Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Кухонный комбайн bosch ремонт своими руками

Самое подробное описание: кухонный комбайн bosch ремонт своими руками от профессионального мастера для своих читателей с фотографиями и видео из всех уголков сети на одном ресурсе.

Кухонные комбайны различных моделей прочно обосновались на кухне, и многие хозяйки уже не могут обходиться без таких изобретательных в приготовлении блюд помощников. При возникновении неисправностей в кухонных комбайнах Bosch, Мулинекс, Мария, Ладомир может быть 2 варианта: отнести устройство в сервисный центр (актуально, если оно еще находится на гарантии) или попробовать осуществить ремонт своими руками. Мы рассмотрим второй вариант.

Чтобы успешно пользоваться этими приборами в быту, достаточно знать назначение основных их составляющих. А вот для успешного ремонта пригодится знание внутреннего устройства техники и схема кухонного комбайна, которая, как правило, прилагается к инструкции по эксплуатации техники.

Все комбайны делятся на 3 основных типа:

  • мини-устройства;
  • компактные изделия;
  • агрегаты многофункционального вида.

К последнему типу относятся устройства, в которых есть комбинация мясорубки с соковыжималкой, но принцип работы у всех типов комбайнов совершенно идентичен. Например, фирма Мулинекс выпускает компактные комбайны с симпатичным дизайном и простой разборкой для мытья, у них понятный для любой домохозяйки интерфейс. Кухонный комбайн Ладомир отличается привлекательным дизайном, а цена намного ниже, чем у импортных аналогичных изделий. Модель 408 оснащена новейшими технологиями, которые позволяют хозяйке приготовить любое, самое сложное блюдо.

Нет видео.

Видео (кликните для воспроизведения).

К основным элементам любого комбайна, в независимости от производителя, относятся:

  • двигатель электрического типа;
  • специальное приспособление для переработки различных продуктов питания;
  • камеры, предназначенные для обработки различных ингредиентов;
  • комплект насадок, дисков и ножей;
  • основная панель, с клавишами для управления процессами;
  • электрическая разводка для соединения всех элементов.

Корпус подобных изделий изготавливается из довольно прочного пластика, а комплекты ножей, дисков для нарезания овощей — из нержавеющего материала, стали особого сорта.

Например, кухонный комбайн Мрия 2М изготовлен из таких материалов, которые применяются в конструкции отечественных ракет, что говорит о высоком качестве и прочности такого изделия.

Схема использования комбайна весьма простая: продукты закладываются в определенную часть изделия, доводятся там до нужной консистенции, согласно выбранного режиму. Процессы и насадки меняются, управление понятное и не требует объяснений — все интуитивно понятно. В любом процессе участвует электродвигатель, именно на него приходится самая большая нагрузка при эксплуатации комбайна. Понять, что с универсальным помощником происходят какие-то неполадки, довольно просто.

  1. Появились посторонние звуки во время работы — скрип, скрежет или циклический стук.
  2. Изнутри кухонного комбайна идет неприятный запах тлеющей электропроводки.
  3. На насадках, дисках или ножах мясорубки появились трещины и сколы.
  4. Комбайн работает неравномерно, как раньше, или же не в том режиме, который ему задан.
  5. При весьма непродолжительной работе корпус сильно нагревается, и агрегат издает нетипичные для правильной работы звуки.
  6. Изделие не включается при нажатии на клавишу Пуск.

На практике можно встретить любую поломку аналогичного агрегата — это не зависит от его марки или модели. Механизм не вечен, и какая-то его деталь со временем может износиться, главное, не пропустить этот момент — проще заменить одну деталь, чем отремонтировать весь узел. Самостоятельно можно устранить только механические повреждения: заменить растянувшийся ремень или вставить новую шпонку, да и при этом надо иметь начальные знания, чтобы разборка агрегата была проведена без изъянов и досадных ошибок.

В электрической схеме и двигателе могут быть легкие неполадки: например, перегорел предохранитель, или износилась одна из щеток. Но бывают и весьма сложные — из-за сильных перегрузок произошел пробой обмотки двигателя, требуется замена коллектора или платы управления.

Во время демонтажа агрегата запоминайте или фотографируйте, чтобы знать, что и куда прикручивать при сборке и как правильно сделать подключения электропроводки.

Порядок работы несложный и выполняется по такой методике:

  • отключить изделие от электрической сети;
  • демонтировать все съемные детали;
  • снять корпус комбайна с подставки, удалить корпус и выяснить целостность ременной передачи или привода;
  • достать двигатель, визуально осмотреть, чтобы найти подгорания;
  • прокрутить вручную ротор, чтобы убедиться в легкости вращения;
  • снять кожух защиты с редуктора, чтобы проверить вал привода.

Все детали для замены можно приобрести в магазинах или центрах, которые обслуживают пользователей конкретной марки изделия.

Передаточный момент в разных комбайнах организован по-разному. Так, в некоторых изделиях он осуществляется с помощью ременной передачи, поэтому при плохой работе изделия необходимо снять ремень, и приобрести в специализированном магазине новый. Если передача происходит с использованием шпонки на валу (это называется прямой привод, например, такой у комбайна Мрия 2м), а она износилась от длительной эксплуатации, то придется разобрать весь агрегат для ее замены. Алгоритм действий при самостоятельном ремонте вы легко найдете в интернете.

В помощь домашним мастерам предлагаем посмотреть вот такое видео:

Специалисты по обслуживанию бытовой техники для кухни предлагают такие методы, которые реально продлят эксплуатацию любого комбайна.

  1. В контейнеры для переработки надо укладывать мелко нарезанные продукты питания, не стоит дробить в блендере твердые ингредиенты, работать с замороженными овощами.
  2. Почувствовали запах горелой проводки — немедленно прекратите работу и выясняйте причину его появления, отключив изделие от сети.
  3. По окончании любых работ сразу же промывайте все детали и элементы, участвующие в процессе обработки.
  4. Не используйте насадки или диски с дефектами, так вы можете навредить комбайну и его внутренним деталям.
  5. По истечении гарантии надо планомерно проводить профилактические работы, не реже одного раза в год.

Выполняя эти рекомендации, вы значительно увеличиваете срок использования агрегата, а консультируясь с мастерами по ремонту — гарантируете безопасную работу изделия после всех работ.

На сегодняшний день кухонный комбайн Bosch и многих других производителей стали почти, что незаменимыми устройствами на кухне. Существуют разнообразные модификации данных агрегатов, которые позволяют выполнять различные задачи, и вы при этом не приложите никаких особых усилий. Для некоторых домохозяек они стали очень важны, и любая поломка в системе становится серьезной проблемой. В данной статье мы расскажем вам об устройстве прибора и как производить ремонт кухонных комбайнов своими руками.

Нет видео.
Видео (кликните для воспроизведения).

Устройство состоит из отдельных элементов механизма, самые основные элементы следующие:

  • электрический двигатель;
  • приемник перерабатывающих продуктов;
  • камера для обработки ингредиентов;
  • комплекты насадок и ножей;
  • главная панель управления комбайном;
  • электрическая проводка, соединяющая основные элементы.

Материал корпуса у комбайнов обычно изготовлен из пластика. Однако все остальные детали, такие как насадки, ножи и другие элементы производятся из нержавеющей стали, так как она долговечна, и именно на внутренние части устройства идет наибольшая нагрузка.

Комбайны подразделяются на несколько типов:

Последний тип комбайнов это такие, в которых, например, идет комбинация мясорубки и соковыжималки. Однако, несмотря на их различные функциональные особенности, у них у всех одинаковый принцип работы.

После загрузки продуктов в рабочую камеру комбайна, они доводятся до нужного состояния согласно заданной программе. Процессы могут меняться, заменяя насадки на них и задавая устройству необходимые команды. Насадки приходят в движения благодаря электрическому двигателю. Понять, что ваш кухонный комбайн требует срочного вмешательства, достаточно просто:

  • новые звуковые эффекты, которые устройство ранее не издавало, например – скрипы, стуки, скрежет и другие им подобные;
  • вы чувствуете, что из машинки идет неприятный запах горящей проводки;
  • на насадках образовались трещины и сколы;
  • агрегат начинает работать в неравномерном темпе, или же он работает не в том режиме по заданной программе;
  • устройство не хочет активироваться и начинать работать.

Что касается части по передачи крутящего момента, то в некоторых комбайнах применяется ременная передача для передачи момента на основные рабочие органы. Когда устройство начинает плохо работать, то возможно, что уже пришло время заменить износившийся ремень. Также имеется и шпоночная передача крутящих усилий, в данном случае может износиться шпонка, что также приведет к неработоспособности комбайна.

Существует множество вариантов неполадок комбайнов, возможно из строя могут выйти какие-то его внутренние элементы, в случае выхода одной детали из строя, может, сломается весь механизм. Также не реки случаи, когда проблемы возникают в самой проводке агрегата, когда происходит короткое замыкание.

Любым владельцам рано или поздно придется самостоятельно ремонтировать свой кухонный комбайн. Перед тем как разобрать кухонный комбайн, убедитесь, действует ли на него еще гарантия после покупки. Если таковая имеется, то лучше всего отнесите агрегат в сервисный центр для того, чтобы они оказали необходимое обслуживание и вернули комбайну его работоспособность.

Но как бывает в большинстве случаев, поломки происходят уже после окончания гарантийного срока, тут уже стоит попробовать самим разобрать и произвести ремонт кухонного комбайна Bosch, прежде чем идти и сдавать его в ремонт, где с вас возьмут много денег за ремонт.

Первым делом разбираем кухонный комбайн, однако хорошо запоминайте, что откуда снимали и откручивали, так как вам придется собирать агрегат обратно. Все действия сводятся к следующему:

  • выключите устройство от электросети и демонтируйте все съемные детали;
  • снимите сам комбайн и удостоверьтесь в целостности ремня и приводных шестеренок;
  • снимете вышеуказанные элементы, и достаньте двигатель. Осмотрите его на предмет целостности и работоспособности;
  • уберите защитный кожух с редуктора и проверьте приводной вал на признаки дефектов.

В случае, если у вас другая модель, вы легко сможете найти видео и подробные инструкции на просторах интернета.

Когда вы собираетесь покупать замену для какой-то детали, обязательно берите оригинальные, так как сторонние попросту не смогут спокойно встать в паз. Такие элементы вы можете приобрести в специальных сервисных центрах, или же заказать их через интернет.

  1. Лучше всего обрабатывать мелкопорезанные продукты, и не стоить перерабатывать замороженные овощи, мясо и прочие вещи. Также не рекомендуется дробить твердые ингредиенты;
  2. Как только вы почувствовали неприятный запах исходящий из комбайна, сразу же выключайте его, дабы избежать короткого замыкания, и не допустить появления поломки;
  3. После того как вы закончили работу, необходимо тщательно промывать те элементы комбайна, которые принимали участи в обработке продуктов. Перед повторным использованием, тщательно высушивайте все детали;
  4. Ни в коем случае не применяйте насадки, на которых имеются дефекты, это может навредить самому комбайну;
  5. После того как истечет гарантийный срок, лучше всего регулярно (хотя бы раз или два в год) проводить профилактические работы с комбайном.
    Разбирать его и смазывать необходимые узлы механизма, а также заранее производить замену изношенных частей устройства, при их обнаружении во время разборки, дабы избежать неисправностей в дальнейшем.

Мы рассказали вам основные способы как произвести ремонт кухонных комбайнов, и как лучше всего избегать неприятных ситуаций с поломкой данного устройства. В случае возникновения трудностей рекомендуется обращаться к мастерам, которые найдут неисправность и произведут качественный и правильный ремонт.

В данной статье, мы будем производить самостоятельный ремонт редуктора, кухонного комбайна бош Для ремонта нам потребуется отвертка T25 (Звездочка).

Берем отвертку и откручивает 5 болтов.

Снимаем верхнюю крышку и откручиваем 6 болтов.

Снимаем корпус редуктора и меняем большую шестеренку, которая вышла из стоя, в следствии не работал редуктор, и комбайн не прокручивал.

Собираем аппарат в обратной последовательности, закручиваем на место все болты.

В данной статье мы рассказали, как своими руками отремонтировать кухонный комбайн. Чаще всего причиной такой поломки является попадание твердых продуктов во время использования вашего аппарата. Не рекомендуется использование продуктов, в которых присутствуют хрящи, мелкие косточки и жилы, тогда ваш комбайн прослужит еще долгое время.

Сообщение elremont » 20 май 2009 16:31

Сообщение bear148d » 20 май 2009 16:41

Сообщение elremont » 20 май 2009 17:38

Сообщение Kuzyaj » 23 май 2009 23:24

Сообщение bear148d » 26 май 2009 12:05

Сообщение SashkaRRR » 26 май 2009 16:40

Сообщение Kuzyaj » 26 май 2009 17:29

Сообщение Sandors » 27 июл 2009 12:52

Сообщение Kuzyaj » 28 июл 2009 16:21

Сообщение Sandors » 29 июл 2009 11:25

Спасибо за совет!
Мой комбайн еще поживет! Надо немного внимательнее относиться к рычагам концевиков. Собрал! Работает.

Кухонный комбайн BOSCH MCM 5530 при включении любой скорости

двигатель вращается на максимальных оборотах несколько секунд

Проверка выявила обрыв датчика скорости

Датчик скорости это стандартный дроссель на 4.7 мгн

Поиски дросселя в магазинах не к чему не привели

Случайно попалась плата от зарядки сотового телефона там стоял

Был закреплен в близи магнитного кольца на расстоянии 1мм

двигатель начал вращятся как положенно зазор был плавно увеличен до 5 мм

при 5 мм двигатель стал работать рывками

Из чего был сделан вывод что чувствительности дросселя 3.9 мгн вполне достаточно

Датчик был установлен на штатное место и проверен

Двигатель работал устойчиво

Часть схемы цепи переключения скорости не показаны

Добавлено (12.03.2014, 10:59)
———————————————
Управился с установкой нового модуля (все оказалось просто), вот в работе ничего не изменилось

ПА-А-МА-ГИ-ТЕ пожалуйста.
Включается, работает секунд 10 и выключается, что делать? Почему так.

семистор Т435 600т звонится 80ом (на плате не выпаивая) между А1 и G (анодом1 и упр электродом) в обе стороны. больше никак не звонится.
дросель на самом краю платы который стоит около крутящегося магнита на валу двигателя
(наверно датчик вращения) не звонится никак .
он бледно зелёного цвета.
палоски :
зелёная 5
чёрная 0
красная 100 (или коричневая тогда 1000 не разберу)
серебристая 10%

на сколько это микрогенри выходит? и чем его заменить если нет такого?

Добавлено (12.03.2014, 16:59)
———————————————
включил на прямую. всё нормально прёт как танк! ничего и не греется я минуты три держал ,всё нормально . спрошу у хозяина если так устроит буду собирать. там походу пол платы выгорило . менять мне нечем ,запчастей в наш колхоз не возят так что как то так . пусть работает на прямую или не работает вообще никак.

Добавлено (13. 03.2014, 08:18)
———————————————
Бродяга0167, так же не бывает
может двиготель подклинивает ? покрути сзади за крыльчатку рукой ,должен легко крутится клемы проверь на которые ты стыкуешь новый модуль может одна какая либо подабуглена контакта достойного не будет и датчик будет срабатывать. почисти всё подожми. Переключатель скоростей проверь или регулятор что стоит у тебя.
пройдись по всему вышеперечисленному для начала.

Виды и причины поломок

Неправильная эксплуатация комбайна приводит к возникновению поломок. Запасные части и элементы для кухонных агрегатов купить дешевле, чем новый прибор. Поэтому ремонт комбайнов – приемлемый способ решения проблемы.

К самым распространенным поломкам относят неисправность двигателя, управляющей платы, трансформаторов, подшипников. А также поломки насадок, выключателей и сетевого шнура.

Причины поломок: нарушения условий эксплуатации; небрежное отношение; скачки напряжения; естественный износ механизмов и деталей.

Виды ремонта кухонных комбайнов

Ремонт кухонных агрегатов можно разделить на три категории сложности:

– ремонт легкий – не требует разборки прибора;

– ремонт средний – требует полной разборки агрегата;

– ремонт сложный – требует замены двигателя, подшипников и трансформаторов.

Для нормального функционирования комбайна его комплектация включает в себя самые различные насадки. С их помощью можно быстро и легко приготовить полезные, вкусные блюда. В основе насадок должен быть качественный материал, на это необходимо обращать внимание. Они могут загрязняться и выходить из строя.

Легкий ремонт агрегата – замену насадок, ручек и сетевого шнура можно осуществить самостоятельно. Практически любой механизм или блок агрегата можно заменить на новый. Приводной ремень и шестеренки могут разорваться или износиться.

Ремонт кухонного комбайна средней сложности – замена таких деталей, как выключатели, щетки электродвигателя, емкости и шестеренки требует разборки прибора. Вначале необходимо отключить кухонный комбайн от сети электричества.

Для того чтобы получить доступ к внутренним деталям прибора, необходимо поддеть опоры и снять основу комбайна. Сгоревшие шестеренки, щетки, емкости или выключатели можно приобрести в магазинах. Но лучше ремонт доверить специалистам.

К поломкам, которые требуют сложного ремонта можно отнести: повреждения управляющей платы, подшипников, трансформаторов и электродвигателя комбайна. Для ремонта и устранения таких поломок требуются специальные знания.

Сервисные центры предоставляют услуги по ремонту и обслуживанию бытовых приборов:

– проведение тщательной диагностики;

– выявление причин неполадок;

– ремонт или замена деталей;

– предоставление консультаций по вопросам эксплуатации прибора.

Поставь лайк ♥ и Подпишись на кана.

Поставь лайк ♥ и Подпишись на канал.

Как работают датчики в кухонном комбайне.

Здравствуйте. Мой канал посвящен электронике, (компьютерной технике, радиоэлектронике, обзорам всяких.

Показал как устроен кухонный комбайн, из чего состоит и как проверить.

Показал как проверить и отремонтировать кухонный комбайн.

Любите готовить котлетки и другие вкусности с качественных продуктов – значит наверняка все готовите сами.

This is tutorial for repairing your Bosch ProfiMixx having problems with the speed control. The failing machine runs at maximum speed at any selected speed.

Ремонт Bosch GLM 80 Своими руками. Не работает кнопка. Александр Оробейко Препарируем Bosch Glm 80 с целью исправить.

Поставь лайк ♥ и Подпишись на канал.

Как самому разобрать, почистить и смазать кухонный комбайн самостоятельно. ремонт и разборка кухонного.

Вытяжка. Не работает двигатель. Как я решал эту проблему.

АБС сервис кухонный комбайн BOSCH E-mail мастера: [email protected]

Ремонт венчика или мешалки от кухонного комбайна.

Комбайн, который рубит кубиками.

Как починить и отрегулировать кофемолку в кофемашине.

Ремонт кухонных комбайнов: http://techservice.vn.ua/ В этом видео я заменил мотор старого образца на мотор нового образ.

Это мой второй видеообзор комбайна, спустя год.Ооочень подробное видео о всех функциях комбайна, НЕДОСТАТК.

Как отремонтировать кухонный комбайн своими руками.

JOIN VSP GROUP PARTNER PROGRAM: https://youpartnerwsp.com/ru/join?80110.

Ремонт ремня в кухонном камбаин браун.

В этом видео мы поговорим о восстановлении кухонного комбайна Moulinex из деталей, доставленных в мешке.

Готовим пиццу дома с помощью кухонной машины!

Самостоятельный ремонт повреждённого узла кухонного комбайна.

Характеристики, цена, отзывы Bosch MCM 5529 – http://fotos.ua/bosch/mcm5529ru.html Как комбайн режет кубиками, смотрите по ссылке.

Работа кухонного комбайна BOSCH MUM 4855 на примере шинковки шампиньонов и лука.

dedushkinsekret.ru здоровый позвоночник. Вариант ремонта шестерни привода блэндера BOSH. После ремонта желательно.

Необычный ремонт таймера пароварки.

Обзор кухонного комбайна Bosch MUM 4406.

Хороший Выбор и разумные цены можно посмотреть здесь http://j.mp/1KF4L5T remont-kuhonnogo-kombajna-first-fa-5113 ••••••••••••.

Видео обзор чаши кухонного комбайна BOSH оригинальный номер: 081169. Подробный список моделей на которые подход.

Видео обзор механического предохранителя (муфты) для мясорубок и кухонных комбайнов Bosch Ссылка на оригинал.

Ремонт мясорубки Bosch 1550. Электромясорубка шумит, но при этом ножи не крутятся. В этом видео обзоре мы разбер.

Ремонтируем кухонный комбайн фирмы ORION. Разборка, отыскание причин неисправности, сборка и пробный пуск.

Средняя терка – muz 45 kp 1, терка для драников – muz 45 rs 1, терка для картофеля фри – muz 45 ps 1. Насадка для кухонного.

Продолжаем работу над кухонным комбайном Moulinex из деталей, доставленных в мешке.

%) %) что значит несколько попыток ? сами спецы не с первого раза смогли что ли ?

что значит упущено ? вы его в ремонт сдали, вам вернули такой же. Нафига прилагать усилия ? вы рискуете сломать какие-нибудь пластиковые детали. СМело сдаете его обратно в магазин и либо меняете, либо забираете деньги. Можете это сделать в течении всего гарантийного срока

😀 спасибо..буду пробовать..но на самом деле вчера весь вечер пыталась, не получилось 🙁 видимо пока мне не скажут.

“ВАМ “ПИППИППИ” не “ПИППИППИП”. ПИПИПИП НЕ УМЕЕШЬ СТРОГАЙ НОЖОМ. “. до меня не дойдет. но теперь решила ,что раз у людей включается, значит будем учиться! :blush:

Кухонные комбайны оснащены коллекторными двигателями. Обсудим недостатки и преимущества технического решения; посмотрим устройство прибора, возможности, как выполнить ремонт. Кухонные комбайны не предназначены решать скромные задачи. Готовить салат — полное ведерко, шинковать овощи — килограммами. Видим недостаток кухонного комбайна и преимущество. Для готовки на раз двоим великоват агрегат; требуется накормить толпу гостей — бинго! Приготовьтесь сразу вымыть изделие: внутри останется гора ингредиентов. Ремонт кухонных комбайнов своими руками не представляет сложности, сумевшим разобрать хитроумное приспособление. Поскольку каждый производитель норовит выполнить дизайн своеобразный, постарается сделать, чтобы никто не мог проникнуть внутрь прибора. Советская техника выгодно отличается от кухонных комбайнов, тогда, как известно, дураки в КБ не работали…

Ремонт кухонных комбайнов своими руками требует знания основ. Внутри несложно. Избитая сайтом фраза вновь уместна. Кухонный комбайн призван выполнить то, что сегодня умеет ручной блендер с приставкой из чаши с ножами. В функции входит приготовление коктейлей. В переводе на русский означает: существует три прибора, пересекающиеся взаимно, только последний заменит все:

  • ручной блендер;
  • настольный блендер;
  • кухонный комбайн.

Критически оценим способности кухонного комбайна. Два привода:

  1. Для блендера прямой.
  2. Для измельчения с редуктором через ременную, шестерную передачу.

Кухонный комбайн KitchenAid не отличишь от блендера, убрав насадку, сегодня не рассматриваем простейшие варианты. Итак, приводов два, каждый шток для своих целей. Под блендер выполнен прямой, нисколько не удивляет. Насадкой часто измельчают ингредиенты, создаются значительные нагрузки, через ремень не передашь. По-настоящему интересен второй привод кухонного комбайна, куда приходятся насадки шинковки, терки. Здесь стоит подвижная муфта, при нажатии отключающая вращение. Заранее скажем: в электрической схеме целая куча нажимных реле, отрубающих питание устройства, если не установлены защитные колпаки. Разумеется, защиту можно обмануть.

Радует простота схемного решения. На входе электронной платы стоит до боли знакомый фильтр RC-цепочки, откуда один провод снабжает двигатель, второй проходит симисторную схему регулировки входного тока.

Осуществляется регулировка скорости. Опишем действие схемы:

  1. Питание подается на симистор, работающий в линейном режиме. Ключевой элемент оснащен приличного размера радиатором, рассеивающим лишнее тепло.
  2. На управляющий электрод приходят напряжение, поделенное переменным резистором, обратный отклик двигателя — паразитная ЭДС, возникающая при переключении секций коллектора вращающимся валом.
  3. Вращается регулятор скорости, переменный резистор изменяет значение управляющего напряжения электрода симистора. Обороты растут или уменьшаются.
  4. На двигатель повышается нагрузка, ротор замедляет обороты. Падает значение паразитной обратной ЭДС коллектора, напряжение управляющего электроде симистора изменяется, потребляемый ток начинает расти. Вслед обороты вновь повышаются, двигатель выходит на заданный режим.

Простая схема саморегуляции, с электрической точки зрения претензий к Philips никаких. Молодцы. Не считая пятого проводника, выходящего с двигателя, приходящего на плату, остающегося висеть в воздухе. Впрочем, мелочи в сравнении с шурупами Torx, ввинченными в пластмассу — фальшивка. Двоечка с минусом: покупателя надувать моветон. Схема лишена предохранителей, термозащита в избытке. На обмотке честно написано, внутри прячется предохранитель порогом 135 градусов Цельсия. Рядом еще один, многоразовый. Поражает одна вещь: питание выходит с платы, приходит двигателю, замыкание участка ротор-статор проводится на плате. Зачем делается, сказать сложно.

Устройство рассмотрено, просто как дважды два. Следовательно, отремонтировать кухонный комбайн легко. Посмотрим порядок.

Обсудим, как починить кухонный комбайн. Большинство читателей знает последовательность. Поясняем вопрос подробнее. Везунчику, сумевшему разобрать кухонный комбайн, необходимо сделать следующее:

Такова процедура осмотра. Сломается реостат (выкрошится), некоторые скорости могут не работать, изменение оборотов происходит рывками, неустойчиво. Устройство кухонного комбайна предусматривает наличие защитных реле (микропереключателей), обойдите по цепи питания. С механической точки зрения, если не вращается ременной вал, проверяется следующее:

  1. Не проскальзывает ли ремень.
  2. Исправность муфта.

Ремень напоминает автомобильный. Непростая резинка, изделие с нарезанными зубцами по размерам шестерней. Становятся очевидными две вещи:

  • изделие будет работать долго;
  • если резина сотрется, рассохнется, заменить будет чрезвычайно сложно.

Порекомендуем жесткие, твердые овощи не шинковать. Следить, чтобы на работающий вал чего не намоталось. Что касается привода блендера, нож никак не отключается, вращается в кухонном комбайне. В период, когда насадка соответствующая не используется, вращающийся шток прикрывается защитной крышкой. Без этого прибор не включится, будут неправильно скоммутированы реле, упомянутые выше. Вредно пользоваться теркой. Что характерно, механизмов регулировки натяга ремня нет. Могли оставить пружинку с подвижной шестеренкой, положение регулировалось бы винтом, пусть даже Torx. Заставило бы резиновый компонент прослужить дольше.

Что может сломаться в кухонном комбайне, описали, сами считаем, под угрозой только симистор и конденсатор на входе. Щетки коллекторного двигателя защищены варисторами, гасящие искру при сильном повышении напряжения, не дают мотору сгореть, если спасовал по неведомой причине фильтр на входе. Новичков удивляют таблетки синего цвета, припаянные к корпусу, на деле искра замыкается двумя варисторами, гасится, если амплитуда напряжения позволит. Учитывая неумелую тепловую защиту, обсуждаемую выше, складывается мнение: конструкторы подстраховались на все случаи жизни. Кухонный комбайн Philips будет работать… если ремонт переживет!

Некоторые агрегаты имеют неразборный корпус. Чтобы в сервисном центре заметили попытку вскрытия неизвестным мастером-самоучкой.

В основе устройств лежит регулирование скорости, проще изменять амплитуду. Если асинхронные двигатели реагируют на инверторное управление, в нашем случае ремонт кухонных комбайнов Мулинекс связан с коллекторами и только с ними. Разновидность может управляться микросхемами. Делается путем изменения скважности, варьируется действующее значение, ведет к изменению оборотов мотора. Надеемся, теперь ремонт кухонного комбайна Мрия читателям по зубам и по плечу. Обращаем внимание: толще проволока катушек, двигатель лучше тянет. Чтобы прочувствовать, оцените толщину обмотки ручных блендеров.

Ремонт кухонных комбайнов своими руками

Кухонные комбайны строятся на коллекторных двигателях. Мы сейчас обсудим все недостатки и преимущества такого решения, посмотрим, как устроен прибор, что он может, и, конечно же, как выполнить ремонт, в случае чего. Кухонные комбайны не предназначены для скромных целей. Если готовить салат, то полную тарелку, если шинковать овощи, то килограммами. В этом недостаток кухонного комбайна, но и его преимущество. В том смысле, что для готовки на раз для двоих он не подходит, зато если требуется накормить толпу гостей, то нет ничего лучше. Кстати, приготовьтесь сразу как следует вымыть изделие. Ремонт кухонных комбайнов своими руками не представляет сложности, если удалось разобрать это хитроумное приспособление. Поскольку каждый производитель норовит выполнить не только дизайн своеобразный, но и постараться сделать так, чтобы никто не смог проникнуть внутрь прибора. На наш взгляд советская техника в этом свете выгодно отличается от кухонных комбайнов, но тогда, как известно, дураки в КБ не работали…

Ремонт кухонных комбайнов своими руками требует знания основ. Внутри нет ничего сложного. Эта избитая на нашем сайте фраза опять к месту. Кухонный комбайн обычно призван выполнить все то, что сегодня умеет ручной блендер с приставкой из чаши с ножами. Но ко всему прочему в функции обычно входит приготовление коктейлей. В переводе на русский язык это означает, что существует три прибора, которые пересекаются между собой, причем только последний может заменить собой все:

  • ручной блендер;
  • настольный блендер;
  • кухонный комбайн.

А теперь критически оценим возможности кухонного комбайна. Обычно у него два привода:

  1. Для блендера прямой.
  2. Для измельчения с редуктором через ременную или прямую передачу.

Это отнюдь не догма, потому что кухонный комбайн KitchenAid не отличишь от блендера, если убрать насадку, но мы сегодня не рассматриваем простейшие варианты. Итак, приводов два, каждый шток для своих целей. Под блендер выполнен прямой шток, и нас это нисколько не удивляет. Дело в том, что в этой насадке часто что-то измельчают, здесь создаются реальные нагрузки, которые через ремень не передашь. По-настоящему интересен как раз второй привод кухонного комбайна, куда приходятся насадки для шинковки и терки. Здесь имеется подвижная муфта, которая при нажатии отключает вращение. Заранее скажем, что в электрической схеме имеется целая куча нажимных реле, которые отрубают питание устройства, если не установлены защитные колпаки. Разумеется, защиту можно обмануть, но кто будет это делать специально? (См. также: Ремонт мясорубок своими руками )

Что радует, так это простота схемного решения. На входе электронной платы стоит до боли знакомый фильтр из RC-цепочки, откуда один провод сразу идет на двигатель, а второй проходит через симисторную схему регулировки входного тока.

Так осуществляется управление скоростью. Вот как примерно действует схема:

  1. Питание подается на симистор, который работает в линейном режиме. В связи с этим ключевой элемент оснащен приличного размера радиатором для рассеивания лишнего тепла.
  2. На управляющий электрод приходит напряжение, поделенное переменным резистором, а также обратный отклик двигателя в виде паразитной ЭДС, которая неизбежно возникает при переключении с секции на секцию в коллекторе.
  3. Когда вращается регулятор скорости, переменный резистор изменяет значение управляющего напряжения на электроде симистора. За счет этого обороты растут или уменьшаются.
  4. В то же время, когда на двигатель повышается нагрузка, он замедляет обороты. За счет этого падает значение паразитной обратной ЭДС на коллекторе, в результате напряжение на управляющем электроде симистора изменяется таким образом, что потребляемый ток начинает расти. Вслед за этим обороты вновь повышаются, пока двигатель не выходит на заданный режим.

Вот такая схема саморегуляции, и с электрической точки зрения у нас претензий к Philips не имеется никаких. Молодцы. Если не считать пятого провода, который выходит с двигателя, приходит на плату и остается висеть в воздухе. Впрочем, это мелочи в сравнении с шурупами Torx, которые ввинчиваются в пластмассу, но ничего не держат. Вот за это двоечка, причем с минусом. В схеме не имеется предохранителей, как таковых, зато есть термозащита и в избытке. Прямо на обмотке честно написано, что внутри прячется предохранитель на 135 градусов. Кроме того рядом имеется еще один, но уже многоразовый. Поражает одна вещь: питание выходит с платы, приходит на двигатель, причем замыкание участка ротор-статор проводится на плате. Зачем это делается, сказать сложно.

Вот в общем-то и все устройство, просто как дважды два. Следовательно, и отремонтировать кухонный комбайн легко. Посмотрим, как это примерно сделать.

А теперь пару слов о том, как починить кухонный комбайн. Из сказанного большинство читателей уже знает, как это сделать. Поясняем все же этот вопрос более подробно. Тому, кому повезет разобрать кухонный комбайн необходимо сделать следующее:

Такова общая процедура осмотра. Если сломается реостат (выкрошится), то некоторые скорости могу не работать, изменение оборотов происходит рывками, неустойчиво. Устройство кухонного комбайна предусматривает наличие множества защитных реле (микропереключателей), обойдите их по цепи питания. С механической точки зрения, если не вращается ременной вал, то проверяется следующее:

  1. Не проскальзывает ли ремень.
  2. Исправна ли муфта.

Нужно отметить, что ремень напоминает автомобильный. Это не простая резинка, а изделие с нарезанными зубцами по размерам шестерней. В этом свете сразу становятся очевидными две вещи:

  • изделие будет работать долго;
  • если резина сотрется или рассохнется, заменить ее будет чрезвычайно сложно.

В этом свете можно порекомендовать жесткие и твердые овощи не шинковать. А кроме того следить, чтобы на вал чего не намоталось во время работы. Что касается привода блендера, то он никак не отключается и вращается в кухонном комбайне все время. В период, когда насадка соответствующая не используется, вращающийся шток прикрывается защитной крышкой. Без этого прибор не включится, потому что будут не так скоммутированы реле, упомянутые выше. По этим же причинам вредно пользоваться и теркой. Что характерно, механизмов для регулировки натяга ремня не имеется. Могли бы оставить пружинку с подвижной шестеренкой, положение которой регулировалось бы винтом, пусть даже и Torx. Это заставило бы резиновый компонент служить дольше. (См. также: Ремонт кофемолки своими руками )

Что может сломаться в кухонном комбайне, мы уже описали, и сами считаем, что под угрозой только симистор и конденсатор на входе. Еще добавим, что щетки коллекторного двигателя защищены варисторами, которые гасят искру при сильном повышении напряжения, а также не дают мотору сгореть, если спасовал по какой-то причине фильтр на входе. Многих удивляют эти таблетки синего цвета, припаянные к корпусу, но на самом деле искра как раз замыкается через два варистора, и прекрасно гасится, если амплитуда напряжения позволяет. Учитывая неумелую тепловую защиту, про которую мы говорили выше, складывается мнение, что конструкторы хорошо подстраховались на все случаи жизни. А значит, кухонный комбайн Philips будет работать долго… если ремонт переживет!

В основе всех устройств также лежит регулирование скорости, а проще всего изменять именно амплитуду. Если асинхронные двигатели реагируют на инверторное управление, то в нашем случае ремонт кухонных комбайнов Мулинекс связан с коллекторами и только с ними. Тем не менее и эта разновидность может управляться микросхемами. Это делается путем изменения скважности, за счет чего варьируется и действующее значение, что ведет к изменению оборотов любого мотора. Мы искренне надеемся, что теперь ремонт кухонного комбайна Мрия будет нашим читателям не только по зубам, но и по плечу. Обращаем также внимание на то, что чем толще проволока катушек, тем двигатель лучше тянет. Чтобы прочувствовать это оцените толщину обмотки ручных блендеров.

Автор статьи: Антон Кислицын

Я Антон, имею большой стаж домашнего мастера и фрезеровщика. По специальности электрик. Являюсь профессионалом с многолетним стажем в области ремонта. Немного увлекаюсь сваркой. Данный блог был создан с целью структурирования информации по различным вопросам возникающим в процессе ремонта. Перед применением описанного, обязательно проконсультируйтесь с мастером. Сайт не несет ответственности за прямой или косвенный ущерб.

✔ Обо мне ✉ Обратная связь Оцените статью: Оценка 4.1 проголосовавших: 9

Кухонный комбайн bosch ремонт своими руками

Мы постараемся ответить на вопрос: кухонный комбайн bosch ремонт своими руками по рекомендациям подлинного мастера с максимально подробным описанием.

Кухонные комбайны различных моделей прочно обосновались на кухне, и многие хозяйки уже не могут обходиться без таких изобретательных в приготовлении блюд помощников. При возникновении неисправностей в кухонных комбайнах Bosch, Мулинекс, Мария, Ладомир может быть 2 варианта: отнести устройство в сервисный центр (актуально, если оно еще находится на гарантии) или попробовать осуществить ремонт своими руками. Мы рассмотрим второй вариант.

Чтобы успешно пользоваться этими приборами в быту, достаточно знать назначение основных их составляющих. А вот для успешного ремонта пригодится знание внутреннего устройства техники и схема кухонного комбайна, которая, как правило, прилагается к инструкции по эксплуатации техники.

Видео (кликните для воспроизведения).

Все комбайны делятся на 3 основных типа:

  • мини-устройства;
  • компактные изделия;
  • агрегаты многофункционального вида.

К последнему типу относятся устройства, в которых есть комбинация мясорубки с соковыжималкой, но принцип работы у всех типов комбайнов совершенно идентичен. Например, фирма Мулинекс выпускает компактные комбайны с симпатичным дизайном и простой разборкой для мытья, у них понятный для любой домохозяйки интерфейс. Кухонный комбайн Ладомир отличается привлекательным дизайном, а цена намного ниже, чем у импортных аналогичных изделий. Модель 408 оснащена новейшими технологиями, которые позволяют хозяйке приготовить любое, самое сложное блюдо.

К основным элементам любого комбайна, в независимости от производителя, относятся:

  • двигатель электрического типа;
  • специальное приспособление для переработки различных продуктов питания;
  • камеры, предназначенные для обработки различных ингредиентов;
  • комплект насадок, дисков и ножей;
  • основная панель, с клавишами для управления процессами;
  • электрическая разводка для соединения всех элементов.

Корпус подобных изделий изготавливается из довольно прочного пластика, а комплекты ножей, дисков для нарезания овощей — из нержавеющего материала, стали особого сорта.

Например, кухонный комбайн Мрия 2М изготовлен из таких материалов, которые применяются в конструкции отечественных ракет, что говорит о высоком качестве и прочности такого изделия.

Схема использования комбайна весьма простая: продукты закладываются в определенную часть изделия, доводятся там до нужной консистенции, согласно выбранного режиму. Процессы и насадки меняются, управление понятное и не требует объяснений — все интуитивно понятно. В любом процессе участвует электродвигатель, именно на него приходится самая большая нагрузка при эксплуатации комбайна. Понять, что с универсальным помощником происходят какие-то неполадки, довольно просто.

  1. Появились посторонние звуки во время работы — скрип, скрежет или циклический стук.
  2. Изнутри кухонного комбайна идет неприятный запах тлеющей электропроводки.
  3. На насадках, дисках или ножах мясорубки появились трещины и сколы.
  4. Комбайн работает неравномерно, как раньше, или же не в том режиме, который ему задан.
  5. При весьма непродолжительной работе корпус сильно нагревается, и агрегат издает нетипичные для правильной работы звуки.
  6. Изделие не включается при нажатии на клавишу Пуск.

На практике можно встретить любую поломку аналогичного агрегата — это не зависит от его марки или модели. Механизм не вечен, и какая-то его деталь со временем может износиться, главное, не пропустить этот момент — проще заменить одну деталь, чем отремонтировать весь узел. Самостоятельно можно устранить только механические повреждения: заменить растянувшийся ремень или вставить новую шпонку, да и при этом надо иметь начальные знания, чтобы разборка агрегата была проведена без изъянов и досадных ошибок.

В электрической схеме и двигателе могут быть легкие неполадки: например, перегорел предохранитель, или износилась одна из щеток. Но бывают и весьма сложные — из-за сильных перегрузок произошел пробой обмотки двигателя, требуется замена коллектора или платы управления.

Видео (кликните для воспроизведения).

Во время демонтажа агрегата запоминайте или фотографируйте, чтобы знать, что и куда прикручивать при сборке и как правильно сделать подключения электропроводки.

Порядок работы несложный и выполняется по такой методике:

  • отключить изделие от электрической сети;
  • демонтировать все съемные детали;
  • снять корпус комбайна с подставки, удалить корпус и выяснить целостность ременной передачи или привода;
  • достать двигатель, визуально осмотреть, чтобы найти подгорания;
  • прокрутить вручную ротор, чтобы убедиться в легкости вращения;
  • снять кожух защиты с редуктора, чтобы проверить вал привода.

Все детали для замены можно приобрести в магазинах или центрах, которые обслуживают пользователей конкретной марки изделия.

Передаточный момент в разных комбайнах организован по-разному. Так, в некоторых изделиях он осуществляется с помощью ременной передачи, поэтому при плохой работе изделия необходимо снять ремень, и приобрести в специализированном магазине новый. Если передача происходит с использованием шпонки на валу (это называется прямой привод, например, такой у комбайна Мрия 2м), а она износилась от длительной эксплуатации, то придется разобрать весь агрегат для ее замены. Алгоритм действий при самостоятельном ремонте вы легко найдете в интернете.

В помощь домашним мастерам предлагаем посмотреть вот такое видео:

Специалисты по обслуживанию бытовой техники для кухни предлагают такие методы, которые реально продлят эксплуатацию любого комбайна.

  1. В контейнеры для переработки надо укладывать мелко нарезанные продукты питания, не стоит дробить в блендере твердые ингредиенты, работать с замороженными овощами.
  2. Почувствовали запах горелой проводки — немедленно прекратите работу и выясняйте причину его появления, отключив изделие от сети.
  3. По окончании любых работ сразу же промывайте все детали и элементы, участвующие в процессе обработки.
  4. Не используйте насадки или диски с дефектами, так вы можете навредить комбайну и его внутренним деталям.
  5. По истечении гарантии надо планомерно проводить профилактические работы, не реже одного раза в год.

Выполняя эти рекомендации, вы значительно увеличиваете срок использования агрегата, а консультируясь с мастерами по ремонту — гарантируете безопасную работу изделия после всех работ.

На сегодняшний день кухонный комбайн Bosch и многих других производителей стали почти, что незаменимыми устройствами на кухне. Существуют разнообразные модификации данных агрегатов, которые позволяют выполнять различные задачи, и вы при этом не приложите никаких особых усилий. Для некоторых домохозяек они стали очень важны, и любая поломка в системе становится серьезной проблемой. В данной статье мы расскажем вам об устройстве прибора и как производить ремонт кухонных комбайнов своими руками.

Устройство состоит из отдельных элементов механизма, самые основные элементы следующие:

  • электрический двигатель;
  • приемник перерабатывающих продуктов;
  • камера для обработки ингредиентов;
  • комплекты насадок и ножей;
  • главная панель управления комбайном;
  • электрическая проводка, соединяющая основные элементы.

Материал корпуса у комбайнов обычно изготовлен из пластика. Однако все остальные детали, такие как насадки, ножи и другие элементы производятся из нержавеющей стали, так как она долговечна, и именно на внутренние части устройства идет наибольшая нагрузка.

Комбайны подразделяются на несколько типов:

Последний тип комбайнов это такие, в которых, например, идет комбинация мясорубки и соковыжималки. Однако, несмотря на их различные функциональные особенности, у них у всех одинаковый принцип работы.

После загрузки продуктов в рабочую камеру комбайна, они доводятся до нужного состояния согласно заданной программе. Процессы могут меняться, заменяя насадки на них и задавая устройству необходимые команды. Насадки приходят в движения благодаря электрическому двигателю. Понять, что ваш кухонный комбайн требует срочного вмешательства, достаточно просто:

  • новые звуковые эффекты, которые устройство ранее не издавало, например – скрипы, стуки, скрежет и другие им подобные;
  • вы чувствуете, что из машинки идет неприятный запах горящей проводки;
  • на насадках образовались трещины и сколы;
  • агрегат начинает работать в неравномерном темпе, или же он работает не в том режиме по заданной программе;
  • устройство не хочет активироваться и начинать работать.

Что касается части по передачи крутящего момента, то в некоторых комбайнах применяется ременная передача для передачи момента на основные рабочие органы. Когда устройство начинает плохо работать, то возможно, что уже пришло время заменить износившийся ремень. Также имеется и шпоночная передача крутящих усилий, в данном случае может износиться шпонка, что также приведет к неработоспособности комбайна.

Существует множество вариантов неполадок комбайнов, возможно из строя могут выйти какие-то его внутренние элементы, в случае выхода одной детали из строя, может, сломается весь механизм. Также не реки случаи, когда проблемы возникают в самой проводке агрегата, когда происходит короткое замыкание.

Любым владельцам рано или поздно придется самостоятельно ремонтировать свой кухонный комбайн. Перед тем как разобрать кухонный комбайн, убедитесь, действует ли на него еще гарантия после покупки. Если таковая имеется, то лучше всего отнесите агрегат в сервисный центр для того, чтобы они оказали необходимое обслуживание и вернули комбайну его работоспособность.

Но как бывает в большинстве случаев, поломки происходят уже после окончания гарантийного срока, тут уже стоит попробовать самим разобрать и произвести ремонт кухонного комбайна Bosch, прежде чем идти и сдавать его в ремонт, где с вас возьмут много денег за ремонт.

Первым делом разбираем кухонный комбайн, однако хорошо запоминайте, что откуда снимали и откручивали, так как вам придется собирать агрегат обратно. Все действия сводятся к следующему:

  • выключите устройство от электросети и демонтируйте все съемные детали;
  • снимите сам комбайн и удостоверьтесь в целостности ремня и приводных шестеренок;
  • снимете вышеуказанные элементы, и достаньте двигатель. Осмотрите его на предмет целостности и работоспособности;
  • уберите защитный кожух с редуктора и проверьте приводной вал на признаки дефектов.

В случае, если у вас другая модель, вы легко сможете найти видео и подробные инструкции на просторах интернета.

Когда вы собираетесь покупать замену для какой-то детали, обязательно берите оригинальные, так как сторонние попросту не смогут спокойно встать в паз. Такие элементы вы можете приобрести в специальных сервисных центрах, или же заказать их через интернет.

  1. Лучше всего обрабатывать мелкопорезанные продукты, и не стоить перерабатывать замороженные овощи, мясо и прочие вещи. Также не рекомендуется дробить твердые ингредиенты;
  2. Как только вы почувствовали неприятный запах исходящий из комбайна, сразу же выключайте его, дабы избежать короткого замыкания, и не допустить появления поломки;
  3. После того как вы закончили работу, необходимо тщательно промывать те элементы комбайна, которые принимали участи в обработке продуктов. Перед повторным использованием, тщательно высушивайте все детали;
  4. Ни в коем случае не применяйте насадки, на которых имеются дефекты, это может навредить самому комбайну;
  5. После того как истечет гарантийный срок, лучше всего регулярно (хотя бы раз или два в год) проводить профилактические работы с комбайном. Разбирать его и смазывать необходимые узлы механизма, а также заранее производить замену изношенных частей устройства, при их обнаружении во время разборки, дабы избежать неисправностей в дальнейшем.

Мы рассказали вам основные способы как произвести ремонт кухонных комбайнов, и как лучше всего избегать неприятных ситуаций с поломкой данного устройства. В случае возникновения трудностей рекомендуется обращаться к мастерам, которые найдут неисправность и произведут качественный и правильный ремонт.

В данной статье, мы будем производить самостоятельный ремонт редуктора, кухонного комбайна бош Для ремонта нам потребуется отвертка T25 (Звездочка).

Берем отвертку и откручивает 5 болтов.

Снимаем верхнюю крышку и откручиваем 6 болтов.

Снимаем корпус редуктора и меняем большую шестеренку, которая вышла из стоя, в следствии не работал редуктор, и комбайн не прокручивал.

Собираем аппарат в обратной последовательности, закручиваем на место все болты.

В данной статье мы рассказали, как своими руками отремонтировать кухонный комбайн. Чаще всего причиной такой поломки является попадание твердых продуктов во время использования вашего аппарата. Не рекомендуется использование продуктов, в которых присутствуют хрящи, мелкие косточки и жилы, тогда ваш комбайн прослужит еще долгое время.

Сообщение elremont » 20 май 2009 16:31

Сообщение bear148d » 20 май 2009 16:41

Сообщение elremont » 20 май 2009 17:38

Сообщение Kuzyaj » 23 май 2009 23:24

Сообщение bear148d » 26 май 2009 12:05

Сообщение SashkaRRR » 26 май 2009 16:40

Сообщение Kuzyaj » 26 май 2009 17:29

Сообщение Sandors » 27 июл 2009 12:52

Сообщение Kuzyaj » 28 июл 2009 16:21

Сообщение Sandors » 29 июл 2009 11:25

Спасибо за совет!
Мой комбайн еще поживет! Надо немного внимательнее относиться к рычагам концевиков. Собрал! Работает.

Кухонный комбайн BOSCH MCM 5530 при включении любой скорости

двигатель вращается на максимальных оборотах несколько секунд

Проверка выявила обрыв датчика скорости

Датчик скорости это стандартный дроссель на 4.7 мгн

Поиски дросселя в магазинах не к чему не привели

Случайно попалась плата от зарядки сотового телефона там стоял

Был закреплен в близи магнитного кольца на расстоянии 1мм

двигатель начал вращятся как положенно зазор был плавно увеличен до 5 мм

при 5 мм двигатель стал работать рывками

Из чего был сделан вывод что чувствительности дросселя 3.9 мгн вполне достаточно

Датчик был установлен на штатное место и проверен

Двигатель работал устойчиво

Часть схемы цепи переключения скорости не показаны

Добавлено (12.03.2014, 10:59)
———————————————
Управился с установкой нового модуля (все оказалось просто), вот в работе ничего не изменилось

ПА-А-МА-ГИ-ТЕ пожалуйста.
Включается, работает секунд 10 и выключается, что делать? Почему так.

семистор Т435 600т звонится 80ом (на плате не выпаивая) между А1 и G (анодом1 и упр электродом) в обе стороны. больше никак не звонится.
дросель на самом краю платы который стоит около крутящегося магнита на валу двигателя
(наверно датчик вращения) не звонится никак .
он бледно зелёного цвета.
палоски :
зелёная 5
чёрная 0
красная 100 (или коричневая тогда 1000 не разберу)
серебристая 10%

на сколько это микрогенри выходит? и чем его заменить если нет такого?

Добавлено (12.03.2014, 16:59)
———————————————
включил на прямую. всё нормально прёт как танк! ничего и не греется я минуты три держал ,всё нормально . спрошу у хозяина если так устроит буду собирать. там походу пол платы выгорило . менять мне нечем ,запчастей в наш колхоз не возят так что как то так . пусть работает на прямую или не работает вообще никак.

Добавлено (13. 03.2014, 08:18)
———————————————
Бродяга0167, так же не бывает
может двиготель подклинивает ? покрути сзади за крыльчатку рукой ,должен легко крутится клемы проверь на которые ты стыкуешь новый модуль может одна какая либо подабуглена контакта достойного не будет и датчик будет срабатывать. почисти всё подожми. Переключатель скоростей проверь или регулятор что стоит у тебя.
пройдись по всему вышеперечисленному для начала.

Виды и причины поломок

Неправильная эксплуатация комбайна приводит к возникновению поломок. Запасные части и элементы для кухонных агрегатов купить дешевле, чем новый прибор. Поэтому ремонт комбайнов – приемлемый способ решения проблемы.

К самым распространенным поломкам относят неисправность двигателя, управляющей платы, трансформаторов, подшипников. А также поломки насадок, выключателей и сетевого шнура.

Причины поломок: нарушения условий эксплуатации; небрежное отношение; скачки напряжения; естественный износ механизмов и деталей.

Виды ремонта кухонных комбайнов

Ремонт кухонных агрегатов можно разделить на три категории сложности:

– ремонт легкий – не требует разборки прибора;

– ремонт средний – требует полной разборки агрегата;

– ремонт сложный – требует замены двигателя, подшипников и трансформаторов.

Для нормального функционирования комбайна его комплектация включает в себя самые различные насадки. С их помощью можно быстро и легко приготовить полезные, вкусные блюда. В основе насадок должен быть качественный материал, на это необходимо обращать внимание. Они могут загрязняться и выходить из строя.

Легкий ремонт агрегата – замену насадок, ручек и сетевого шнура можно осуществить самостоятельно. Практически любой механизм или блок агрегата можно заменить на новый. Приводной ремень и шестеренки могут разорваться или износиться.

Ремонт кухонного комбайна средней сложности – замена таких деталей, как выключатели, щетки электродвигателя, емкости и шестеренки требует разборки прибора. Вначале необходимо отключить кухонный комбайн от сети электричества.

Для того чтобы получить доступ к внутренним деталям прибора, необходимо поддеть опоры и снять основу комбайна. Сгоревшие шестеренки, щетки, емкости или выключатели можно приобрести в магазинах. Но лучше ремонт доверить специалистам.

К поломкам, которые требуют сложного ремонта можно отнести: повреждения управляющей платы, подшипников, трансформаторов и электродвигателя комбайна. Для ремонта и устранения таких поломок требуются специальные знания.

Сервисные центры предоставляют услуги по ремонту и обслуживанию бытовых приборов:

– проведение тщательной диагностики;

– выявление причин неполадок;

– ремонт или замена деталей;

– предоставление консультаций по вопросам эксплуатации прибора.

Поставь лайк ♥ и Подпишись на кана.

Поставь лайк ♥ и Подпишись на канал.

Как работают датчики в кухонном комбайне.

Здравствуйте. Мой канал посвящен электронике, (компьютерной технике, радиоэлектронике, обзорам всяких.

Показал как устроен кухонный комбайн, из чего состоит и как проверить.

Показал как проверить и отремонтировать кухонный комбайн.

Любите готовить котлетки и другие вкусности с качественных продуктов – значит наверняка все готовите сами.

This is tutorial for repairing your Bosch ProfiMixx having problems with the speed control. The failing machine runs at maximum speed at any selected speed.

Ремонт Bosch GLM 80 Своими руками. Не работает кнопка. Александр Оробейко Препарируем Bosch Glm 80 с целью исправить.

Поставь лайк ♥ и Подпишись на канал.

Как самому разобрать, почистить и смазать кухонный комбайн самостоятельно. ремонт и разборка кухонного.

Вытяжка. Не работает двигатель. Как я решал эту проблему.

АБС сервис кухонный комбайн BOSCH E-mail мастера: [email protected]

Ремонт венчика или мешалки от кухонного комбайна.

Комбайн, который рубит кубиками.

Как починить и отрегулировать кофемолку в кофемашине.

Ремонт кухонных комбайнов: http://techservice.vn.ua/ В этом видео я заменил мотор старого образца на мотор нового образ.

Это мой второй видеообзор комбайна, спустя год.Ооочень подробное видео о всех функциях комбайна, НЕДОСТАТК.

Как отремонтировать кухонный комбайн своими руками.

JOIN VSP GROUP PARTNER PROGRAM: https://youpartnerwsp.com/ru/join?80110.

Ремонт ремня в кухонном камбаин браун.

В этом видео мы поговорим о восстановлении кухонного комбайна Moulinex из деталей, доставленных в мешке.

Готовим пиццу дома с помощью кухонной машины!

Самостоятельный ремонт повреждённого узла кухонного комбайна.

Характеристики, цена, отзывы Bosch MCM 5529 – http://fotos.ua/bosch/mcm5529ru.html Как комбайн режет кубиками, смотрите по ссылке.

Работа кухонного комбайна BOSCH MUM 4855 на примере шинковки шампиньонов и лука.

dedushkinsekret.ru здоровый позвоночник. Вариант ремонта шестерни привода блэндера BOSH. После ремонта желательно.

Необычный ремонт таймера пароварки.

Обзор кухонного комбайна Bosch MUM 4406.

Хороший Выбор и разумные цены можно посмотреть здесь http://j.mp/1KF4L5T remont-kuhonnogo-kombajna-first-fa-5113 ••••••••••••.

Видео обзор чаши кухонного комбайна BOSH оригинальный номер: 081169. Подробный список моделей на которые подход.

Видео обзор механического предохранителя (муфты) для мясорубок и кухонных комбайнов Bosch Ссылка на оригинал.

Ремонт мясорубки Bosch 1550. Электромясорубка шумит, но при этом ножи не крутятся. В этом видео обзоре мы разбер.

Ремонтируем кухонный комбайн фирмы ORION. Разборка, отыскание причин неисправности, сборка и пробный пуск.

Средняя терка – muz 45 kp 1, терка для драников – muz 45 rs 1, терка для картофеля фри – muz 45 ps 1. Насадка для кухонного.

Продолжаем работу над кухонным комбайном Moulinex из деталей, доставленных в мешке.

%) %) что значит несколько попыток ? сами спецы не с первого раза смогли что ли ?

что значит упущено ? вы его в ремонт сдали, вам вернули такой же. Нафига прилагать усилия ? вы рискуете сломать какие-нибудь пластиковые детали. СМело сдаете его обратно в магазин и либо меняете, либо забираете деньги. Можете это сделать в течении всего гарантийного срока

😀 спасибо..буду пробовать..но на самом деле вчера весь вечер пыталась, не получилось 🙁 видимо пока мне не скажут.

“ВАМ “ПИППИППИ” не “ПИППИППИП”. ПИПИПИП НЕ УМЕЕШЬ СТРОГАЙ НОЖОМ. “. до меня не дойдет. но теперь решила ,что раз у людей включается, значит будем учиться! :blush:

Кухонные комбайны оснащены коллекторными двигателями. Обсудим недостатки и преимущества технического решения; посмотрим устройство прибора, возможности, как выполнить ремонт. Кухонные комбайны не предназначены решать скромные задачи. Готовить салат — полное ведерко, шинковать овощи — килограммами. Видим недостаток кухонного комбайна и преимущество. Для готовки на раз двоим великоват агрегат; требуется накормить толпу гостей — бинго! Приготовьтесь сразу вымыть изделие: внутри останется гора ингредиентов. Ремонт кухонных комбайнов своими руками не представляет сложности, сумевшим разобрать хитроумное приспособление. Поскольку каждый производитель норовит выполнить дизайн своеобразный, постарается сделать, чтобы никто не мог проникнуть внутрь прибора. Советская техника выгодно отличается от кухонных комбайнов, тогда, как известно, дураки в КБ не работали…

Ремонт кухонных комбайнов своими руками требует знания основ. Внутри несложно. Избитая сайтом фраза вновь уместна. Кухонный комбайн призван выполнить то, что сегодня умеет ручной блендер с приставкой из чаши с ножами. В функции входит приготовление коктейлей. В переводе на русский означает: существует три прибора, пересекающиеся взаимно, только последний заменит все:

  • ручной блендер;
  • настольный блендер;
  • кухонный комбайн.

Критически оценим способности кухонного комбайна. Два привода:

  1. Для блендера прямой.
  2. Для измельчения с редуктором через ременную, шестерную передачу.

Кухонный комбайн KitchenAid не отличишь от блендера, убрав насадку, сегодня не рассматриваем простейшие варианты. Итак, приводов два, каждый шток для своих целей. Под блендер выполнен прямой, нисколько не удивляет. Насадкой часто измельчают ингредиенты, создаются значительные нагрузки, через ремень не передашь. По-настоящему интересен второй привод кухонного комбайна, куда приходятся насадки шинковки, терки. Здесь стоит подвижная муфта, при нажатии отключающая вращение. Заранее скажем: в электрической схеме целая куча нажимных реле, отрубающих питание устройства, если не установлены защитные колпаки. Разумеется, защиту можно обмануть.

Радует простота схемного решения. На входе электронной платы стоит до боли знакомый фильтр RC-цепочки, откуда один провод снабжает двигатель, второй проходит симисторную схему регулировки входного тока.

Осуществляется регулировка скорости. Опишем действие схемы:

  1. Питание подается на симистор, работающий в линейном режиме. Ключевой элемент оснащен приличного размера радиатором, рассеивающим лишнее тепло.
  2. На управляющий электрод приходят напряжение, поделенное переменным резистором, обратный отклик двигателя — паразитная ЭДС, возникающая при переключении секций коллектора вращающимся валом.
  3. Вращается регулятор скорости, переменный резистор изменяет значение управляющего напряжения электрода симистора. Обороты растут или уменьшаются.
  4. На двигатель повышается нагрузка, ротор замедляет обороты. Падает значение паразитной обратной ЭДС коллектора, напряжение управляющего электроде симистора изменяется, потребляемый ток начинает расти. Вслед обороты вновь повышаются, двигатель выходит на заданный режим.

Простая схема саморегуляции, с электрической точки зрения претензий к Philips никаких. Молодцы. Не считая пятого проводника, выходящего с двигателя, приходящего на плату, остающегося висеть в воздухе. Впрочем, мелочи в сравнении с шурупами Torx, ввинченными в пластмассу — фальшивка. Двоечка с минусом: покупателя надувать моветон. Схема лишена предохранителей, термозащита в избытке. На обмотке честно написано, внутри прячется предохранитель порогом 135 градусов Цельсия. Рядом еще один, многоразовый. Поражает одна вещь: питание выходит с платы, приходит двигателю, замыкание участка ротор-статор проводится на плате. Зачем делается, сказать сложно.

Устройство рассмотрено, просто как дважды два. Следовательно, отремонтировать кухонный комбайн легко. Посмотрим порядок.

Обсудим, как починить кухонный комбайн. Большинство читателей знает последовательность. Поясняем вопрос подробнее. Везунчику, сумевшему разобрать кухонный комбайн, необходимо сделать следующее:

Такова процедура осмотра. Сломается реостат (выкрошится), некоторые скорости могут не работать, изменение оборотов происходит рывками, неустойчиво. Устройство кухонного комбайна предусматривает наличие защитных реле (микропереключателей), обойдите по цепи питания. С механической точки зрения, если не вращается ременной вал, проверяется следующее:

  1. Не проскальзывает ли ремень.
  2. Исправность муфта.

Ремень напоминает автомобильный. Непростая резинка, изделие с нарезанными зубцами по размерам шестерней. Становятся очевидными две вещи:

  • изделие будет работать долго;
  • если резина сотрется, рассохнется, заменить будет чрезвычайно сложно.

Порекомендуем жесткие, твердые овощи не шинковать. Следить, чтобы на работающий вал чего не намоталось. Что касается привода блендера, нож никак не отключается, вращается в кухонном комбайне. В период, когда насадка соответствующая не используется, вращающийся шток прикрывается защитной крышкой. Без этого прибор не включится, будут неправильно скоммутированы реле, упомянутые выше. Вредно пользоваться теркой. Что характерно, механизмов регулировки натяга ремня нет. Могли оставить пружинку с подвижной шестеренкой, положение регулировалось бы винтом, пусть даже Torx. Заставило бы резиновый компонент прослужить дольше.

Что может сломаться в кухонном комбайне, описали, сами считаем, под угрозой только симистор и конденсатор на входе. Щетки коллекторного двигателя защищены варисторами, гасящие искру при сильном повышении напряжения, не дают мотору сгореть, если спасовал по неведомой причине фильтр на входе. Новичков удивляют таблетки синего цвета, припаянные к корпусу, на деле искра замыкается двумя варисторами, гасится, если амплитуда напряжения позволит. Учитывая неумелую тепловую защиту, обсуждаемую выше, складывается мнение: конструкторы подстраховались на все случаи жизни. Кухонный комбайн Philips будет работать… если ремонт переживет!

Некоторые агрегаты имеют неразборный корпус. Чтобы в сервисном центре заметили попытку вскрытия неизвестным мастером-самоучкой.

В основе устройств лежит регулирование скорости, проще изменять амплитуду. Если асинхронные двигатели реагируют на инверторное управление, в нашем случае ремонт кухонных комбайнов Мулинекс связан с коллекторами и только с ними. Разновидность может управляться микросхемами. Делается путем изменения скважности, варьируется действующее значение, ведет к изменению оборотов мотора. Надеемся, теперь ремонт кухонного комбайна Мрия читателям по зубам и по плечу. Обращаем внимание: толще проволока катушек, двигатель лучше тянет. Чтобы прочувствовать, оцените толщину обмотки ручных блендеров.

Ремонт кухонных комбайнов своими руками

Кухонные комбайны строятся на коллекторных двигателях. Мы сейчас обсудим все недостатки и преимущества такого решения, посмотрим, как устроен прибор, что он может, и, конечно же, как выполнить ремонт, в случае чего. Кухонные комбайны не предназначены для скромных целей. Если готовить салат, то полную тарелку, если шинковать овощи, то килограммами. В этом недостаток кухонного комбайна, но и его преимущество. В том смысле, что для готовки на раз для двоих он не подходит, зато если требуется накормить толпу гостей, то нет ничего лучше. Кстати, приготовьтесь сразу как следует вымыть изделие. Ремонт кухонных комбайнов своими руками не представляет сложности, если удалось разобрать это хитроумное приспособление. Поскольку каждый производитель норовит выполнить не только дизайн своеобразный, но и постараться сделать так, чтобы никто не смог проникнуть внутрь прибора. На наш взгляд советская техника в этом свете выгодно отличается от кухонных комбайнов, но тогда, как известно, дураки в КБ не работали…

Ремонт кухонных комбайнов своими руками требует знания основ. Внутри нет ничего сложного. Эта избитая на нашем сайте фраза опять к месту. Кухонный комбайн обычно призван выполнить все то, что сегодня умеет ручной блендер с приставкой из чаши с ножами. Но ко всему прочему в функции обычно входит приготовление коктейлей. В переводе на русский язык это означает, что существует три прибора, которые пересекаются между собой, причем только последний может заменить собой все:

  • ручной блендер;
  • настольный блендер;
  • кухонный комбайн.

А теперь критически оценим возможности кухонного комбайна. Обычно у него два привода:

  1. Для блендера прямой.
  2. Для измельчения с редуктором через ременную или прямую передачу.

Это отнюдь не догма, потому что кухонный комбайн KitchenAid не отличишь от блендера, если убрать насадку, но мы сегодня не рассматриваем простейшие варианты. Итак, приводов два, каждый шток для своих целей. Под блендер выполнен прямой шток, и нас это нисколько не удивляет. Дело в том, что в этой насадке часто что-то измельчают, здесь создаются реальные нагрузки, которые через ремень не передашь. По-настоящему интересен как раз второй привод кухонного комбайна, куда приходятся насадки для шинковки и терки. Здесь имеется подвижная муфта, которая при нажатии отключает вращение. Заранее скажем, что в электрической схеме имеется целая куча нажимных реле, которые отрубают питание устройства, если не установлены защитные колпаки. Разумеется, защиту можно обмануть, но кто будет это делать специально? (См. также: Ремонт мясорубок своими руками )

Что радует, так это простота схемного решения. На входе электронной платы стоит до боли знакомый фильтр из RC-цепочки, откуда один провод сразу идет на двигатель, а второй проходит через симисторную схему регулировки входного тока.

Так осуществляется управление скоростью. Вот как примерно действует схема:

  1. Питание подается на симистор, который работает в линейном режиме. В связи с этим ключевой элемент оснащен приличного размера радиатором для рассеивания лишнего тепла.
  2. На управляющий электрод приходит напряжение, поделенное переменным резистором, а также обратный отклик двигателя в виде паразитной ЭДС, которая неизбежно возникает при переключении с секции на секцию в коллекторе.
  3. Когда вращается регулятор скорости, переменный резистор изменяет значение управляющего напряжения на электроде симистора. За счет этого обороты растут или уменьшаются.
  4. В то же время, когда на двигатель повышается нагрузка, он замедляет обороты. За счет этого падает значение паразитной обратной ЭДС на коллекторе, в результате напряжение на управляющем электроде симистора изменяется таким образом, что потребляемый ток начинает расти. Вслед за этим обороты вновь повышаются, пока двигатель не выходит на заданный режим.

Вот такая схема саморегуляции, и с электрической точки зрения у нас претензий к Philips не имеется никаких. Молодцы. Если не считать пятого провода, который выходит с двигателя, приходит на плату и остается висеть в воздухе. Впрочем, это мелочи в сравнении с шурупами Torx, которые ввинчиваются в пластмассу, но ничего не держат. Вот за это двоечка, причем с минусом. В схеме не имеется предохранителей, как таковых, зато есть термозащита и в избытке. Прямо на обмотке честно написано, что внутри прячется предохранитель на 135 градусов. Кроме того рядом имеется еще один, но уже многоразовый. Поражает одна вещь: питание выходит с платы, приходит на двигатель, причем замыкание участка ротор-статор проводится на плате. Зачем это делается, сказать сложно.

Вот в общем-то и все устройство, просто как дважды два. Следовательно, и отремонтировать кухонный комбайн легко. Посмотрим, как это примерно сделать.

А теперь пару слов о том, как починить кухонный комбайн. Из сказанного большинство читателей уже знает, как это сделать. Поясняем все же этот вопрос более подробно. Тому, кому повезет разобрать кухонный комбайн необходимо сделать следующее:

Такова общая процедура осмотра. Если сломается реостат (выкрошится), то некоторые скорости могу не работать, изменение оборотов происходит рывками, неустойчиво. Устройство кухонного комбайна предусматривает наличие множества защитных реле (микропереключателей), обойдите их по цепи питания. С механической точки зрения, если не вращается ременной вал, то проверяется следующее:

  1. Не проскальзывает ли ремень.
  2. Исправна ли муфта.

Нужно отметить, что ремень напоминает автомобильный. Это не простая резинка, а изделие с нарезанными зубцами по размерам шестерней. В этом свете сразу становятся очевидными две вещи:

  • изделие будет работать долго;
  • если резина сотрется или рассохнется, заменить ее будет чрезвычайно сложно.

В этом свете можно порекомендовать жесткие и твердые овощи не шинковать. А кроме того следить, чтобы на вал чего не намоталось во время работы. Что касается привода блендера, то он никак не отключается и вращается в кухонном комбайне все время. В период, когда насадка соответствующая не используется, вращающийся шток прикрывается защитной крышкой. Без этого прибор не включится, потому что будут не так скоммутированы реле, упомянутые выше. По этим же причинам вредно пользоваться и теркой. Что характерно, механизмов для регулировки натяга ремня не имеется. Могли бы оставить пружинку с подвижной шестеренкой, положение которой регулировалось бы винтом, пусть даже и Torx. Это заставило бы резиновый компонент служить дольше. (См. также: Ремонт кофемолки своими руками )

Что может сломаться в кухонном комбайне, мы уже описали, и сами считаем, что под угрозой только симистор и конденсатор на входе. Еще добавим, что щетки коллекторного двигателя защищены варисторами, которые гасят искру при сильном повышении напряжения, а также не дают мотору сгореть, если спасовал по какой-то причине фильтр на входе. Многих удивляют эти таблетки синего цвета, припаянные к корпусу, но на самом деле искра как раз замыкается через два варистора, и прекрасно гасится, если амплитуда напряжения позволяет. Учитывая неумелую тепловую защиту, про которую мы говорили выше, складывается мнение, что конструкторы хорошо подстраховались на все случаи жизни. А значит, кухонный комбайн Philips будет работать долго… если ремонт переживет!

В основе всех устройств также лежит регулирование скорости, а проще всего изменять именно амплитуду. Если асинхронные двигатели реагируют на инверторное управление, то в нашем случае ремонт кухонных комбайнов Мулинекс связан с коллекторами и только с ними. Тем не менее и эта разновидность может управляться микросхемами. Это делается путем изменения скважности, за счет чего варьируется и действующее значение, что ведет к изменению оборотов любого мотора. Мы искренне надеемся, что теперь ремонт кухонного комбайна Мрия будет нашим читателям не только по зубам, но и по плечу. Обращаем также внимание на то, что чем толще проволока катушек, тем двигатель лучше тянет. Чтобы прочувствовать это оцените толщину обмотки ручных блендеров.

Автор статьи: Артем Кондратьев

Добрый день! Я Артем. Чуть меньше 9 лет работаю слесарем и мне нравиться работать руками. Когда создаешь новые полезные вещи или возвращаешь к жизни сломанные предметы. Разве это не прекрасно? Рекомендую, перед реализацией идей с моего сайта, проконсультироваться со специалистами. Удачного рабочего дня!

✔ Обо мне ✉ Обратная связь Оцените статью: Оценка 5 проголосовавших: 3

Анализ изменчивости нуклеотидной последовательности фрагмента гена цитохромоксидазы 1 мтДНК у тихоокеанского белокорого палтуса (Hippoglossus stenolepis) Охотского моря Текст научной статьи по специальности «Биологические науки»

ИССЛЕДОВАНИЯ ВОДНЫХ БИОЛОГИЧЕСКИХ РЕСУРСОВ КАМЧАТКИ И СЕВЕРО-ЗАПАДНОЙ ЧАСТИ ТИХОГО ОКЕАНА, 2015, вып. 36

УДК 576.312:597.587.9 DOI: 10.15853/2072-8212.2015.36.25-33

анализ изменчивости нуклЕотидной последовательности фрагмента гена цитохромоксидАзы 1 мтднк у тихоокеанского БЕЛокоРого палтуса (HIPPOGLOSSUS STENOLEPIS) охотского моРя

с.п. пустовойт, Р.Р. Юсупов*, А.и. каика*

Ст. н. с., Институт биологических проблем Севера Дальневосточного отделения Российской академии наук 685000 Магадан, Портовая, 18 Тел, факс: (4132) 64-31-21 E-mail: [email protected]

*Ст. н. с., ст. н. с., Магаданский научно-исследовательский институт рыбного хозяйства и океанографии 685000 Магадан, Портовая, 36/10 Тел., факс: (4132) 64-88-23 Е-mail: [email protected]

белокорый палтус, цитохромоксидаза 1 мтднк, охотское море

Рассматривается изменчивость нуклеотидной последовательности фрагмента гена цитохромоксидазы 1 мтДНК белокорого палтуса. Нуклеотидное разнообразие палтусов Охотского моря составило п=0,00495. Показано, что на величину изменчивости нуклеотидных сайтов у особей белокорого палтуса оказывают влияние неселективные факторы, такие как мутационный процесс или миграция.

analysis of variability of the nucleotide sequence of the gene

fragment cytochrome c oxidase i (coi) mtdna from the pacific halibut (HIPPOGLOSSUS STENOLEPIS) in the sea of okhotsk s.P. Pustovoit, R.R. Yusupov*, A.I. kaika*

Senior scientist, Institute of Biological Problems of the North Far East Division RAS 685000 Magadan, Portovaya, 18 Tel., fax: (4132) 64-31-21 E-mail: [email protected]

*Senior scientist, senior scientist, Magadan Research Institute of Fisheries and Oceanography 685000 Magadan, Portovaya, 36/10 Tel. , fax: (4132) 64-88-23 E-mail: [email protected]

PACIFIC HALIBUT, CYTOCHROME C OXIDASE I (COI) MTDNA, THE SEA OF OKHOTSK

The nucleotide sequences mitochondrial cytochrome C oxidase I (COI) mtDNA of the Pacific halibut was founded. Nucleotide diversity of halibut of the Sea of Okhotsk was n=0.00495. It is shown that the amount of variability in nucleotide sites in individuals Pacific halibut influence nonselective factors such as mutation or migration process.

Тихоокеанский белокорый палтус Hippoglossus ставе донного ихтиоцена североохотоморского

stenolepis Schmidt, 1904 — широко распространен- шельфа, но и оценить его численность и биомассу.

ный, преимущественно бореальный, ценный про- Однако в целом информация по белокорому пал-

мысловый вид. Первые сведения о распростране- тусу северной части Охотского моря ограничива-

нии белокорого палтуса в Охотском море приводят лась лишь общими сведениями о его батиметри-

В.К. Солдатов и Г.У. Линдберг (1930) (цит. по Вер- ческом распределении. По всей видимости, отсут-

нидуб, 1936) для Западной Камчатки. В 60-80-х ствие в литературе 60-80-х гг. каких-либо сведений

годах прошлого века исследованиями Н.П. Нови- о биологии белокорого палтуса в этой части Охот-

кова (1964) и Н.С. Фадеева (1987) было установлено, ского моря связано с ограниченностью исследова-

что ареал белокорого палтуса охватывает также ний акваториями шельфа и материкового склона в

северную часть Охотского моря, где он изредка летне-осенний период, когда его численность в

отмечался авторами в уловах донного трала на этом батиметрическом диапазоне низкая.

материковом склоне. Материалы, полученные в Для Берингова моря давно известно, что летом

ходе проведения траловых съемок 1981-1982 и белокорый палтус часто присутствует в уловах

1988 гг., позволили Л.А. Борцу (1985, 1990) не толь- ярусов, а также ставных неводов при добыче ло-

ко установить наличие белокорого палтуса в со- сосей (Вернидуб, 1936). Такая особенность летне-

го распределения белокорого палтуса была подтверждена и более поздними исследованиями (Моисеев, 1953; Полутов, 1967; Новиков, 1964, 1974; Фадеев, 1987; Линдберг, Федоров, 1993; Новиков, 1997; Чикилев, Пальм, 1999).

В 1996 г. северо-восточная центральная ихтиологическая лаборатория Охотскрыбвода (СВЦИЛ) провела научно-поисковые работы в прибрежье Магаданской области, в ходе которых впервые были выявлены летние скопления белокорого палтуса у побережья п-ова Кони и прилегающих к нему с востока прибрежных участках Притауйского района и получены количественные данные плотности его поселения. В 1997 г. исследования продолжили специалисты МагаданНИРО; были уточнены участки основных концентраций палтуса и собран первый материал о его размерно-массовой структуре (Лачугин, 1998). С 2001 г. специалистами МагаданНИРО налажен ежегодный мониторинг за состоянием запаса этого ценного промыслового объекта (Юсупов и др., 2008).

Имеющиеся сведения о популяционной структуре белокорого палтуса базируются на анализе темпов роста и морфометрических исследованиях выборок из разных участков ареала, а также на анализе поимки особей после мечения (Фадеев, 2005; Юсупов, 2012; Юсупов и др., 2008). По-видимому, для данного вида характерно образование территориально разобщенных стад, окончательное количество таких стад и их локализация до конца не известны. В настоящее время предпринимаются попытки решить данную проблему генетическими методами (Коваль, Богданов, 1982; Потапова и др., 2014; Пустовойт, Юсупов, 2011, 2012; Mork, Haug, 1983; Ding et al., 2009). Несмотря на видимые успехи, авторы обзора генетических исследований донных видов рыб (Cerda et al., 2010) отмечают фрагментарность популяционно-гене-тических исследований палтусов.

Другим направлением генетических работ является определение нуклеотидных последовательностей ядерных и митохондриальных генов. Полная нуклеотидная последовательность митохон-дриальной ДНК как тихоокеанского, так и атлантического видов известна (Mjelle et al., 2008). Кроме того, имеются сведения о последовательностях отдельных генов, прежде всего цитохро-моксидазы субъединицы 1 (Espineira et al., 2008; Mecklenburg et al., 2011; Steinke et al., 2009). Стандартный участок данного гена является единствен-

ным для международной программы «Штрих-кодирование жизни» (International Barcode of Life, www.boldsystems.org), поскольку в подавляющем большинстве исследований животных нуклеотид-ные последовательности его являются видоспеци-фичными (Шнеер, 2009). Анализ изменчивости указанного участка гена полезен, прежде всего, для филогенетических исследований, а также для идентификации видов в смешанных выборках в случае затруднения определения вида по морфологическим признакам. Если сравнивать два вида палтусов, то атлантический вид исследован более подробно (Ding et al, 2009; Nielsen et al., 2009). Имеющиеся данные для белокорого палтуса касаются только популяций Берингова моря (Galindo et al., 2011; Nielsen et al., 2010).

Цель работы — исследовать нуклеотидные последовательности фрагмента гена цитохро-моксидазы субъединицы 1 мтДНК у белокорого палтуса.

МАТЕРИАЛ И МЕТОДИКА

Пробы мышц белокорого палтуса собраны во время промысла в ноябре 2006 г. на западнокамчат-ском шельфе (6 экз.), они обозначены 1-06, т. е. это 1-я проба за 2006 г. и до 6-й пробы — 6-06; 3 пробы получены от рыб, пойманных в июле 2011 г. на североохотоморском шельфе в районе п-ова Кони (обозначены 1-11, 2-11 и 3-11).

Выделение ДНК проведено солево-хлоро-формным методом (Пустовойт, Юсупов, 2012; Sambrook et al., 1989). Секвенирование нуклеотид-ной последовательности гена цитохромоксидазы 1 выполнено в ОАО «Синтол» (Москва). Для по-лимеразной цепной реакции использованы следующие праймеры (Шарина, Картавцев, 2010): FishF1 5' TCAACCAACCACAAAGACATTGGCAC3', FishR1 5'TAGACTTCTGGGTGGCCAAAGAATCA3'. Из двух антипараллельных последовательностей, определенных для каждой особи, получена одна консенсусная последовательность общей длиной 651 нуклеотид. Последовательности ДНК были выравнены при помощи программы Clustal W, входящей в пакет MEGA 6.0 (Tamura et al., 2013). Для анализа привлечены все имеющие в международных банках данных последовательности, пробы приведены с указанием номера (barcode ID, www.boldsystems.org) и места сбора (прибрежный участок моря): 1) MFC344-8 — залив Пьюджет Саунд, Вашингтон, США; 2) FMV126-08 — залив

Пьюджет Саунд, Вашингтон, США; 3) TZFP082-04; 4) TZFPB689-06; 6) TZFPB800-06; 7) TZFPB706-06 — все Британская Колумбия, Канада; 4) DSFAL039-07 — о. Семиди, Аляска, США; 8) DSFAL221-07 — юго-восточная часть Чукотского моря, США; 9) DSFAL456-08 — о. Булдур, западная часть Алеутских островов, США, пробы номеров GBGC7344-09, GBGC7345-09, GBGC7346-09 собраны из коммерческих уловов, места сбора в работе (Espineira et al, 2008) не указаны, пробы номеров GBGC7859-09, GBGC7860-09, GBGC3103-07, GBGC7858-09, GBGC3115-07 получены от рыб, пойманных около тихоокеанского побережья Канады (Mjelle et al., 2008).

Статистический анализ выполнен при помощи программы MEGA 6.0. (Tamura et al. , 2013). Он включал определение нуклеотидного разнообразия (п), а также тестов на селективность замен нуклеотидов. Дендрограммы строили с использованием алгоритма UPGMA и p-дистанций для оценки величины генетических различий.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Проведенные в 1996-1997 гг. научно-поисковые исследования обширной прибрежной зоны от бух. Лужина на западе до м. Кекурный (п-ов Пья-гина) на востоке показали, что в летне-осенний период на основной площади исследованного прибрежья белокорый палтус встречается повсеместно, но в небольших количествах. Скопления промысловой значимости отмечены лишь на сравнительно небольшом участке от м. Скалистого (северное побережье п-ова Кони) до м. Кекурного (юго-восточная часть п-ова Пьягина). Но и в этом районе частота его встреч была неодинакова: мак-

симальные концентрации палтус образовывал, как правило, на участках, прилегающих к мысам с крутым уклоном дна.

Предпринятые РС «Бриакан» в 1998 г. поисковые работы с целью обнаружить новые промысловые скопления этого объекта к западу от Тауй-ской губы (вплоть до п-ова Лисянского) положительных результатов не дали: палтус часто присутствовал в улове, но в единичных экземплярах.

В 2000 г. МагаданНИРО на НИС «Зодиак» провел траловую съемку северной части Охотского моря с целью оценить современное состояние и структуру биоресурсов этого региона. В числе исследованных участков общей площадью 67 250 квадратных миль был и зал. Шелихова — к северу от 58°00' и к востоку от 155°00' (от м. Кекурного) (Вышегородцев, Панфилов, 2001). Анализ видового состава рыб на 21 станции, с глубинами 41219 м, наличие белокорого палтуса не выявил.

В целом, имеющиеся сведения позволяют сформировать достаточно четкую картину сезонного распределения белокорого палтуса на североохото-морском шельфе. К востоку от п-ова Лисянского, на обширном мелководье северной части Охотского моря, общей протяженностью береговой линии около 2 тыс. км, белокорый палтус образует плотные концентрации лишь на сравнительно небольшом, примерно 360-километровом, участке прибрежной зоны вдоль побережья п-овов Кони и, частично, Пьягина (рис. 1). Здесь узкая локализация основной массы белокорого палтуса в период летнего откорма, несомненно, связана с благоприятными условиями его обитания. Как известно (Чернявский, 1980а, б; Борец, 1990), этот район характеризуется высокой биологической продуктивно-

Рис. 1. Карта летнего (слева) и зимнего (справа) распределения белокорого палтуса на акватории североохото-морского шельфа

стью, обусловленной влиянием ямского апвеллин-га, где температура водной массы от придонного слоя до поверхности находится в пределах температурного оптимума обитания белокорого палтуса, составляющего 2-7 °С (Фадеев, 1987).

Объединенные за 2012-2014 гг. данные ССД (суточных судовых донесений) промысловых судов о прилове белокорого палтуса при добыче черного палтуса на североохотоморском шельфе показывают, что в зимний период скопления бело-корого палтуса (более разреженные, чем летние), смещаясь на юг, в целом сохраняют свою локальность. Основные концентрации его отмечены на траверзе летнего обитания на глубинах 200-300 м.

Наличие устойчивой географической локальности белокорого палтуса на североохотоморском шельфе подтверждается и историей промыслового освоения его запасов (рис. 2). В целом, динамика промыслового освоения североохотоморского белокорого палтуса обнаруживает значительное сходство с хорошо известными литературными данными (Милинский, 1944; Никольский, 1974), описывающими примеры подрыва запасов долго-живущих видов рыб интенсивным промыслом, их перехода в депрессивное состояние и длительного периода восстановления. В то же время по данным на западнокамчатском шельфе, вылов белокорого палтуса характеризуется стабильностью и составляет 500-600 т в год (Новиков, 2009).

Секвенирование участка гена цитохромокси-дазы субъединицы 1 мтДНК белокорых палтусов разных районов обитания показало, что для всех исследованных нами особей его стандартная длина составила 651 нуклеотид (табл. 1). Сопоставление определенной нами нуклеотидной последовательности и имеющейся в GenBank (www.ncbi.nlm. nih.gov) полной последовательности мтДНК бело-корого палтуса (М]е11е et а1., 2008) показывает, что исследованный нами участок гена цитохромокси-

1996 1998 2000 2002 2004 2006 2008 2010 2012 2014 Год

Рис. 2. Динамика вылова белокорого палтуса на североохотоморском шельфе

дазы 1 начинается с позиции № 5555 и заканчивается N° 6205. Обнаружено 11 полиморфных сайтов, ps = 0,0169, нуклеотидное разнообразие п=0,00495. Девять особей делятся на две неравные группировки в зависимости от комбинаций нуклеотидов. Две особи (1-06, 1-11) в положениях 25 и 100 имеют цитозин (С), в положении 333 гуанин (G), остальные семь: в положениях 25 и 100 — гуанин (G), и в положении 333 — аденин (A).

Гаплотипы нуклеотидных последовательно -стей гена цитохромоксидазы 1 у особей из Охотского, Берингова и Чукотского морей указаны в таблице 2. Для корректного сопоставления в данном случае и в последующих вычислениях длины всех секвенсов были ограничены 651 нуклеотида-ми, а проба № TZFP010-04 (14 мая 2004 г., Британская Колумбия, Канада, www. boldsystems. org) исключена из анализа по причине неполноты последовательности. По нуклеотидным последовательностям из 26 особей в наибольшей степени отличаются тауйская № 1-06 и западнокамчатская особи № 1-11, поскольку они имеют вышеупомянутые особенности наборов нуклеотидов в полиморфных сайтах. ЧО 00 оч

Окончание таблицы 1

№ | 1 1 2 1 3 1 4 5 1 6 7 1 8 1 9 1 10 и 1 12 1 13 1 14 1 15 116 1 17 1 18 1 19 1 20 21 1 22 23 | 24 1 25 | 26 | 27 1 28 29 | 30

1 1 361 С 391 т 362 А 392 Т 363 с 393 С 364 в 394 Т 365 С 395 С 366 с 396 А 367 в 397 С 368 в 398 Т 369 А 399 Т 370 в 400 С 371 С 401 А 372 А 402 С 373 Т 403 С 374 С 404 Т 375 С 405 Т 376 в 406 в 377 Т 407 С 378 А 408 А 379 в 409 в 380 А 410 в 381 С 411 А 382 С 412 А 383 Т 413 Т 384 в 414 Т 385 А 415 Т 386 С 416 С 387 А 417 А 388 А 418 Т 389 Т 419 С 390 С 420 А

/ 1 5 421 А 422 Т 423 Т 424 С 425 Т 426 в Т 427 в 428 в 429 в 430 в 431 С 432 А 433 А 434 Т 435 Т 436 А 437 А 438 С 439 Т 440 Т 441 Т 442 А 443 Т 444 Т 445 А 446 С 447 Т 448 А 449 С 450 Т

6 9 : : : : : I т : : : : : : : : : : : : : : : : : : : : : : : :

451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480

1 А Т С А Т Т А А С А Т в А А А С С С А С А А С А в Т С А С Т

481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510

1 А Т в Т А С С А А А Т С С С С Т Т А Т т Т в Т Т Т в А в С С

511 512 513 514 151 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540

1 в Т Т С Т Т А Т Т А С А в С С в Т А С Т Т С Т Т С Т Т С Т А

541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570

1 Т С С С Т в С С С в Т Т Т Т А в С С в С А в в А А Т Т А С А

571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600

1 о А Т А С Т А С Т А г А С А в А С С в С А А С С Т Т А А С А С в

о 601 602 603 604 605 606 607 608 и 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630

1 А С С Т Т С Т Т Т в А С С С Т в С С в в А в в А в в Т в А с

631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651

1 С С с А Т с С Т С Т А С С А в С А С С Т А

Примечание: в каждом разделе таблицы указаны только те последовательности, которые отличаются от таковой у первой особи.

Таблица 2. Гаплотипы исследованного участка гена цитохромоксидазы 1 мтДНКу 26 особей белокорого палтуса

9 21 24 25 34 66 96 100 246 333 362 412 426 453 573 579 594 645

1 вВСС7859-09 С С А в в А А в Т А А А в Т А А Т А 1

2 СВСС7858-09, СВСС7860-09, Т2РРВ800-06, 3-1ирр-06 в 4

3 СВСС7344-09, СВСС7345-09, вВСС7345-09 - - - - - - - - - - - - Т - - - А - 3

4 СВвСЗЮЗ-Ог СВСС3115-07 - - - - - - - - С - в - - - - в - в 2

5 В8РАЬ221-07, ВСРАЬ039-07, МРС344-08, РМУ126-08, 2-Ырр-11 - - - - - - - - с - - - - - - в - в 5

6 Б8РАЬ456-08 - т - - - - - - с - - - - - - в - в 1

7 Т2РРВ689-06 - - - - - - - - с - - - - - - в - 1

8 Т2РРВ706-06, 5-Ырр-06, 6-1ирр-06, 7-1ирр-11 - - - - - - - - - - - - т - - - - в

9 Т2РР082-04 - - - - - в - - - - - - - С в - - - 1

10 1-Ырр-06 - - - С - - - С - в - - - - - - - в 1

11 2-Ырр-06 - - С - С - - - - - - - - - - - - в 1

12 4-1ирр-06 - - - - - - в - - - - - - - - - - в 1

13 1-1ирр-11 т - - С - - - с - в - Т - - - - - в 1

разнообразия и частот вариабельных сайтов (Nei, Kumar, 2000). Другим способом оценить существенность селективных факторов является сравнение частот замен в синонимичных (не меняющих кодирование) или в несинонимичных сайтах. Реализованный в программе MEGA z-тест на селективность замен показал, что только в небольшом числе случаев попарного сравнения 26 последовательностей можно предполагать преобладание несинонимичных замен над синонимичными (матрица не приводится из-за недостатка места). Следовательно, наибольшая часть замен происходит под влиянием неселективных факторов.

Рис. 3. Дендрограмма генетических дистанций, определенная по нуклеотидным последовательностям СО1 для 26 особей белокорого палтуса

ЗАКЛЮЧЕНИЕ

Таким образом, на величину изменчивости нукле-отидных сайтов оказывают влияние неселективные факторы. Таковыми могут быть как мутационный процесс, так и миграции особей в северной части Тихоокеанского бассейна. Степень влияния каждого из факторов пока остается неясной. Полученные результаты базируются на небольшом числе сравниваемых особей и пока носят характер предварительных. Для окончательного ответа на поставленный вопрос необходимы дополнительные исследования.

TZFPB 300-06 > hipp 06 ~ G9GC7858-09 " GBGC 7860-09

-4- hipp- 06

TZFPB 706-06 5-КррОб

- 6 hipp 06

7-hipp-11

-GBGC7859-09

_ _ 2 hipp 06

GBGC 7346-09

- GBGC7345-09

--GBGC7344-09

_GBGC3103-07

I GBGC3115-07

- -DSFAL456-08

-TZFPB 689-06

DSFAL039-07 DSFAL221-07

- FMV126-08

MFC344-08 2-hipp 11

-TZFP082-04

- 1-hip-06

-i-hip-11

QOM (ЙШ шЗо2 ШЮ1 Ö000

СПИСОК ЛИТЕРАТУРЫ

Борец л. А. 1985. Состав и биомасса донных рыб на шельфе Охотского моря // Биол. моря. № 4. С.54-65.

борец л.А. 1990. Состав и обилие рыб в донных их-тиоценах шельфа северной части Охотского моря // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. III. С. 162-171.

Вернидуб М.Ф. 1936. Материалы к познанию тихоокеанского белокорого палтуса // Тр. Ленинград. общества естествоиспыт. Т. 65. Вып. 2. С. 143-184. Вышегородцев В.А., Панфилов А.М. 2001. О результатах донной траловой съемки в северной части Охотского моря на НИС «Зодиак» в августе-сентябре 2000 г. // Сб. науч. тр. Магаданского НИИ рыб. хоз-ва и океанографии. Вып. 1. С. 7-36. картавцев Ю.Ф., ли Ж.С. 2006. Анализ нукле-отидного разнообразия по генам цитохрома b и цитохромоксидазы 1 на популяционном, видовом и родовом уровнях // Генетика. Т. 42. № 4. С. 437-461.

коваль Е.з., богданов л.В. 1982. Сравнение элек-трофоретических спектров белков у разных видов дальневосточных камбал (Pleuronectiformes, Pleuronectidae) // Вопр. ихтиологии. Т. 22. Вып. 4. С.679-685.

лачугин А.С. 1998. О возможностях промыслового освоения палтусов в северной части Охотского моря // Северо-восток России: проблемы экономики и народонаселения: Тез. докл. Магадан. С. 85-86.

линдбергГ.у., Федоров В.В. 1993. Рыбы Японского моря и сопредельных частей Охотского и Желтого морей. Ч. 6. Teleostomi. 31. Pleuronectiformes. СПб.: Наука. 272 с.

Милинский Г.И. 1944. Биология и промысел палтуса Hippoglossus vulgaris (L.) Норвежского и Баренцева морей // Промысловые донные рыбы Баренцева моря. Труды ВНИРО, ПИНРО. Вып. 8. М., Л.: Пи-щепромиздат. С. 331-374.

Моисеев П.А. 1953. Треска и камбала дальневосточных морей // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. 40. 288 с.

Никольский Г.В. 1974. Теория динамики стада рыб. М.: Пищ. пром-сть. 448 с.

Новиков Н.П. 1964. Основные черты биологии тихоокеанского белокорого палтуса (Hippoglossus hippoglossus stenolepis Schmidt) в Беринговом море // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. 51. Вып. 2. С. 167-207.

Новиков Н.П. 1974. Промысловые рыбы материкового склона северной части Тихого океана. М.: Пищ. пром-сть. 308 с.

Новиков Р.Н. 1997. Некоторые результаты исследований белокорого палтуса у восточного побережья Камчатки // Биомониторинг и рациональное использование гидробионтов: Тез. докл. молодых ученых 27-29 мая 1997 г. Владивосток: ТИНРО-Центр. С. 56-57.

Новиков Р.Н. 2009. Некоторые аспекты промысла белокорого палтуса (Hippoglossus stenolepis) восточной части Охотского моря // Исслед. водн. биол. ресурсов Камчатки и сев.-зап. части Тихого океана. Сб. науч. тр. КамчатНИИ рыб. хоз-ва и океанографии. Вып. 15. С. 44-49.

Полутов И.А. 1967. Запасы камбаловых и донных рыб в водах Камчатки и развитие активного рыболовства // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. 57. С. 98-121. ПотаповаН.А., Пустовойт С.П., ЮсуповР.Р. 2014. Анализ нуклеотидных последовательностей гена цитохромоксидазы 1 (СО1) мтДНК полярной Li-opsetta glacialis и Liopsettapinnifasciata полосатой камбал (Pleuronectidae) Охотского моря // Цитология и генетика. Т. 48. № 6. С. 11-16. Пустовойт С.П., Юсупов Р.Р. 2011. О генетической дифференциации желтоперой камбалы Limanda aspera, обитающей в Тауйской губе, Охотское море // Цитология и генетика. Т. 45. № 3. С. 57-62. Пустовойт С.П., Юсупов Р.Р. 2012. О нуклеотид-ной последовательности гена цитохромооксидаза СО-1 митохондриальной ДНК желтоперой камбалы (Limanda aspera) Тауйской губы // Вестник Северо-Восточного гос. ун-та. Вып. 17. С. 49-58. Фадеев Н.С. 1987. Северотихоокеанские камбалы: распространение и биология. М.: Агропромиздат. 175 с.

Фадеев Н.С. 2009. Справочник по биологии и промыслу рыб северной части Тихого океана. Владивосток: ТИНРО-Центр. 366 с. Чикилев В.Г., Пальм С.А. 1999. Распределение и биологическая характеристика белокорого палтуса Hippoglossus stenolepis на шельфе северо-западной части Берингова моря // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. 1999. Т. 126. С. 262-270. Шарина С.Н., картавцевЮ.Ф. 2010. Филогенетический анализ камбал (Teleostei, Pleuronectiformes), основанный на исследовании нуклеотидных последовательностей гена цитохромоксидазы 1 (Со-1) // Генетика. Т. 46. № 3. С. 401-407.

Шнеер В.С. 2009. ДНК-штрих-кодирование видов животных и растений — способ их молекулярной идентификации и изучения биоразнообразия // Журн. общ. биологии. Т. 70. № 4. С. 296-315. Чернявский В.И. 1980а. Гидрологический фронт северной части Охотского моря // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. 86. С. 3-11. Чернявский В.И. 1980б. О причинах высокой биологической продуктивности северной части Охотского моря // Изв. Тихоокеан. НИИ рыб. хоз-ва и океанографии. Т. 86. С. 13-22. ЮсуповР.Р. 2012. О половом диморфизме в процессе роста белокорого палтуса Hippoglossus stenolepis (Pleuronectidae) северной части Охотского моря // Вестник Северо-Восточного научного центра ДВО РАН. № 1. С. 61-68.

Юсупов Р.Р., лачугин А.С., Михайлов А.Н., Ракити-на М.В. 2008. Морфо-биологические особенности, промысел и рыбохозяйственный статус белокорого палтуса Hippoglossus stenolepis (Pleuronectidae) северной части Охотского моря // Вестник Северо-Восточного научного центра ДВО РАН. № 1. С. 61-71. Cerda J., Douglas S., Reith M. 2010. Genomic resources for flatfish research and their applications // Journal of Fish Biology. V. 77.5. P. 1045-1070. Ding H., Shao C.W., Liao X.L., Xu G.B., Ji X.S., Chen S.L. 2009. Ten polymorphic microsatellite loci for the Atlantic halibut (Hippoglossus hippoglossus) and cross-species application in the related species // Conservation Genetics. V. 10. 3. P. 611-614. Espineira M., Gonzalez-Lavin N., Vieites J.M., Santaclara J. 2008. Development of a method for the genetic identification of flatfish species on the basis of mitochondrial DNA sequences // Journal of Agricultural and Food Chemistry. V. 56 (19). P. 8954-8961. Galindo H.M., Loher T., Hauser L. 2011. Genetic sex identification and the potential evolution of sex deter-

mination in Pacific halibut (Hippoglossus stenolepis) // Marine Biotechnology. V. 13. № 5. P. 1027-1037. Nei M., Kumar S. 2000. Molecular evolution and phy-logenetics. Oxford University Press. 333 p. Mecklenburg C.W., Moller P.R., Steinke D. 2011. Biodiversity of arctic marine fishes: taxonomy and zoogeography // Marine Biodiversity. V. 41. P. 109-140.

Mjelle K.A., Karlsen B.O., Jorgensen T.E., Moum T., Johansen D.J. 2008. Halibut mitochondrial genomes contain extensive heteroplasmic tandem repeat arrays involved in DNA recombination // BMC Genomics. V. 9. P. 1-11.

Mork J., Haug T. 1983. Genetic variation in halibut Hippoglossus hippoglossus from Norwegian waters // Hereditas. V. 98 (2). P. 167-174. Nielsen E.E., Hemmer-Hansen J., Larsen P.F., Bekken-vold D. 2009. Population genomics of marine fishes: identifying adaptive variation in space and time // Molecular ecology. V. 18. 15. P. 3128-3150. Nielsen J.L., GrazianoS.L., SeitzA.C. 2010. Fine-scale population genetic structure in Alaskan Pacific halibut (Hippoglossus stenolepis) // Conservation Genetics. V.11. 3. P. 999-1012.

Sambrook J.F., Fristch E.F., Maniatis T. 1989. Molecular cloning: a laboratory manual. N.Y.: Cold Spring Harbor Lab. Press. 2nd edn. 1626 p. Steinke D., Zemlak T.S., Boutillier J.A., Hebert P.D.N. 2009. DNA barcoding of Pacific Canada's fishes // Marine Biology. V. 156. № 12. P. 2641-2647. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. 2013. MEGA6: Molecular Evolutionary Genetic Analysis version 6.0 // Molecular Biology and Evolution. V. 30. P. 2725-2729. Tajima F. 1989. Statistical method for testing the neutral mutation hypothesis dy DNA polymorphism // Genetics. 1989. V. 123. P. 585-595.

% PDF-1.3 % 1 0 объект > поток конечный поток эндобдж 2 0 obj > / Затенение> / ProcSet [/ PDF / Text] / ColorSpace> / Font> / Свойства >>> / MediaBox [0 0 595.22 842] / Аннотации [17 0 R 18 0 R] / Повернуть 0 >> эндобдж 19 0 объект > поток hб

Поиск электронных компонентов и запчастей

Усилители

Аналоговые ИС

Аккумуляторные батареи

Зуммеры, динамики и микрофоны

Кабели и провода

Конденсаторы

Разъемы

Кристаллы

Совет по развитию / Совет по проверке программ

Диоды

ИС драйвера

ИС встроенной периферии

Встроенные процессоры и контроллеры

Фильтры

Функциональные модули

Предохранители

Оборудование и прочее

Катушки индуктивности, дроссели и трансформаторы

Интерфейсные ИС

Логические ИС

Память

Двигатель

Оптопары, светодиоды и инфракрасный порт

ИС управления питанием

Кнопочные переключатели и реле

RF и радио

Резисторы

Датчики

Инструменты и аксессуары

Транзисторы

Прочие

T435-600T STMicroelectronics | Дистрибьютор Rutronik24

  1. Дом
  2. Симисторы / Тиристоры
  3. STMicroelectronics Симисторы / Тиристоры
Показанное изображение

представляет собой только представление

TRIAC 4A 600V TO220
Поставщик: Код поиска STMicroelectronics
: T435-600T
Rutronik No.: TRIAC4908
Единичная упаковка: 50
MOQ: 50
упаковка: TO220
Упаковка: TUBE

Лучший выбор

I (TRMS) эфф
4 А
У (РРМ)
600 В
Вкладка напряжения
НЕИЗОЛЯЦИЯ
I (GT) макс
35 мА
Автомобильная промышленность
НЕТ
Пакет
TO220
Leadfree Defin.
10
Упаковка
ТРУБКА
ECCN
EAR99
Таможенный тариф №
85413000000
Страна
Китай
Код ABC
B
Поставщик Срок выполнения
29 недель

С товарами в вашей корзине вы можете отправить нам заказ или, если у вас возникнут дополнительные вопросы, запрос, не имеющий обязательной силы.

TRIAC 4A 600V TO251
упаковка: TO252
Упаковка: ТРУБКА

Предыдущий Следующий

Перекрестная ссылка T435-600T, замена T435-600T, замена T435-600T

Номер запасной части Repl.Mfr Описание Ссылка Тип
BT136-500 Перекрестная ссылка Philips Симисторы Замена штифтов
BT136-500G Перекрестная ссылка Philips Симисторы Замена штифтов
BT136-600 Перекрестная ссылка Philips Симисторы Замена штифтов
BT136-600D Перекрестная ссылка Philips Источник информации: сайт Littelfuse Возможный аналог
BT136-600G Перекрестная ссылка Philips Симисторы Замена штифтов
BTA204-500B Перекрестная ссылка Philips Источник информации: сайт STMicroelectronics Замена штифта на штырь
BTA204-500C Перекрестная ссылка Philips Источник информации: сайт STMicroelectronics Замена штифтов
BTA204-600B Перекрестная ссылка Philips Источник информации: сайт STMicroelectronics Замена штифтов
BTA204-600C Перекрестная ссылка Philips Источник информации: сайт STMicroelectronics Замена штифтов
Перекрестная ссылка MAC4M ON Semiconductor Симисторы Кремниевые двунаправленные тиристоры Замена штифтов
Q6006Rh5 Перекрестная ссылка Литтельфузе Альтернативные симисторы (от 6 А до 40 А) Замена штифтов

T435-600T datasheet, Распиновка, схемы применения 4A TRIACS

CD74HCT4351EE4 Техасские инструменты 8-КАНАЛЬНЫЙ, МУЛЬТИПЛЕКСОР С КОНЕЧНЫМ SGL, PDIP20, СООТВЕТСТВУЮЩИЙ ROHS, ПЛАСТИК, DIP-20
CD74HCT4351E Техасские инструменты Высокоскоростной 8-канальный аналоговый мультиплексор / демультиплексор CMOS с защелкой 20-PDIP -55 - 125
LME49600TS / NOPB Техасские инструменты Высокопроизводительный, высокоточный аудиобуфер 5-DDPAK / TO-263 от -40 до 85
UCC28600TDRQ1 Техасские инструменты Автомобильный 8-контактный контроллер обратного хода с текущим режимом и зеленым режимом 8-SOIC -40-105
MCP73811T-435I / OT Microchip Technology Inc ОДНА ЯЧЕЙКА, СИСТЕМА LI-LON / LI-POLYMER CHG MGMT, от -40 ° C до + 85 ° C, 5-SOT-23, T / R
MCP73812T-435I / OT Microchip Technology Inc ОДНА ЯЧЕЙКА, СИСТЕМА LI-LON / LI-POLYMER CHG MGMT, от -40 ° C до + 85 ° C, 5-SOT-23, T / R
MICRF600TR Microchip Technology Inc Телекоммуникационная сеть, 1-Func, 11.50 X 14,10 ММ, МОДУЛЬ-16
ENC424J600T-I / PT Microchip Technology Inc DATACOM, ПЕРЕДАТЧИК ETHERNET, PQFP64, 10 X 10 ММ, ВЫСОТА 1 ММ, ПЛАСТИК, TQFP-64
DSC1001DL5-015.3600 т Microchip Technology Inc OSC MEMS 15,36 МГц CMOS SMD
MCP9600T-E / NU Microchip Technology Inc СПЕЦИАЛЬНАЯ АНАЛОГОВАЯ ЦЕПЬ

T435-600T | ET11955143 | STMicroelectronics | STMicroelectronics T435-600T

Стандартное время выполнения производителем : 27 недель
Базовый номер детали : Т435
Подробное описание : TRIAC Alternistor - Snubberless 600V 4A Through Hole TO-220AB
Тип крепления : Сквозное отверстие
Напряжение - триггер затвора (Vgt) (макс.) : 1.3В
Состояние детали : Активный
серии : Snubberless ™
Комплект устройства поставщика : К-220АБ
Ток - триггер затвора (Igt) (макс.) : 35 мА
Ток во включенном состоянии (It (RMS)) (макс.) : 4A
Упаковка : Трубка
Напряжение - выключенное состояние : 600 В
Рабочая температура : -40 ° C ~ 125 ° C (ТДж)
Симистор Тип : Генератор - без амортизатора
Ссылка клиента :
Текущие - не представительстваСкачок 50, 60 Гц (Itsm) : 30А, 31А
Упаковка / чемодан : К-220-3
Конфигурация : Одноместный
Ток - удержание (Ih) (макс.) : 35 мА
Производитель : STMicroelectronics
Повторяющееся пиковое прямое запирающее напряжение : 600 В
Повторяющееся пиковое обратное напряжение : 600 В
Пиковое напряжение в открытом состоянии : 1.56 В
Размеры : 10,4 x 4,6 x 9,15 мм
Тип крепления : Сквозное отверстие
Номинальный импульсный ток : 31A
Расчетный средний ток в открытом состоянии : 4A
Высота : 9.15 мм
Ширина : 4,6 мм
Длина : 10,4 мм
Повторяющийся пиковый ток в выключенном состоянии : 0.005 мА
Тип корпуса : К-220АБ
Минимальная рабочая температура : -40 ° С
Максимальный ток удержания : 35 мА
Максимальный ток срабатывания затвора : 35 мА
Максимальная рабочая температура : +125 ° С
Счетчик выводов : 3
rohs : Сертификат соответствия RoHS
Максимальное напряжение срабатывания затвора : 1.3В

- Купить t435 с бесплатной доставкой на AliExpress

Отличные новости !!! С t435 вы попали в нужное место. К настоящему времени вы уже знаете, что все, что вы ищете, вы обязательно найдете на AliExpress. У нас буквально есть тысячи отличных продуктов во всех товарных категориях. Ищете ли вы товары высокого класса или дешевые и недорогие оптовые закупки, мы гарантируем, что он есть на AliExpress.

Вы найдете официальные магазины торговых марок наряду с небольшими независимыми продавцами со скидками, каждый из которых предлагает быструю доставку и надежные, а также удобные и безопасные способы оплаты, независимо от того, сколько вы решите потратить.

AliExpress никогда не уступит по выбору, качеству и цене.Каждый день вы найдете новые онлайн-предложения, скидки в магазинах и возможность сэкономить еще больше, собирая купоны. Но вам, возможно, придется действовать быстро, поскольку этот лучший t435 вскоре станет одним из самых востребованных бестселлеров. Подумайте, как вам будут завидовать друзья, когда вы скажете им, что купили свой t435 на AliExpress. Благодаря самым низким ценам в Интернете, дешевым тарифам на доставку и возможности получения на месте вы можете еще больше сэкономить.

Если вы все еще не уверены в t435 и думаете о выборе аналогичного товара, AliExpress - отличное место для сравнения цен и продавцов.Мы поможем вам решить, стоит ли доплачивать за высококачественную версию или вы получаете столь же выгодную сделку, приобретая более дешевую вещь. И, если вы просто хотите побаловать себя и потратиться на самую дорогую версию, AliExpress всегда позаботится о том, чтобы вы могли получить лучшую цену за свои деньги, даже сообщая вам, когда вам будет лучше дождаться начала рекламной акции. и ожидаемая экономия.AliExpress гордится тем, что у вас всегда есть осознанный выбор при покупке в одном из сотен магазинов и продавцов на нашей платформе.Реальные покупатели оценивают качество обслуживания, цену и качество каждого магазина и продавца. Кроме того, вы можете узнать рейтинги магазина или отдельных продавцов, а также сравнить цены, доставку и скидки на один и тот же продукт, прочитав комментарии и отзывы, оставленные пользователями. Каждая покупка имеет звездный рейтинг и часто имеет комментарии, оставленные предыдущими клиентами, описывающими их опыт транзакций, поэтому вы можете покупать с уверенностью каждый раз. Короче говоря, вам не нужно верить нам на слово - просто слушайте миллионы наших довольных клиентов.

А если вы новичок на AliExpress, мы откроем вам секрет. Непосредственно перед тем, как вы нажмете «купить сейчас» в процессе транзакции, найдите время, чтобы проверить купоны - и вы сэкономите еще больше. Вы можете найти купоны магазина, купоны AliExpress или собирать купоны каждый день, играя в игры в приложении AliExpress. Вместе с бесплатной доставкой, которую предлагают большинство продавцов на нашем сайте, вы сможете приобрести t435 по самой выгодной цене.

У нас всегда есть новейшие технологии, новейшие тенденции и самые обсуждаемые лейблы. На AliExpress отличное качество, цена и сервис всегда в стандартной комплектации. Начните самый лучший шоппинг прямо здесь.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *