые в толстой кишке ( Mdr1a ) или почках ( Mdr1b ). В нормальных тканях пониженная чувствительность к доксорубицину также имеет независимые от P-gp причины, такие как отсутствие механизмов пролиферации или восстановления интактной ДНК. В исследованных опухолях мы уверены, что эти низкие уровни P-gp вызывают резистентность к доксорубицину, поскольку резистентность может быть отменена с помощью ингибитора P-gp третьего поколения тариквидар.Мы пришли к выводу, что в нашей модели опухоли P-gp играет ключевую роль в возникновении лекарственной устойчивости даже в опухолях с 5-кратным увеличением мРНК Mdr1a и Mdr1b . Наша неспособность уничтожить опухоли комбинацией тариквидар-доксорубицин может быть связана с бездействием остаточных клеток, инициирующих опухоль, или другими механизмами ( 44).

    До сих пор было трудно показать роль P-gp в лекарственно-устойчивом раке груди in vivo . Например, метаанализ 31 исследования рака молочной железы обнаружил экспрессию P-gp в 41% опухолей и связал трехкратное снижение ответа на химиотерапию с присутствием P-gp ( 45).Тем не менее, к таким исследованиям следует относиться с недоверием из-за огромных различий в определении того, что представляет собой «P-gp-положительная опухоль». Совсем недавно в клинических испытаниях фазы II тарикдар показал ограниченную способность восстанавливать чувствительность к лекарствам у 17 женщин с раком груди III-IV стадии, у которых прогрессировало или имело стабильное заболевание на терапии антрациклином или таксанами ( 46). Только пациент с наибольшим увеличением захвата 99m Tc-сестамиби, который также продемонстрировал индуцибельную экспрессию P-gp, частично ответил на терапию, содержащую тариквидар.Очевидно, что для увеличения потенциальной пользы от терапии, ингибирующей P-gp, необходим тщательный отбор пациентов. In vivo визуализация с использованием субстрата P-gp 99m Tc-sestamibi является одним из подходов, и мы также обнаружили повышенное вымывание сестамиби в нашей модели опухоли, устойчивой к доксорубицину ( 2, 47). Однако этот индикатор не является полностью специфичным для P-gp и других насосов для оттока лекарств (например, MRP1; исх. 48), которые не ингибируются P-gp-специфическими транспортными блокаторами, могут давать ложноположительный результат.

    Другой подход – это in situ обнаружение с помощью P-gp-специфических антител. Наши попытки создать более чувствительное антитело для окрашивания мышиного P-gp были частично успешными: новое куриное антитело LS9509 обнаруживает только мышиный MDR1A in situ . Тем не менее, восемь резистентных к доксорубицину опухолей с по меньшей мере 5-кратным повышением уровней транскрипта Mdr1a по сравнению с необработанными опухолями были признаны P-gp-положительными, тогда как C219 обнаружил P-gp только в одной из этих опухолей.Возможно, использование блока «мышь-мышь» для C219 является причиной его пониженной чувствительности. Хотя по-прежнему возможно, что другие специфические для человека антитела, у которых отсутствует перекрестная реактивность мыши, лучше работают с образцами человека, может быть полезно создать более чувствительные инструменты для обнаружения P-gp в срезах опухоли. Помимо новых антител, чувствительных как к иммуногистохимии, так и к иммуноблоттингу, усиление сигнала с помощью метода лигирования близости ( 49) – еще один вариант, который можно протестировать и оптимизировать в нашей модели.

    Хотя наша модель имитирует ключевые особенности BRCA1-ассоциированного рака молочной железы, она не отражает полной гетерогенности реакции на лечение, наблюдаемой при раке молочной железы. Мы не наблюдали внутренней резистентности к доксорубицину у опухолей, не получавших лекарственные препараты, хотя у людей в ответ на химиотерапию, содержащую антрациклин, часто обнаруживается стабильное или прогрессирующее заболевание. Насколько повышенная экспрессия P-gp способствует первичной устойчивости к химиотерапии у пациентов с раком груди, остается под вопросом.Плохие результаты предварительного лечения тарикдаром у таких пациентов ( 46) не одобряет ключевую роль P-gp. Преимущество нашей модели мыши состоит в том, что мы можем размножаться по Mdr1 -null аллелям ( 43) для выявления Mdr1 -независимых механизмов резистентности к доксорубицину. Будущие исследования опухолей Mdr1 – / – ; Brca1 – / – , p53 – / – должны выявить новые механизмы лекарственной устойчивости, которые также могут быть задействованы в раке груди человека, где ингибирование P-gp не выгодно.

    Раскрытие информации о потенциальных конфликтах интересов

    A.O.H. Нигрен – сотрудник компании MRC-Holland, которая продает тесты MLPA, используемые в этой статье. Остальные авторы не сообщили о потенциальных конфликтах интересов.

    Благодарности

    Грантовая поддержка: гранта Голландского онкологического общества в 2006-3566 (П. Борст, С. Роттенберг и Дж. Йонкерс) и 2005-3379 (П. Борст, Р. Бернардс и Р. Л. Бейерсберген), интегрированный проект FP6 Европейского Союза. 037665-ХЕМОРЕС (П.Borst and S. Rottenberg), а также грант Швейцарского фонда грантов в области биологии и медицины PBBEB-104429 (S. Rottenberg).

    Расходы на публикацию этой статьи были частично покрыты за счет оплаты страницы. Таким образом, данная статья должна быть помечена как реклама в соответствии с 18 U.S.C. Раздел 1734 исключительно для указания этого факта.

    Мы благодарим Альфреда Шинкеля за критическое прочтение рукописи и Сьюзан Бейтс (NIH) за предоставленный тарификатар, и мы благодарны доктору Р.Susan B. Horwitz (Медицинский колледж Альберта Эйнштейна) за предоставление клеточных линий со сверхэкспрессией Mdr1a и Mdr1b , используемых для создания протокола 5′-RACE.

    Сноски

    • Получено 7 января 2009 г.
    • Исправление получено 8 мая 2009 г.
    • Принято 3 июня 2009 г.
    • © Американская ассоциация исследований рака, 2009 г.

    Ссылки

    1. DeVita VT, Jr., Хеллман С, Розенбург С.А. Рак, принципы и практика онкологии. 6-е изд. Филадельфия: Липпинкотт Уильямс и Уилкинс, 2001. стр. 3–3235.

    2. Rottenberg S, Nygren AOH, Pajic M, et al. Селективная индукция устойчивости к химиотерапии опухолей молочной железы в условной мышиной модели наследственного рака молочной железы. Proc Natl Acad Sci U S A 2007; 104: 12117–22.

    3. Szakacs G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM.Ориентация на множественную лекарственную устойчивость при раке. Nat Rev Drug Discov 2006; 5: 219–34.

    4. Fojo T. Множественные пути к фенотипу лекарственной устойчивости: мутации, транслокации, делеции и амплификация кодирующих генов или промоторных областей, эпигенетические изменения и микроРНК. Обновление лекарственного средства 2007; 10: 59–67.

    5. Schmitt CA. Старение, апоптоз и терапия – отрезки жизни от рака.Нат Рев Рак 2003; 3: 286–95.

    6. Voorzanger-Rousselot N, Alberti L, Blay JY. CD40L индуцирует множественную лекарственную устойчивость к апоптозу в клетках карциномы молочной железы и лимфомы через каспазонезависимые и зависимые пути. BMC Рак 2006; 6: 75.

    7. Brown M, Wilson G. Гены апоптоза и устойчивость к терапии рака: что говорят нам экспериментальные и клинические данные? Рак Biol Ther 2007; 2: 477–90.

    8. Браун Дж. М., Аттарди ЛД. Роль апоптоза в развитии рака и ответе на лечение. Нат Рев Рак 2005; 5: 231–7.

    9. Borst P, Jonkers J, Rottenberg S. Что делает опухоли множественной лекарственной устойчивостью? Клеточный цикл 2007; 6: 2782–7.

    10. Ронинсон И.Б., Броуд Э.В., Чанг Б.Д. Если не апоптоз, то что? Вызванное лечением старение и митотическая катастрофа в опухолевых клетках.Обновления Drug Resist 2001; 4: 303–13.

    11. Devault A, Gros P. Два члена семейства генов mdr мыши придают множественную лекарственную устойчивость с перекрывающимися, но разными лекарственными специфичностями. Mol Cell Biol 1990; 10: 1652–63.

    12. Уэда К., Кардарелли С., Готтесман М.М., Пастан I. Экспрессия полноразмерной кДНК человеческого гена «MDR1» придает устойчивость к колхицину, доксорубицину и винбластину.Proc Natl Acad Sci U S A 1987; 84: 3004–8.

    13. Pusztai L. Маркеры, прогнозирующие клиническую пользу при раке груди от агентов, нацеленных на микротрубочки. Анналы онкологии ЕСМО 2007; 18 Дополнение 12: xii15–20.

    14. О’Дрисколл Л., Клайнс М. Биомаркеры и множественная лекарственная устойчивость при раке груди. Цели лекарств от рака Curr 2006; 6: 365–84.

    15. Faneyte IF, Kristel PM, van de Vijver MJ.Определение экспрессии MDR1 / P-гликопротеина при раке груди. Int J Рак 2001; 93: 114–22.

    16. Raderer M, Scheithauer W. Клинические испытания агентов, обращающих вспять множественную лекарственную устойчивость. Обзор литературы. Рак 1993; 72: 3553–63.

    17. Мистри П., Стюарт А.Дж., Дэнджерфилд В. и др. In vitro и in vivo Обращение множественной лекарственной устойчивости, опосредованной P-гликопротеином, с помощью нового мощного модулятора XR9576.Рак Res 2001; 61: 749–58.

    18. Fox E, Bates SE. Тариквидар (XR9576): ингибитор оттока лекарственного средства Р-гликопротеина. Эксперт Rev Anticancer Ther 2007; 7: 447–59.

    19. Лю Х, Холстедж Х, ван дер Гулден Х и др. Соматическая потеря BRCA1 и p53 у мышей вызывает опухоли молочной железы с патологическими и молекулярными особенностями базального рака молочной железы человека, мутировавшего BRCA1. Proc Natl Acad Sci U S A 2007; 104: 12111–6.

    20. Rottenberg S, Jaspers JE, Kersbergen A, et al. Высокая чувствительность BRCA1-дефицитных опухолей молочной железы к ингибитору PARP AZD2281 отдельно и в комбинации с препаратами платины. Proc Natl Acad Sci U S A 2008; 105: 17079–84.

    21. Мартин С.А., лорд К.Дж., Эшворт А. Дефицит репарации ДНК как терапевтическая мишень при раке. Curr Opin Genet Dev 2008; 18: 80–6.

    22. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, Van der Valk M, Berns A.Синергетическая опухолевая супрессорная активность BRCA2 и p53 в условной мышиной модели рака молочной железы. Нат Жене 2001; 29: 418–25.

    23. Гринбергер Л.М., Лотштейн Л., Уильямс СС, Хорвиц С.Б. Определенные предшественники Р-гликопротеина избыточно продуцируются в независимо изолированных линиях клеток, устойчивых к лекарствам. Proc Natl Acad Sci U S A 1988; 85: 3762–6.

    24. Микли Л.А., Шпенглер Б.А., Кнутсен Т.А., Бидлер Д.Л., Фоджо Т.Перестройка гена: новый механизм активации гена MDR-1. J Clin Invest 1997; 99: 1947–57.

    25. Микли Л.А., Ли Дж.С., Вен Зи и др. Генетический полиморфизм в MDR-1: инструмент для изучения экспрессии аллелей в нормальных клетках, линиях клеток, не прошедших отбор и отобранных с помощью лекарств, и опухолях человека. Кровь 1998; 91: 1749–56.

    26. Chen KG, Wang YC, Schaner ME, et al. Генетическое и эпигенетическое моделирование происхождения клеток с множественной лекарственной устойчивостью в линии клеток саркомы человека.Рак Res 2005; 65: 9388–97.

    27. Scotto кВт. Транскрипционная регуляция переносчиков лекарств ABC. Онкоген 2003; 22: 7496–511.

    28. Lepage P, Devault A, Gros P. Активация мышиного гена mdr3 путем вставки ретровируса в опухолевые клетки P388 с множественной лекарственной устойчивостью. Mol Cell Biol 1993; 13: 7380–92.

    29. Коэн Д., Хигман С.М., Сюй С.И., Хорвиц С.Б.Участие элемента LINE-1 в перестройке ДНК перед геном mdr1a в линии мышиных клеток с множественной лекарственной устойчивостью к таксолу. J Biol Chem 1992; 267: 20248–54.

    30. Хсу С.И., Коэн Д., Киршнер Л.С., Лотштейн Л., Хартштейн М., Хорвиц С.Б. Структурный анализ промотора mdr1a (P-гликопротеин) мыши выявил основу дифференциальной гетерогенности транскриптов в клетках J774.2 с множественной лекарственной устойчивостью. Mol Cell Biol 1990; 10: 3596–606.

    31. Lepage P, Raymond M, Nepveu A, Gros P. Активация транскрипции мышиного гена mdr3 совпадает с появлением новых сайтов инициации транскрипции в опухолевых клетках P388 с множественной лекарственной устойчивостью. Рак Res 1993; 53: 1657–64.

    32. Раймонд М., Грос П. Ген множественной лекарственной устойчивости млекопитающих: корреляция организации экзона со структурными доменами и дупликация предкового гена.Proc Natl Acad Sci U S A 1989; 86: 6488–92.

    33. Коэн Д., Пикарз Р.Л., Хсу СИ-Х, ДеПиньо Р.А., Карраско Н., Хорвиц С.Б. Структурно-функциональный анализ промотора гена mdr1b мыши. J Biol Chem 1991; 266: 2239–44.

    34. Huff LM, Lee JS, Robey RW, Fojo T. Характеристика перестроек генов, ведущих к активации MDR-1. J Biol Chem 2006; 281: 36501–9.

    35. Rao PS, Govindarajan R, Mallya KB, West W, Rao US.Характеристика нового антитела, индуцированного против NH 2 конца P-гликопротеина. Clin Cancer Res 2005; 11: 5833–9.

    36. Ши Т., Рин Дж., Ридер Дж., Лю Д., Кольцо ДБ. Высокоаффинные моноклональные антитела против Р-гликопротеина. Клин Иммунол Иммунопатол 1995; 76: 44–51.

    37. Kartner N, Evernden-Porelle D, Bradley G, Ling V. Обнаружение P-гликопротеина в линиях клеток с множественной лекарственной устойчивостью с помощью моноклональных антител.Природа 1985; 316: 820–3.

    38. Barrand MA, Twentyman PR. Дифференциальное распознавание продуктов генов mdr1a и mdr1b в линиях опухолевых клеток мышей с множественной лекарственной устойчивостью различными моноклональными антителами. Br J Рак 1992; 65: 239–45.

    39. Chintamani, Singh JP, Mittal MK, et al. Роль экспрессии P-гликопротеина в прогнозировании ответа на неоадъювантную химиотерапию при раке груди – проспективное клиническое исследование.Мир J Surg Oncol 2005; 3: 61.

    40. Schinkel AH, Wagenaar E, Van Deemter L, Mol CAAM, Borst P. Отсутствие P-гликопротеина mdr1a у мышей влияет на тканевое распределение и фармакокинетику дексаметазона, дигоксина и циклоспорина A. J Clin Invest 1995; 96: 1698–705.

    41. Schinkel AH, Borst P. Характеристика человеческого Р-гликопротеина MDR3 и его перекрестная реактивность с моноклональными антителами, специфичными для Р-гликопротеина.Рак Res 1991; 51: 2628–35.

    42. Джорджес Э., Брэдли Дж., Гариепи Дж., Линг В. Обнаружение изоформ Р-гликопротеина с помощью ген-специфичных моноклональных антител. Proc Natl Acad Sci U S A 1990; 87: 152–6.

    43. Schinkel AH, Mayer U, Wagenaar E, et al. Нормальная жизнеспособность и измененная фармакокинетика у мышей, лишенных Р-гликопротеинов mdr1-типа (переносящих лекарственные средства). Proc Natl Acad Sci U S A 1997; 94: 4028–33.

    44. Borst P, Rottenberg S, Jonkers J. Как настоящие опухоли становятся устойчивыми к цисплатину? Клеточный цикл 2008; 7: 1353–9.

    45. Трок Б.Дж., Леонесса Ф., Кларк Р. Множественная лекарственная устойчивость при раке груди: метаанализ экспрессии MDR1 / gp170 и его возможного функционального значения. J Natl Cancer Inst 1997; 89: 917–31.

    46. Pusztai L, Wagner P, Ibrahim N, et al.Фаза II исследования тариквитара, селективного ингибитора Р-гликопротеина, у пациентов с химиотерапевтической резистентной прогрессирующей карциномой молочной железы. Рак 2005; 104: 682–91.

    47. Van Leeuwen F, Buckle T, Kersbergen A, Rottenberg S, Gilhuijs KG. Неинвазивная функциональная визуализация опосредованной P-гликопротеином устойчивости к доксорубицину на мышиной модели наследственного рака молочной железы для прогнозирования ответа и определения чувствительности к ингибитору P-gp. Eur J Nucl Med Mol Imaging 2009; 36: 406–12.

    48. Hendrikse NH, Franssen EJF, Van der Graaf WTA и др. 99m Tc-sestamibi является субстратом для P-гликопротеина и белка, связанного с множественной лекарственной устойчивостью. Br J Рак 1998; 77: 353–8.

    49. Содерберг О., Гуллберг М., Ярвиус М. и др. Прямое наблюдение индивидуальных эндогенных белковых комплексов in situ путем лигирования близости. Методы природы 2006; 3: 995–1000.

    Адаптация H⁺-накачки и активности плазматической мембраны H⁺-АТФазы в протеоидных корнях белого люпина при дефиците фосфата на JSTOR

    Абстрактный

    Люпин белый (Lupinus albus) способен адаптироваться к дефициту фосфора, производя корни протеидов, которые выделяют огромное количество органических кислот, что приводит к мобилизации труднорастворимых фосфатов почвы в ризосфере. Механизмы, ответственные за высвобождение органических кислот протеоидными клетками корня, особенно процессы трансмембранного транспорта, не выяснены.Из-за высокого цитозольного pH высвобождение недиссоциированных органических кислот маловероятно. В настоящем исследовании мы сосредоточились на экспорте Н + с помощью Н + АТФазы плазматической мембраны в активных корнях протеидов. In vivo закисление ризосферы активных протеоидных корней было чувствительным к ванадату. Плазматические мембраны выделяли из корней протеидов и боковых корней из растений с дефицитом и дефицитом фосфора. In vitro, по сравнению с двумя типами боковых корней и протеоидных корней P-достаточных растений, в активных протеоидных корнях P-дефицитных растений индуцировалось следующее увеличение различных параметров: (a) гидролитическая активность АТФазы, (b) Vmax и Km, (c) концентрация фермента H + АТФазы в плазматической мембране, (d) H + -пампинговая активность, (e) градиент pH через мембрану везикул плазмалеммы и (f) пассивная проницаемость H + плазматической мембраны.Кроме того, были определены более низкая чувствительность к ванадату и более кислый оптимум pH для АТФазы плазматической мембраны активных протеоидных корней. Наши данные подтверждают гипотезу о том, что в активных протеоидных клетках корня Н + и органические анионы экспортируются отдельно, и что модификация Н + АТФазы плазматической мембраны необходима для усиленного закисления ризосферы активными протеоидными корнями.

    Информация о журнале

    Основанный в 1926 году, Plant Physiology – международный журнал, посвященный физиологии, биохимии, клеточной и молекулярной биологии, генетике, биофизике и экологической биологии растений.Физиология растений – один из старейших и наиболее уважаемых журналов по науке о растениях.

    Информация об издателе

    Oxford University Press – это отделение Оксфордского университета. Издание во всем мире способствует достижению цели университета в области исследований, стипендий и образования. OUP – крупнейшая в мире университетская пресса с самым широким присутствием в мире. В настоящее время он издает более 6000 новых публикаций в год, имеет офисы примерно в пятидесяти странах и насчитывает более 5500 сотрудников по всему миру.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *