Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Содержание

Доработка головки динамической 25ГДН-1-4 – RadioRadar

Широко распространенные низкочастотные головки динамические 25ГДН-1-4 (старое название10ГД-34, современный аналог 25ZT-1-4), рис. 1, устанавливались в двухполосных акустических системах 6АС-2, 6АС-9, 10АС-9, 6МАС-4, во всех модификациях S-30 и других в качестве НЧ – СЧ звеньев. Высокочастотным звеном зачастую служила головка  6ГДВ-1-16 (3ГД-2) [1]. В некоторых выпусках трехполосных акустических системах 35АС-1 она применялась как СЧ звено. Однако качество звучания этих систем в диапазоне средних частот желает лучшего. Радиолюбителями неоднократно поднимался вопрос улучшения качества звучания громкоговорителей на базе данной головки.

а)

 

б)

Рис. 1. Низкочастотная головка динамическая 25ГДН-1-4 (10ГД-34): а – общий вид; б) – габариты и установочные размеры.

 

Частотная характеристика головки 25ГДН-1-4 имеет значительные неравномерности в области средних частот.  Начиная с 1 кГц плавный подъем звукового давления, а свыше 4,5 кГц резкий спад (рис. 2).  Фильтр акустических систем серии S-30 имеет частоту раздела 5 кГц, а 6АС-2 – 10 кГц. Вследствие этого имеем значительный провал в этой области частот, что, в свою очередь, заметно ухудшает качество звучания излучателя. Помимо этого пылезащитный колпачок не имеет необходимой жесткости, особенно полимерный металлизированный. При больших амплитудах колебаний подвижной системы слышимы щелчки и дребезг. Головка 6ГДВ-1-16 имеет частоту основного резонанса 4,5 кГц и работать на этой частоте и вблизи ее без искажений не может, как недостаток следует отметить присутствие некого сипения.

Рис. 2. АЧХ звукового давления головки динамической 25ГДН-1-4 (10ГД-34)

 

Повысить верхнюю границу частотного диапазона динамика до 10-12 кГц можно, например, применить дополнительный конус, который вставляется внутрь диффузора (рис. 3). В этом случае на высоких частотах основной диффузор перестает работать из-за относительно гибкого соединения его с звуковой катушкой, а в работу включается малый диффузор, достаточно жесткий и легкий [2].

Рис. 3. Громкоговоритель с дополнительным диффузором.

 

Типичные недостатки имеют акустические системы семейства S-90. В статье  “Модернизация АС 35АС-012 (S-90)” [3] описана методика их устранения для головки 15ГД-11А (20ГДС-1-8) конструктивно очень схожей с 25ГДН-1-4, которую с успехом можно применить к последней – заменить родной пылезащитного колпачка на колпачок от головки 10ГДШ-1-4 (10ГД-36К), имеющий форму конуса – рупора (рис. 4). Диаметры их звуковых катушек очень близки – 25,7 мм у 10ГДШ-1-4, и 25,4 мм у 25ГДН-1-4.

Рис. 4. Высокочастотные пассивные рупоры (конусы) 10ГДШ-1-4. 

 

Работы проводят в следующем порядке. Вначале отмачивают пылезащитный колпачок растворителем 646 или 647. Аккуратно извлекают его скальпелем (рис. 5, а). Желательно пользоваться не намагничиваемым инструментом.  Неосторожным движением предмета из стали можно повредить элементы динамика! Вытирают ватным тампоном, смоченным в том же растворителе, диффузор от клея. Промазывают клеем “Момент” нижнюю часть рупора и верхнюю часть звуковой  катушки. Просушивают 10-15 минут. Опять промазывают обе детали  и сразу соединяют их, прижимая с определенным усилием (рис. 5, б).

а)

 

б)

Рис 5. Низкочастотная динамическая головка 25ГДН-1-4: а – извлечение пылезащитного колпачка;  б – приклеивание рупора.

 

Конструкция рупора разработана для динамической головки 10ГДШ-1. Для 25ГДН-1-4 его следует подогнать. Подгонка заключается в поэтапном срезании его края, измеряя, после каждого срезания, АЧХ динамика. Операцию повторяют до тех пор пока не получат наиболее ровную кривую АЧХ в приделах средних частот. Срезав, примерно, 10 мм края рупора проводят измерения. Второе и последующие подрезания следует проводить очень аккуратно, срезая не более 3 – 1 мм (в порядке уменьшения). В итоге, боковая поверхность рупора внутри составила около 7 мм (от пылезащитного элемента колпачка до края обрезки) – рис. 6,а. Обрезку исполняют маникюрными ножницами, поскольку они оказались самым приемлемым инструментом для такого вида работы, имеют миниатюрные округленные режущие поверхности. Обрезанный край, для придания жесткости, пропитывается клеем БФ-2, немного разведенным этиловым спиртом.

а)

 

б)

 

в)

Рис. 6. Формирования рупора головки динамической 25ГДН-1-4: а – процесс срезания; б – измерение высоты стенки; в – вид на этапе завершения.

 

Измерения АЧХ производят с помощью конденсаторного микрофона (желательно измерительного), размещенного на одной оси с головкой*, в пределах 30 – 40 см,   компьютера и программы RightMark 6.2.3. Микрофон подключается к линейному входу звуковой карты компьютера, а динамик к усилителю компьютерных АС. Запускают программу RightMark 6.2.3 и проводят измерения АЧХ звукового давления [4,5].

Такая доработка позволила расширить полосу частот, воспроизводимых головкой 25ГДН-1-4, до 10 кГц (!),  и избавится от структурных призвуков пылезащитного колпачка. При прослушивании и сравнении головок доработанной с оригинальной установлено заметное расширение полосы воспроизведения верхних частот, что наблюдается на графике АЧХ звукового давления – рис. 7. Несмотря на погрешности измерений, искажения сигнала, вносимые усилителем, микрофоном, окружающей средой, можно сделать вывод, что желаемый результат достигнут.

Рис. 7. АЧХ звукового давления головки динамической 25ГДН-1-4 оборудованной дополнительным излучателем.

 

Головка динамическая 25ГДН-1-4 после такой доработки может использоваться в качестве низкочастотной, среднечастотной и  широкополосной, как в компьютерных АС, так и  автомобильных (легко монтируется в штатные места под акустику передних дверей большинства моделей автомобилей), малогабаритных сабвуферах и т. п. 

Примечание. С целью устранения негативного влияния акустического короткого замыкания на итоги измерений, головку 25ГДН-1-4 помещают в бокс с открытой задней стенкой, снаружи и изнутри покрытого звукопоглощающим материалом. Динамик монтируют на переднюю панель снаружи. В противном случае воздух, резонирующий в отверстии под головку, будет вносить искажения. На графике АЧХ это проявляется в виде пиков и провалов.

Литература

1. Бурко В., Лямин П. Бытовые акустические системы: эксплуатация и ремонт. Справочное пособие. Минск, “Беларусь”, 1996, с. 224.

2. Сапожков М. Акустика. Учебник для вузов. М., “Связь”, 1978, с. 138.

3. Марченко В. Модернизация АС 35АС-012 (S-90). http://www.radioradar.net/radiofan/audio_equipment/35ac_012.html

4. Марченко В. Микрофон измерительный. http://www.radioradar.net/radiofan/measuring_technics/measuring_microphone.html

5. Афонин С. Создание акустических систем в домашних условиях. М., “Эксимо”, 2008, с. 90-96.

Автор: Владимир Марченко г. Умань, Украина

25гдн-1-4 (10гд-34) | Festima.Ru – Мониторинг объявлений

Bинтaжные динaмики. Все в отличном рабочeм и коcметическом coстоянии. Без пpopывoв,тpений,хрипeний,пoдклеeк и прoчиx недoстаткoв. Отпpавлю Почтой Роcсии или СДEК пocылки cтоимоcтью oт 400р. Пакую очень нaдежно. Хорoшие мaтeриaлы для упaковки имеютcя. —————————————————- Фoто 1-2: 5ГД-3 (2шт) (13000р. зa пapу) Диaпазон чacтот 40-5000 Гц. Чувcтвительность 93,5 дБ. Мощность 5 Вт на канал. Номинальное сопротивление 10 Ом. Сопротивление на тестере 8,0 + 6,0 Ом. 4ГД-4 (2шт) (9000р.за пару) Новые. С хранения. Не паяные. Оба изготовлены в январе 1972г. Оригинальные коробки и паспорта в комплекте. Диапазон частот 60-12000 Гц. Чувствительность 93 дБ. Мощность 4 Вт на канал. Номинальное сопротивление 8 Ом. Сопротивление на тестере 7,2 + 7,1 Ом. —————————————————– Фото 3-4: 4ГД-8Е (4шт) (700р.за пару) Диапазон частот 125-7100 Гц. Чувствительность 93,5 дБ. Мощность 4 Вт на канал. Номинальное сопротивление 4 Ом. Сопротивление на тестере: Дата выпуска 1984г. – 3,2 + 3,3 Ом. Дата выпуска 1972г. – 3,6 + 3,4 Ом. Защитные решетки с алюминиевыми рамками к динамикам 10ГД-34 и 4ГД-8Е. (в наличии 2шт) (цена 300р за пару) Защитные сетки с алюминиевыми рамками к головкам 3ГД-2. (в наличии 2шт) (цена 300р.за пару) 3ГД-31 (2шт) (700р.за пару) Диапазон частот 2800-20000 Гц. Чувствительность 90 дБ.

Мощность 5 Вт на канал. Номинальное сопротивление 8 Ом. Сопротивление на тестере 6,5 и 6,8 Ом. 5ГДВ-10 (2шт) (700р.за пару) Диапазон частот 2800-20000 Гц. Чувствительность 90 дБ. Мощность 5 Вт на канал. Номинальное сопротивление 8 Ом. Сопротивление на тестере 6,4 и 6,6 Ом. 1ГД-3 (1шт) (1000р) Диапазон частот 5000-18000 Гц. Чувствительность 93,5 дБ. Мощность 1 Вт. Номинальное сопротивление 12,5 Ом. Сопротивление на тестере 10,2 Ом. —————————————————— Фото 5-6: Драйвер ЛОМО Кинап 1А-22 с диафрагмой (1шт) (1000р.) Верхней карболитовой крышки нет. Магнит кобальт. (не размагниченный) Номинальное сопротивление 25 Ом. Сопротивление на тестере 20.4 Ом. Диапазон частот 1000-16000 Гц. Мощность 12 Вт. Вес 3,2 кг. 25ГДВ-1-4 (1шт) Под пломбой (1000р.) Размеры: 107х119х32 мм Диапазон частот 2000 – 25000 Гц. Чувствительность 88 дБ. Мощность 25 Вт. Номинальное сопротивление 4 Ом. Сопротивление на тестере 4,0 Ом. Динамик 2ГД-19 (1шт) (400р.) Диапазон частот 80-10000 Гц.
Чувствительность 90 дБ. Размеры: Диаметр 15,2см, глубина 5,4см. Номинальное сопротивление 4,5 Ом. Сопротивление на тестере 4,2 Ом. Динамик W0404-0250-47 (1шт) (200р.) Внешние размеры корзины: Диаметр 10,5см, глубина 5,5см. Номинальное сопротивление 4 Ом. Сопротивление на тестере 3,8 Ом. Твиттер (пищалка) 171352 (1шт) (200р.) Номинальное сопротивление 8 Ом. Сопротивление на тестере 7,5 Ом. Размеры: Диаметр 8см, глубина 3см. Расстояние между креплениями 19,3см. —————————————————– Фото 7-8: 5ГДШ-5 (2шт) В корпусах Орбита 8АС-14А. (700р.за пару) Диапазон частот 100-12500 Гц. Чувствительность 92,5 дБ. Мощность 5 Вт на канал. Номинальное сопротивление 4 Ом. Сопротивление на тестере 3,7 и 3,8 Ом. 5ГДШ-5 (5шт) (200р.за штуку) Диапазон частот 100-12500 Гц. Чувствительность 92,5 дБ. Мощность 5 Вт на канал. Номинальное сопротивление 4 Ом. Сопротивление на тестере: 3,8 и 3,8 Ом. 4,0 и 3,9 Ом. 3,8 Ом. —————————————————– Фото 9-10: Н 0816/10М (2шт) (400р.
за пару) Диффузор бумага. Номинальное сопротивление 8 Ом. Сопротивление на тестере 7,5 и 7,7 Ом. Размеры: Длина 16см, ширина 8,2см, глубина 6см. Расстояние между креплениями по диагонали 14см. Динамики широкополосные. (2шт) (400р.за пару) Диффузор бумага. Номинальное сопротивление 4 Ом. Сопротивление на тестере 3,7 и 3,8 Ом. Размеры: Длина 18см, ширина 8см, глубина 5,5см. Расстояние между креплениями по диагонали 16,5см. 1ГД-18 (2шт) (200р.за штуку) Номинальное сопротивление 6,5 Ом. Сопротивление на тестере 6,5 и 6,3 Ом. 1ГД-28 (1шт) (200р.) Номинальное сопротивление 6,5 Ом. Сопротивление на тестере 6,2 Ом.

Аудио и видео техника

Хорошо звучащие колонки при минимальных затратах

Построить хорошо звучащие колонки при минимальных затратах – мечта любого самодельщика. Именно поэтому статья Олега Салтыкова «Малогабаритный Громкоговоритель», вышедшая в журнале «Радио» в далёком 1977-м году, до сих пор не теряет актуальности. Конструкция горячо обсуждается на форумах, предлагается масса вариантов её улучшения. Один из них, прекрасно показавший себя на практике, мы сегодня и рассмотрим.

Со времени публикации в «Радио» той самой статьи с «Кубиками» Салтыкова (такое название закрепилось за этим проектом) и до недавнего времени, когда я сам занялся изготовлением и настройкой колонок, так и не удалось увидеть их реальную АЧХ. Есть тема по этой конструкции на vegalab.ru, но и там, в основном, либо отзывы владельцев о звучании, либо вопросы как применить тот или иной динамик вместо указанного.

И вот недавно я получил посылку с парой промышленных колонок 6АС-224, доработанных владельцем по мотивам «Кубиков». Кроме самих колонок, в посылке было множество разных динамиков, позволивших поэкспериментировать с их применением в этой конструкции.

Работа началась с измерения самих колонок без вмешательства. Исходный набор динамиков был такой: 6ГД-6 на НЧ, 2ГД-36 на ВЧ, а фильтры по схеме из того же журнала «Радио».

АЧХ колонок 6АС-224 на расстоянии 0,5 м по оси

Розовым цветом показана АЧХ НЧ-головки 6АС-224 в ближнем поле. Порт фазоинвертора – зеленым, суммарная характеристика — черным

АЧХ пищалки 6АС-224 в ближнем поле

Что же мы видим? 1. Выраженная неравномерность АЧХ, особенно наверху. Хорошего звука ожидать не стоит. 2. Нижняя граница в районе 60 — 70Гц с учетом работы порта фазоинвертора. Резонанс НЧ динамика 80 Гц, фазоинвертор настроен на 65 — 70 Гц.

АЧХ пищалки 2ГД-36 с фильтром от «Кубиков» просто чудовищная. На слух это подтвердилось, звук ужасен. Вместо ВЧ полочки какие-то зубы дракона. С этим набором всё ясно.

Но в той же посылке я нашел пару запечатанных новеньких пищалок Visaton TW70. Я с ними хорошо знаком, это удачные и недорогие бумажные, с приятным звуком динамики. Вот и узнаем, пригодятся ли они взамен жутковатых 2ГД-36. А пользуясь счастливым случаем, сравним их с нашими 2ГД-36, для чего из кучи наших пищал я отобрал лучшую, перебрав гору откровенно кривого барахла.

АЧХ лучшего экземпляра 2ГД-36, отобранного из кучи барахла

Сравнение АЧХ 2ГД-36 и Visaton TW70

АЧХ Visaton TW70 при 30º вне оси

Резонанс у TW70 в районе 2 кГц, значит, с 3 — 4 кГц можно её стыковать с нашим мидом (что и получилось дальше). АЧХ достаточно спокойная, протяженная и без резких изломов. У всех наших 2ГД-36 есть провал на 10 кГц, а как мы знаем, эта частота весьма важна для достоверного звучания. Там живут все реально слышимые звуки на верхнем крае диапазона, и потери на 10 кГц недопустимы — звук на высоких частотах стухнет и лишится серебра.

В этом плане Визатон оказался удачнее. К тому же у него есть пичок на верхнем крае, килогерцах на 13, за счет чего получается красивый акцент на всех щёточках-тарелочках и звенелочках, но не ярко выраженный, в пределах нормы. Итак, выбираем в пищалки Visaton TW70.

В посылке также оказались ранее незнакомые мне басовички с непривычно мощным магнитом, блестящим куполом-пыльником и маркированные буквами БРЗ — Бердский Радиозавод. На корзине размытая надпись 25ГДН… и ещё что-то. Позже выяснилось, что это 25 ГДН3-4 — нашел в сети ролики с прекрасной лекцией о них, измерениями и теплыми отзывами, как о шедевре нашего радиопрома. С чем сам искренне согласен, динамик превосходен по АЧХ, иным параметрам и звуку.

Итак, оценим характеристики НЧ-динамика при прямом включении и с катушкой фильтра.

Характеристики 25ГДН3-4 в ящике от 6АС-224 без фильтра по оси на расстоянии 0,5 м

Сначала рассмотрим характеристику в верхней части графика. Там два резонансных горба на кривой импеданса, это резонансы динамика на воздухе (48 Гц), его резонанс в ящике с закрытым портом фазоинвертора (70 Гц) и участок АЧХ в районе нижнего среза. Эти данные позволят прикинуть добротность Qtc.

Видно, что на 70 Гц спад отдачи относительно полки (она у нас идёт по уровню 120 дБ) составил минус 7 дБ, это соответствует полной добротности в ящике порядка 0,45. Соответственно, добротность самого динамика примерно 0,35, т.е. идеальна для фазоинверторного оформления.

Переходим к АЧХ, снятой на дистанции полуметра на оси басовичка. Видим чуть сваленную влево полочку, плавный монотонный спад с небольшим пиком в районе 5 кГц (это «работа» пылезащитного колпачка) и спокойный спад выше по частоте. Звучание динамика тоже порадовало, чистое, спокойное, без крика. И это напрямую, без фильтра.

Определившись с выбором динамиков, я, как обычно, выбросил прибывшие незнакомые фильтры (с ними успеем разобраться) и быстренько спаял макет собственных, простых двухполосных. Так у меня за годы как-то само собою сложилось, и после всех попыток сочинить что-то более крутое, обычно возвращаюсь к привычному варианту.

4-омному динамику 25ГДН3-4 для выравнивания АЧХ потребовалась катушка 0,68 мГн. Сразу оговорюсь, что есть и редкий 8-омный басовик 25ГДН3-8, он устанавливался в колонках Вега 15АС110. Если использовать его, то катушка понадобится вдвое большей индуктивности, 1,5 мГн.

АЧХ 25ГДН3-4 с катушкой Mundorf 0,68 мГн

Виден красивый пологий спад с маленьким пичком на 1 кгц. Как раз этот участок отвечает за презенс и живость голоса, супер! А выше, на 2 — 3 кГц, как раз спад, полезный для комфортности звучания.

Обратите внимание на поведение динамиков в ящике с учетом порта фазоинвертора. Срез басовика начинается с 60 — 65 Гц, инвертор протягивает отдачу герц до 50 уверенно, да и на слух бас превосходен. Можно не трогать и не достраивать.

Чтобы сделать фильтр для Визатона TW70 не понадобилось много времени, набор деталей типовой. Чуть убавил отдачу с помощью гасящего сопротивления на 3 Ома последовательно с пищалкой. И суммарная АЧХ сложилась в итоговую.

Финальный вариант «Кубика» от Александра Бокарева

Сквозь суммарную характеристику типа «черный забор» просматриваются раздельные АЧХ по полосам.

Жутковатая схема на картинке вверху позже будет облагорожена и выложена отдельно.

Предположим, что в нашем распоряжении не оказалось таких шикарных динамиков, о которых рассказано выше, а имеются те же самые из «Кубиков», 10 ГД-34-80 и 2ГД-36. Можно ли здесь что-то улучшить?

Для начала рассмотрим вариант колонки с оригинальными «Кубиками» от Олега Салтыкова. В ящике установлены эти динамики, ещё раз посмотрим на исходную АЧХ.

АЧХ колонок 6АС-224 на расстоянии 0,5 м по оси

АЧХ пищалки 2гд-36 с моим фильтром

Здесь уже ВЧ-фильтр мной подправлен, сглажен выброс на 5 кГц до общего уровня. Для этого схему я переделал на 2-й порядок, оставив входную ёмкость 2 мкФ (подойдёт и 1,5 мкФ) и добавив катушку на 0,3 мГн. В паре с 10ГД-34 и фильтром НЧ от Олега Салтыкова зазвучало неплохо. Кстати, в его схеме есть загадочный резистор на 22 Ома, включенный параллельно динамику. На самом деле этот резистор в сочетании с емкостью на 10 мкФ образует особую цепочку Цобеля, облагораживающую звучание на нижних частотах. Она формирует благозвучный многоступенчатый срез АЧХ и, как следствие, отменное звучание всей колонки в целом. Басовичок с этим фильтром можно слушать даже без пищалки, он удивительно музыкален. Автор угадал и выстроил все верные нотки в звучании этого фильтра.

Поэтому несмотря на уже рабочую схему моего макета, на роль НЧ-фильтра был безоговорочно выбран авторский вариант Салтыкова.

И вот что в итоге получилось:

АЧХ «Кубика» Александра Бокарева, версия от 14 02 2020

Привожу три рабочих варианта фильтров для колонок по мотивам Кубиков. Кто-то найдет для себя свой. Они все звучат в пределах своих возможностей, но достаточно тщательно выведены в звук и отслушаны придирчиво.

А вот как выглядят «Кубики» изнутри и снаружи.

Успеха и вам. Ваш АБ.

делаем концепт-широполосники из старых динамиков 10ГД-34 » Журнал практической электроники Датагор (Datagor Practical Electronics Magazine)


Заранее приношу извинения почитателям советской аудиотехники. В тексте присутствуют высказывания, которые могут быть болезненно восприняты некоторыми из них. Но, c’est la vie, и это всего лишь мое мнение.

Достались мне колонки 6АС-2 от старого рижского проигрывателя. Ну, такие продолговатые ящички литра по четыре, по которым некоторые в инете ностальгируют. Хороший, мол, у них звук…

Содержание / Contents


На самом деле, по-моему, колонки эти слова доброго не стоят. Спроектированы с особым цинизмом, изготовлены с особой небрежностью.
Звук соответствующий. Абы гудело да смотрелось как-то.

Но дело не в колонках. Которые кстати, при проверке на сигнал не реагировали, а изредка выдавали вместо музыки то ли предсмертные, то ли посмертные хрипы.
Вынул я из них динамики. Посмотрел на них. Это классика: криво поставленные магниты, наляпанный как попало клей. Плюс сзади обмазаны какой-то гадостью типа пластилина. И вот бы разумному человеку выкинуть всё это барахло на мусорник. Но, как человек неразумный, я начал думать, что бы с ними сотворить необычного.

Для начала почистить:

После очистки отремонтировал гибкие проводники, из-за излома которых динамики и не работали. Кстати, это у них болезнь.

Затем взгляд упал на старые 10ГДШ-4 с убитыми подвесами.


Эта фотка не моя, но мой был такой же
Вот вам и дармовые ВЧ-диффузоры. Концепция готова — делаю широкополосники!

Сверлю керн с мыслями о снижении Fs, увеличении Qms, и уменьшении КНИ. Просверлил:

Во дела! Магниты на 10ГДШ-4 такого же диаметра! Толку от них мало, но чего добру пропадать:

Цвет диффузора не нравится!!! Покраска:

Результат — «уникальные технологии», «бумагополимерный сендвич»!!! Ура!!!

Вклеиваю донорский диффузор, крашу магниты:

Вид снизу.

Визуальные результаты работы ясны.

Что касается параметров, то снизилась резонансная частота, увеличился эквивалентный объем. Чувствительность немного понизилась, но даже в таком варианте измеренная величина осталась на уровне 86 Дб, при паспортных 84(?).
Симуляция обещает F3 = 45 Hz при ГВЗ в пике 14 мс для фазоинвертирующего оформления объемом 8 литров. Неплохо.

На слух значительно расширился частотный диапазон, появились высокие частоты. Но ватную природу этого динамика мне победить, конечно же, не удалось. Он ни в коем случае не подходит для построения качественной АС, и даже современные китайские головки с диффузорами близких диаметров будут в основном звучат лучше. Проверено.
По этой причине изготовление корпусов отложено. Возможно навсегда.

Я сам толком не понимаю. Наверно просто забава. Радиолюбительское макраме.
Бессмысленное, с точки зрения рационализма, занятие. Но было весело, было интересно!

Спасибо за внимание!

Камрад, рассмотри датагорские рекомендации

🌼 Полезные и проверенные железяки, можно брать

Куплено и опробовано читателями или в лаборатории редакции.

 

Динамик 25 гдн 3 4. Правильные фильтры АС

Проект выходного дня так сказать. Довольно долго у меня жила в одном из углов акустика от двухкассетного магнитофона Нота 220с-1. Руки чесались ее разобрать. И вот дочесались. Фото на старте.

В разобранном состоянии.

К моему удивлению в ней оказалась пара 25ГДН-3-4. На мой взгляд это единственный советский динамик в таком размере на котором можно что-то строить. Для примера фото совместно с 25ГДН-1-4.

Мощный магнит, своя собственная корзина, а не остатки от 15ГД-11, как следствие довольно приятный звук. АЧХ в корпусе.

К нему в пару будет играть китайский высокочатотник Tinly. Эффектная внешность и очень посредственные характеристики. Впрочем большинство бюджетных твиттеров недалеко уходят по параметрам. АЧХ на фото ниже.

Ниже 3кГц его пускать нельзя, орет гнусно. Плюс оба динамика имеют выброс на 5кГц. Очень тяжелое испытание. Но задача стояла лепить из того что есть. Режектор в фильтре немного скрасит картину. АЧХ акустической системы в итоге.

Импеданс опять же в финальном исполнении.

Фильтр на скорую руку.

И фото обновленной АС.

По звуку… По звуку мне понравились. Вполне себе самодостаточная акустика. Чуть-чуть басит, слегка цыкает, не утомляет. Что еще можно требовать от данного набора динамиков?

В конце привожу схем фильтра. Характер АЧХ примененного высокочастотного динамика позволяет предположить, что без изменения фильтра возможно применение динамика 10ГД-35. Возможно прийдется корректировать уровень ВЧ, а в целом должно заиграть.

Схема НЧ части фильтра.

Схема ВЧ части фильтра.

Финал действа, фанерирование и окраска передней панели.

Думаю, не подлежит сомнению, что наилучший звук можно получить только от полноразмерных напольных трехполосных АС. Но нередки случаи, когда для них просто нет места. Небольшие колонки, как правило, будут уже двухполосными. Требования к ним будут немного меньше, но звук всё равно должен быть хорошим. Вот такой вариант мы и обсудим.

Первыми массовыми малогабаритными, но качественными советскими колонками были 10МАС.


Акустика 10МАС-1 от Эстония-006-стерео


Главными отличительными чертами были относительно скромные размеры при повышенной отдаче НЧ, а также всего два динамика (для экономии размеров).

Дальше – больше, размеры АС становились всё меньше, звук – хуже. Пользователи радовались тому, что их можно засунуть в нишу мебельной стенки, поставить на шкаф под потолок или на пол. Это окончательно убивало звук, но мало кого волновало, а дребезг посуды в шкафу с колонкой, вызывал восторг и гордость.

В чём же недостатки семейства таких моделей, коих выпущено было десятки? На мой взгляд, корень зла в двухполосности и неправильном разделе частот. Я считаю, что такие динамики, как 10ГД-30, 25ГД-26, 6ГД-6, 10ГД-34, 15ГД-14 и им подобные, принципиально неспособны хорошо звучать до 5 кГц, а именно это обычная частота раздела в двухполосках с этими динамиками. Кстати, про напарники этих динамиков – 3ГД-31, 10ГД-35 и им подобных, доброго слова не услышишь, без конструктивных доработок и сложных фильтров, работают они не лучшим образом.

Надо сказать, что были приличные динамики для двухполосок, способные хорошо звучать до 5 кГц, но они требовали не малогабаритных корпусов, поэтому не использовались.

Прогрэсс двигался дальше по дороге к абсурду , АС становились всё меньше, динамики для них – тоже. Системы 15АС и 25АС выпускались большими тиражами, до сих пор их немало на вторичном рынке по умеренным ценам. Заманчиво было бы улучшить их с минимальными переделками и расходами.

Акустические системы 15АС-109

Считаю, что данные колонки достойны доработки. Если их корпус, не изуродован, то выглядит неплохо, объем удовлетворительно достаточен для штатного динамика, есть ФИ.


Источник фото: vega-brz.ru

В 15АС-109 установлены 15ГД-14 (25ГДН-3-4) и 10ГДВ-2-16. Раздел на частоте 5 кГц и изменить его нельзя т. к. работа 10ГДВ-2-16 ниже невозможна. Поэтому звук вялый, серый, тусклый из-за невнятного воспроизведения средних (самых главных для общего восприятия звука) частот. И это касается не только данной модели, но и всех двухполосок в которые установлены ранее упомянутые НЧ динамики.

Лучшие советские конструкторы прекрасно это знали и для модернизации подобных двухполосок предлагали радиолюбителям установить полноценные СЧ динамики, такие как 2ГД-40. Увы, маразм миниатюризации не позволял что-то дополнительно ставить в малюсенькие корпуса, да еще в боксе, потому как объём и так был недостаточен.

Предлагались внешние городушки-скворечники, это хорошо звучало, но добиться культурного вида было сложно. Кроме того, что бы ни говорили, но 2ГД-40 и им подобные, работали, как по паспорту до 12,5 кГц, выше – обрыв, да и направленность выше игольчатая т. е. нужна трехполоска в новом корпусе и с новыми фильтрами, от старых колонок оставался один НЧ динамик.
Вариант хороший и я сделал такую трехполоску, принципиально только на доступных советских динамиках, но сегодня не об этом.

Доработка динамиков 25ГДН-3-4

В 15АС-109 установлены динамики 25ГДН-3-4, это неплохие динамики, братья 10ГД-34, но значительно лучше их за счет огромного мощного магнита. Вследствие этого они могут нормально работать на объем 8…12 литров, обеспечивать отдачу от 30…40 Гц при спаде не 15 дБ, как у S-90 и им подобных, а 3…6 дБ. Конечно, объем движимого воздуха и мощность несопоставимы с 75ГДН.

Общей бедой большинства советских динамиков с резиновым подвесом является его задубение, что вызывает повышение резонансной частоты, добротности, а это приводит к ухудшению качества. Если изначально (при изготовлении) подвесы были нормальными, их можно попытаться оживить. Если уже на заводе поставили тугие подвесы, поможет только их замена.

Что я могу посоветовать из практики. Взять вату, хороший бензин («Калоша» или аналогичный), вырезать из картона кружок по размеру бумажной части диффузора и прикрепить его, чтобы жидкости меньше попадали на бумагу. Далее смочить вату и обильно смачивать резиновый подвес с лицевой части.

Да, бензин быстро испаряется, но пересохшая резина жадно впитывает бензин, меняется на глазах, из тусклой становится блестящей. Конечно, все работы, особенно с ЛВЖ, требуют соответствующих мер безопасности.

Итак, поим разину с лицевой части, пока она не откажется пить бензин. Затем ставим динамик магнитом вверх и наливаем в канавку гофра бензин, ждём, пока он впитается и испарится. Сразу после полного испарения полезно устроить динамику разминку час-другой низкими частотами на резонансной частоте (легко определяется на глаз) добиваясь максимальной амплитуды, но без стука гильзы о магнитную систему.

Если резина действительно была сухой, она изменится, параметры динамика заметно улучшатся. Конечно, лучше всего, проводить измерения, если есть такая возможность. В моей практике были как случаи снижения резонанса на 20 Гц, так и незначительный эффект всего в несколько Герц.

Проблема в том, что через пару суток происходит частичный откат улучшенных параметров. Чтобы закрепить достижения, надо воспользоваться автомобильным восстановителем приводных ремней. Он продается в аэрозольных баллончиках. Думаю, все они примерно одинаковы, я купил «Belt Dressing & Conditioner» фирмы Permatex.


Покрываем пеной гофр с обеих сторон поочередно 2-3 раза (вот где понадобится картонный кружок, без него на диффузоре будут пятна и некрасивые потёки) дожидаясь каждый раз высыхания.

Эффект от такой обработки длительный, явно присутствует более полугода (по моему опыту). Резина становится на ощупь совсем другой – мягкой и немного липкой, на глаз – блестящей. Разминка с максимальной амплитудой тоже желательна.
Резонанс понизился с 60…65 до 45…50 Гц т. е. стал как у новых динамиков.

Замена динамиков 10ГДВ2-16

Динамик 10ГДВ2-16 принципиально не может работать от 2…3 кГц, поэтому ему – только замена. Основное требование – низкая резонансная частота 1…2 кГц без выброса на резонансе. Думаю, сгодятся 2ГД-36 и 4ГД-56, но устанавливать их неудобно, поэтому я не стал ими пользоваться. Поставил Philips AD0142 с резонансом 1300 Гц, результат оказался неплох.


Это промежуточный вариант и до настройки ФИ. Понимаю, что мало у кого есть эти Филипсы, да и ставить их сюда не хотелось т. к. для них есть хорошие комплектные низкочастотники Филипс.

Китайские твитеры Alphard TW-302

Для данного бюджетного проекта не хотелось использовать пищалки у которых стоимость одной штуки была выше пары колонок, да и размеры играли важную роль. Поэтому я купил данные дешевые (но не самые дешевые) пищалки.


Интересно было послушать эти «шёлковые» купольники. «Шёлк» тут явно синтетический, нити арматуры реденькие, но материал очень мягкий упругий, резко отличается от пластиковых мембран.
Корпус пластмассовый, а это погано – царапается, нет жесткости.

Заявленные параметры 8 Ом и 95 дБ оказались «китайскими» – сопротивление 4 Ома (импеданс во всей полосе частот, не просто измерено тестером), а чувствительность… Точно измерить не могу, да и не надо, по моим прикидкам 88 дБ. Есть разница с 95 дБ?..
Тем не менее, резонанс 900 Гц и 1200 Гц, звук неплохой, мембраны легко можно заменить. В общем, «третий сорт – не брак».

Доработка корпуса 15АС-109


Подробно останавливаться не буду, т. к. описано много раз, остановлюсь на самом важном. Это тщательная герметизация, заливка всех стыков и щелей снаружи и изнутри. Желательна проверка с помощью программы LIMP – щели очень хорошо видны.

Желательно стамеской удалить потеки эпоксидки на лицевой панели, выровнять неровности.

Установить внутри туго распорку между передней и задней панелями. Я поставил брусок сечением 20×40 мм. Распорку ставить между отверстиями под динамики.

Под пищалки Alphard TW-302 пришлось сделать дополнительную панель с отверстием под магнитную систему, она внутри. Шурупы через отверстия в пищалке ввинчиваются в эту панель, и она притягивает головку к лицевой панели.

Под динамики вырезаны прокладки из искусственной замши. Шурупы рекомендую заменить на более современные.

Отверстия под акустические провода залить клеем, установить сзади пружинные зажимы, к сожалению, нормальные терминалы с винтовыми зажимами установить не удалось из-за недостатка места.

При желании корпус снаружи можно покрыть лаком или облагородить иным образом. Внутри корпус обязательно плотно заполнить распушенным синтепоном, но оставить проход между отверстием трубы ФИ и НЧ динамиком.

Вместо поганой штатной пластмассовой панели я сделал рамку из тонкого ламината и натянул на неё ткань типа «канва». Крепление рамки к корпусу через «липучку» – просто и не надо сверлить отверстия. По неопытности я поставил слишком длинные отрезки липучки и снять рамку оказалось ох как непросто!

Правильные фильтры АС

Часто приходится видеть, как самодельщики считают, что фильтры – это что-то третьестепенное, достаточно по аудиофильским меркам поставить один конденсатор и одну катушку максимум.

По моему глубокому убеждению, всё совсем наоборот – фильтры важнейший элемент АС, неправильные фильтры способны испортить звук любых динамиков. Фильтры первого порядка могут работать с хорошо подобранными по характеристикам парами динамиков, имеющих естественный спад на частотах раздела без горбов и выбросов. В абсолютном большинстве случаев нам трудно найти такие пары.

И еще я убежден, что быстро и правильно отладить фильтры без акустических измерений, невозможно.
Пользы от любых калькуляторов – с гулькин нос, поскольку они в качестве моделей используют резисторы, хотя динамики – это непростые электромеханические системы с резонансами и другими особенностями.

Исключение – LSP CAD и только в том случае, если скормить ему результаты опять-таки микрофонных измерений.

Удалось добиться очень простой схемы фильтров, с минимумом стандартных номиналов (на это был особый упор).

Конденсаторы К73-16, все детали для удобства размещены на фанерке старого фильтра. Монтаж сделан акустическим кабелем сечением 1,5 квадрата.

Вот что получилось в LSP CAD


А вот результат измерений с микрофоном. Сравните.


Вот график импеданса, он нигде не опускается ниже 4 Ом, поэтому АС будут нормально работать с любым 4-х омным усилителем.


А вот что показал LIMP в ящике, где вроде бы не было явных щелей…

Ниже 300 Гц в обычной комнате из-за отражений измерения сделать трудно, поэтому они сделаны в упор.


Замер в упор доработанного динамика 25ГДН-3-4, порт ФИ заткнут. Видно, что по уровню -3 дБ нижняя частота 45 Гц. Частоту по -15 дБ, как принято измерять у промышленных колонок, найдите по графику сами. После включения и настройки ФИ удалось понизить частоту, но привести график измерений затруднительно из-за удаленности отверстия ФИ от динамика.

Повторяю, несмотря на низкую воспроизводимую частоту, не надо ждать такого же баса, как от S-90 из-за крошечного размера диффузора, но для тонального баланса этого хватает. С моей точки зрения, тональный баланс крайне важен.

Прослушивание обновлённых 15АС-109

Колонки сделаны были ещё летом. Конечно, на «хиенд» они не претендуют. Сравнивались с моим самодельным трехполосным трехкорпусным вариантом на 25ГДН-3-4 с модными последовательными фильтрами, и с Tandberg 2510 (кто-то сегодня помнит эту фирму – Hi-End 70-х годов?).

Естественно, они уступают обоим. Тем не менее, после переделки колонки явно стали лучше . Уверен, что они лучше любых заводских 15АС, S-20, S-30, всяких там кубиков и т. п. Звук ясный, чистый, по сравнению с трехполосным вариантом есть небольшая окраска, что неудивительно т. к. пищалка работает примерно от 2,5 кГц, а ниже – низкочастотник.

Обязательное условие – работа на подставке, хотя бы на табуретке. Если басы записаны на диске, они есть и в колонке, если в записи басов нет, то и колонки их не воспроизводят. Для нормального уровня громкости в комнате достаточно мощности до 4 Вт на канал. «Сибилянты не раздражают.»

В целом колонки играют достаточно ярко, но не назойливо. Тональный баланс по сравнению с вышеуказанными колонками смещен несколько вверх.

Малый размер позволяет их ставить даже на компьютерный стол. Колонки весьма тяжелые, что является скорее достоинством.

Итого

К моему удивлению, результат оказался лучше ожиданий. Теперь осталось передать колонки в добрые руки кого-то из моих друзей, на новое ПМЖ.

Спасибо за внимание!

Читательское голосование

Статью одобрили 125 читателей.

Для участия в голосовании зарегистрируйтесь и войдите на сайт с вашими логином и паролем.
Доработка НЧ динамика 25ГДН-3-4.

Этот динамик с малым Va s. Он равен 8литров, что уже само по себе неплохо, да еще и АЧХ 50-5000 Гц достаточно приемлемая, с F рез=55+/-10Гц. Вот только спад около 5000 Гц, да еще чувствительность маловата 84Дб. Итак, начнем….

Из опыта эксплуатации этих динамиков авторитетными людьми, характерной особенностью является продавливания мягкого, хрупкого колпачка вовнутрь – это первое. Второе – динамики редко когда держат полную мощность, чаще всего больше 15Вт они не держат. Ход динамика при большей мощности становиться на столько велик, что динамик катушкой начинает биться о магнит, что со временем сбивает отцентровку.

От сгнивших 25АС-027 остались никчемные динамики 20 ГДС-ХХ с которых было принято решение снять более плотный колпачок (он в диаметре несколько больше) и переставить на наш динамик. Эта операция описана во многих изданиях, я лишь ограничусь фотографиями. Что получилось – видно на последней фотографии.

Многие подумают – а ведь колпачок у 20 ГДС черный – и будут правы. Я просто его покрасил. Проделав эту операцию, получаем следующие результаты:

1/ Ушел провал в районе 5000 Гц!

2/ АЧХ стала несколько шире в сторону верха порядка 5500- 6500 Гц.(Это заметно даже на слуху)

3/ Однако чуть-чуть увеличился вес диффузора, что неприятно при такой чувствительности.

Теперь о чувствительности:

От старых, горелых динамиков 25 ГДН-3-4 были сняты магниты и приклеены в «противофазе» с торца динамика 88-ым клеем. Это дало прибавку чувствительности более 2 Дб, а так же появилась магнитное экранирование! Так же опустила резонансную частоту. Согласитесь – неплохо!

Теперь надо бы опустить резонансную частоту ещё ниже (В моём случае это не мешало бы. т.к. я планирую собрать Саб на этом динамике. У приобретенного она оказалась54Гц). Воспользовавшись советом, я промазал центрирующую шайбу и проводники – касторкой (аккуратно). Т.к. Центровочная шайба является частью ” тормоза” динамика, а вторая часть – это подвес. Промазывание центровочной шайбы привило к увеличению ” тормоза” динамика, что в свою очередь увеличило мощность которую может держать динамик и уменьшило Qts .


Подвес у диффузора этого динамика – резиновый и как следствие – жесткий. А хочется помягче! Для смягчения подвеса динамика я использовал жидкость под названием ” Кодиционер для резиновых приводных ремней” для автомобиля. Общий результат: F рез=35Гц – КРАСОТА!

Далее силиконовым герметиком заполнена канавка между магнитами и образовавшаяся дыра с торца магнита. А так же, отрезав часть рукава от резиновой хозяйственной перчатки, я его надел на вновь образовавшуюся магнитную систему.

В результате получился уже совершенно другой динамик с параметрами:

АЧХ 37-6500Гц, F рез=35Гц, Чувствительность не менее 86Дб. Vas динамика тоже увеличился, это надо так же учесть при вычислениях корпуса.

Если при сборке возникнут проблемы или непонятки, то пишите

Просматривая проекты Валентина и Владимира Пронина о создании Торнадо, также решил построить АС на небольших динамиках 25ГДН3-4 в оформлении Торнадо. Динамики неплохие, ФИ типа, как раз для небольших колонок, то – что и нужно для постройки миниТорнадо. Колонки планируются как мобильный вариант, для возможности переноски и прослушивания музыки на работе или в гараже. Материал применил обычный – ДСП. Пока сделана одна АС, снята АЧХ и импеданс головки. Виброплата из текстолита приклеена на силикон.

В качестве материала для пропеллера применил потолочную плитку (моющуюся), которая менее скрипучая. Опыт применения потолочной плитки уже был, когда делал небольшие колонки для кухни. Плитка хороша тем, что лёгкая, гибкая (эластичная).





(нажмите на фото для просмотра в полном размере)

С помощью металлической щётки дополнительно прокалывал пропеллер, для возможного пропуска воздуха. Также для устранения возможных призвуков между лопастями пропеллера проложена тонкая прокладка из флизелина, придающая мягкость звучания на НЧ и сводит шуршание лопастей пропеллера между собой к минимальному.


(нажмите на фото для просмотра в полном размере)

После настройки импеданса была снята и АЧХ НЧ динамика в Торнадо.
Импеданс – красная линия;
АЧХ в ближнем поле (у гофра динамика) – сиреневый цвет;
АЧХ порта – синий;
АЧХ с расстояния 50см – светло-синий.



(нажмите на фото для просмотра в полном размере)

С ВЧ динамиком пока не определился. Скорее всего, будет недорогой бумажный (телевизионный). Первое прослушивание показало неплохой, плотный, насыщенный звук на НЧ, что для небольших АС уже хорошо. После доделки второй АС дополнительно сообщу о результатах, что получилось. В принципе, что хотел – это получить приличные НЧ из небольших АС, на сколько способны воспроизвести данные динамики.

Широко распространенные низкочастотные головки динамические 25ГДН-1-4 (старое название10ГД-34, современный аналог 25ZT-1-4), рис. 1, устанавливались в двухполосных акустических системах 6АС-2, 6АС-9, 10АС-9, 6МАС-4, во всех модификациях S-30 и других в качестве НЧ – СЧ звеньев. Высокочастотным звеном зачастую служила головка 6ГДВ-1-16 (3ГД-2) . В некоторых выпусках трехполосных акустических системах 35АС-1 она применялась как СЧ звено. Однако качество звучания этих систем в диапазоне средних частот желает лучшего. Радиолюбителями неоднократно поднимался вопрос улучшения качества звучания громкоговорителей на базе данной головки.

Рис. 1. Низкочастотная головка динамическая 25ГДН-1-4 (10ГД-34): а – общий вид; б) – габариты и установочные размеры.

Частотная характеристика головки 25ГДН-1-4 имеет значительные неравномерности в области средних частот. Начиная с 1 кГц плавный подъем звукового давления, а свыше 4,5 кГц резкий спад (рис. 2). Фильтр акустических систем серии S-30 имеет частоту раздела 5 кГц, а 6АС-2 – 10 кГц. Вследствие этого имеем значительный провал в этой области частот, что, в свою очередь, заметно ухудшает качество звучания излучателя. Помимо этого пылезащитный колпачок не имеет необходимой жесткости, особенно полимерный металлизированный. При больших амплитудах колебаний подвижной системы слышимы щелчки и дребезг. Головка 6ГДВ-1-16 имеет частоту основного резонанса 4,5 кГц и работать на этой частоте и вблизи ее без искажений не может, как недостаток следует отметить присутствие некого сипения.

Рис. 2. АЧХ звукового давления головки динамической 25ГДН-1-4 (10ГД-34)

Повысить верхнюю границу частотного диапазона динамика до 10-12 кГц можно, например, применить дополнительный конус, который вставляется внутрь диффузора (рис. 3). В этом случае на высоких частотах основной диффузор перестает работать из-за относительно гибкого соединения его с звуковой катушкой, а в работу включается малый диффузор, достаточно жесткий и легкий .

Рис. 3. Громкоговоритель с дополнительным диффузором.

Типичные недостатки имеют акустические системы семейства S-90. В статье “Модернизация АС 35АС-012 (S-90)” описана методика их устранения для головки 15ГД-11А (20ГДС-1-8) конструктивно очень схожей с 25ГДН-1-4, которую с успехом можно применить к последней – заменить родной пылезащитного колпачка на колпачок от головки 10ГДШ-1-4 (10ГД-36К), имеющий форму конуса – рупора (рис. 4). Диаметры их звуковых катушек очень близки – 25,7 мм у 10ГДШ-1-4, и 25,4 мм у 25ГДН-1-4.

Рис. 4. Высокочастотные пассивные рупоры (конусы) 10ГДШ-1-4.

Работы проводят в следующем порядке. Вначале отмачивают пылезащитный колпачок растворителем 646 или 647. Аккуратно извлекают его скальпелем (рис. 5, а). Желательно пользоваться не намагничиваемым инструментом. Неосторожным движением предмета из стали можно повредить элементы динамика! Вытирают ватным тампоном, смоченным в том же растворителе, диффузор от клея. Промазывают клеем “Момент” нижнюю часть рупора и верхнюю часть звуковой катушки. Просушивают 10-15 минут. Опять промазывают обе детали и сразу соединяют их, прижимая с определенным усилием (рис. 5, б).

Рис 5. Низкочастотная динамическая головка 25ГДН-1-4: а – извлечение пылезащитного колпачка; б – приклеивание рупора.

Конструкция рупора разработана для динамической головки 10ГДШ-1. Для 25ГДН-1-4 его следует подогнать. Подгонка заключается в поэтапном срезании его края, измеряя, после каждого срезания, АЧХ динамика. Операцию повторяют до тех пор пока не получат наиболее ровную кривую АЧХ в приделах средних частот. Срезав, примерно, 10 мм края рупора проводят измерения. Второе и последующие подрезания следует проводить очень аккуратно, срезая не более 3 – 1 мм (в порядке уменьшения). В итоге, боковая поверхность рупора внутри составила около 7 мм (от пылезащитного элемента колпачка до края обрезки) – рис. 6,а. Обрезку исполняют маникюрными ножницами, поскольку они оказались самым приемлемым инструментом для такого вида работы, имеют миниатюрные округленные режущие поверхности. Обрезанный край, для придания жесткости, пропитывается клеем БФ-2, немного разведенным этиловым спиртом.

Рис. 6. Формирования рупора головки динамической 25ГДН-1-4: а – процесс срезания; б – измерение высоты стенки; в – вид на этапе завершения.

Измерения АЧХ производят с помощью конденсаторного микрофона (желательно измерительного), размещенного на одной оси с головкой*, в пределах 30 – 40 см, компьютера и программы RightMark 6.2.3. Микрофон подключается к линейному входу звуковой карты компьютера, а динамик к усилителю компьютерных АС. Запускают программу RightMark 6.2.3 и проводят измерения АЧХ звукового давления .

Такая доработка позволила расширить полосу частот, воспроизводимых головкой 25ГДН-1-4, до 10 кГц (!), и избавится от структурных призвуков пылезащитного колпачка. При прослушивании и сравнении головок доработанной с оригинальной установлено заметное расширение полосы воспроизведения верхних частот, что наблюдается на графике АЧХ звукового давления – рис. 7. Несмотря на погрешности измерений, искажения сигнала, вносимые усилителем, микрофоном, окружающей средой, можно сделать вывод, что желаемый результат достигнут.

Рис. 7. АЧХ звукового давления головки динамической 25ГДН-1-4 оборудованной дополнительным излучателем.

Головка динамическая 25ГДН-1-4 после такой доработки может использоваться в качестве низкочастотной, среднечастотной и широкополосной, как в компьютерных АС, так и автомобильных (легко монтируется в штатные места под акустику передних дверей большинства моделей автомобилей), малогабаритных сабвуферах и т. п.

Примечание. С целью устранения негативного влияния акустического короткого замыкания на итоги измерений, головку 25ГДН-1-4 помещают в бокс с открытой задней стенкой, снаружи и изнутри покрытого звукопоглощающим материалом. Динамик монтируют на переднюю панель снаружи. В противном случае воздух, резонирующий в отверстии под головку, будет вносить искажения. На графике АЧХ это проявляется в виде пиков и провалов.

Литература

1. Бурко В., Лямин П. Бытовые акустические системы: эксплуатация и ремонт. Справочное пособие. Минск, “Беларусь”, 1996, с. 224.

2. Сапожков М. Акустика. Учебник для вузов. М., “Связь”, 1978, с. 138.

3. Марченко В. Модернизация АС 35АС-012 (S-90). http://www..html

4. Марченко В. Микрофон измерительный. http://www..html

5. Афонин С. Создание акустических систем в домашних условиях. М., “Эксимо”, 2008, с. 90-96.

Дата публикации: 08.06.2015


Мнения читателей
  • Игорь / 28.12.2018 – 21:47
    надо ли делать пас этой головки для применения в s90 ?

О фазовых характеристиках громкоговорителей

О фазовых характеристиках громкоговорителей

О фазовых характеристиках громкоговорителей

Замечено, что громкоговорители с почти аналогичными техническими характеристиками звучат далеко не одинаково. Связано это с тем, что общепринятые параметры АС (частотная характеристика, коэффициенты нелинейных и интермодуляционных искажений, мощность, направленность излучения) не дают полного представления о фактическом ее звучании.

Важнейшим показателем, определяющим качество звучания громкоговорителя, является его поведение при переходе подвижной системы из состояния покоя к состоянию воспроизведения сигнала и наоборот, что зависит от переходных характеристик, входящих в громкоговоритель головок, и его сквозной фазочастотной характеристики (ФЧХ). И хотя влияние последней на качество звуковоспроизведения в настоящее время оценивается неоднозначно, замечено, что при испытаниях АС с близкими техническими характеристиками эксперты-музыканты отдают предпочтение АС с хорошими фазовыми характеристиками и с малым временем перехода из спокойного состояния в рабочее и наоборот.

Причем особенно важно сохранить имеющиеся фазовые и временные сдвиги между сигналами стереофонических каналов. Рядом исследований [1, 2] установлено, что существенно влияют на качество стереовоспроизведения фазовые сдвиги в диапазоне 100…1600 Гц. Неравномерность временных частотных характеристик (ВЧХ) стереоканалов в этом диапазоне не должна превышать 200 мкс. При неравномерности менее 30 мкс фазовые искажения незаметны. Последняя цифра характеризует разрешающую способность органов слуха в определении положения кажущегося источника звука в пространстве.

Идеальная ВЧХ излучения АС представляет собой прямую горизонтальную линию, а соответствующая ей ФЧХ – прямую наклонную линию. Угол наклона ФЧХ, характеризующий величину задержки сигнала в системе, может быть любым, и при этом в воспроизведенном звуковом сигнале сохранятся такие же фазовые соотношения, какими они были в исходном электрическом сигнале.

Фазовая характеристика однополосного громкоговорителя в диапазоне частот выше 150 Гц определяется параметрами установленной в нем головки, а многополосного зависит еще и от взаимного пространственного положения отдельных полосных головок, их фазировки, суммарной ФЧХ разделительных фильтров, т. е. в значительной степени от конструкции АС. Достаточно подробно о влиянии перечисленных факторов на качество многополосной АС рассказано в [3]. Там же сформулированы рекомендации для конструкторов многополосных громкоговорителей. В частности, чтобы сконструировать хорошую АС, следует соблюсти одинаковую фазировку полосных головок (особенно НЧ и СЧ), применить разделительные фильтры с гладкими суммарными АЧХ и ФЧХ, добиться пространственного согласования полосных головок по глубине, которое в первом приближении достигается расположением звуковых катушек полосных головок в одной плоскости, перпендикулярной акустической оси громкоговорителя.

Последняя рекомендация часто оказывается недостаточной по причинам, указанным в [4]. С целью уточнения величины относительного пространственного смещения полосных головок по глубине были проведены экспериментальные измерения этого параметра у ряда отечественных головок. Результаты этих измерений сведены в таблицу, в которой указана величина смещения (приближение к слушателю) звуковых катушек головок по глубине относительно звуковой катушки головки 10ГД-35 (наименования головок указаны в соответствии состарым ГОСТ 9010-84).

Головка

10ГД-35

6ГД-13

1ГД-З

2ГД-36 2ГД-22 10ГД-30

ЗГД-31

2 ГД -40

3 ГД -38

3 ГД -42

4 ГД -6

30ГД-1

4ГД-8

6ГД-2

6ГД-6

10ГД-34 15ГД-11

Смещение, см

0

0,5

1

2

2,5

Согласование, например, головок 10ГД-34 и ЗГД-31 достигается расположением звуковой катушки головки 10ГД-34 на 1,5 см ближе к слушателю по отношению к звуковой катушке головки ЗГД-31.

Если ФЧХ головок известна, то по их линейности в диапазоне частот выше 150 Гц можно оценить качество, а по углу наклона – величину пространственного смещения по глубине. Особенно важны сведения о форме фазовой характеристики головки при конструировании систем с датчиковой ЭМОС. С учетом последнего обстоятельства ФЧХ излучения головки удобно представить состоящей из двух слагаемых: φ1 (f) (ФЧХ ускорения звуковой катушки) плюс φ2 (f) (ФЧХ диффузора).

Такое разграничение носит условный характер, поскольку многие параметры диффузора (эффективная площадь излучения, эффективная масса подвижной системы) оказывают влияние и на φ1 (f), но оно оправдано тем, что в системах с ЭМОС ФЧХ сигнала обратной связи по ускорению совпадает с φ1 (f).

На слагаемое φ1 (f) влияют размеры и форма диффузора, скорость распространения механических колебаний в материале диффузора и характер их затухания, локальные резонансы небольших участков диффузора и ряд других факторов. В пределах диапазона поршневой работы диффузора характеристика φ2 (f) линейна, а за его пределами может стать нелинейной, причем нелинейность тем больше, чем больше изрезана АЧХ излучения головки на этих частотах.

Поскольку рабочий диапазон частот охваченной петлей ЭМОС головки выбирают в пределах диапазона поршневой работы диффузора (условие обеспечения линейности АЧХ излучения системы с ЭМОС), то снимаемую с датчика ФЧХ ускорения звуковой катушки с полным правом можно отождествить с ФЧХ излучения головки, т. е. происходящее в результате действия обратной связи сглаживание φ1 (f) однозначно приводит к сглаживанию ФЧХ излучения головки, что положительно сказывается на верности звуковоспроизведения.

Таким образом, конструкторам систем с ЭМОС можно ограничиться измерением формы φ1 (f) головки, что значительно проще, так как при этом не требуется специально оборудованного помещения, как при измерении ФЧХ излучения головки.

Для измерения φ1 (f) микрофонный капсюль малых размеров, например, встраиваемый в переносные магнитофоны, размещают на расстоянии 2…5 мм от центральной части поверхности диффузора и снимают ФЧХ напряжения микрофона по отношению к фазе приложенного к головке напряжения синусоидальной формы. С достаточной для практики точностью измерить характеристику этим способом можно с помощью осциллографа. Для этого подводимый к головке сигнал одновременно подают на вход внешней синхронизации, а снимаемый с микрофона – на вход “Y”. При правильной фазировке головки на ее резонансной частоте фазовый сдвиг составляет +90°, а с повышением частоты уменьшается до нуля и далее изменяет свой знак.

Одновременно с измерением ФЧХ измеряют и АЧХ снимаемого с микрофона сигнала, которая в диапазоне частот 500… 1000 Гц совпадает с АЧХ излучения головки. Если головку расположить в свободном пространстве, то измеренные таким способом характеристики будут соответствовать АЧХ и ФЧХ излучения головки, установленной в бесконечном экране. На рис. 1 и 2 приведены характеристики некоторых типов головок, измеренные приведенным выше способом.

Поскольку АЧХ и ФЧХ громкоговорителя на низких частотах в сильной степени зависят от акустического оформления, то для получения достоверных результатов измерения следует проводить после установки головки в штатное оформление. Однако в радиолюбительской практике часто возникает потребность иметь представление о форме АЧХ излучения и ФЧХ громкоговорителя до его изготовления. В этом случае можно воспользоваться следующим приемом. Эквивалентную схему головки представляют состоящей из двух последовательно включенных слагаемых – фильтра ВЧ (ФВЧ) и линии задержки. При этом на низших частотах параметры громкоговорителя описываются ФВЧ, а линия задержки определяет форму ФЧХ излучения (ее наклон) на более высоких частотах.

Параметры ФВЧ (частота среза, добротность, порядок) зависят как от применяемой головки, так и от оформления. Их можно найти по методикам, используемым при расчете громкоговорителей со сглаженными АЧХ [5, б], в основе которых лежит представление о громкоговорителе как о ФВЧ второго (закрытый ящик) или четвертого (фазоинвертор) порядка. Параметр линии задержки (время задержки) зависит только от типа используемой головки (у головок с более тяжелой подвижной системой время задержки больше).

По найденным параметрам ФВЧ легко построить АЧХ и ФЧХ излучения громкоговорителя на низших частотах, а на более высоких частотах (начиная с частоты, на которой φ1 (f) = 0) акустическое оформление на их форму влияния почти не оказывает, поэтому форма АЧХ и ФЧХ излучения громкоговорителя на этих частотах совпадает с характеристиками головки, измеренными по приведенной выше методике.

Построенные таким способом АЧХ и ФЧХ излучения (сигнала с датчика по ускорению диффузора) будущего громкоговорителя позволяют выбрать тип используемой в системе головки, вид оформления (закрытый ящик или фазоинвертор) и его габариты, отыскать параметры корректирующего устройства, правильно выбрать верхнюю частоту среза петлевого усиления системы, при которой сохраняется ее устойчивость.

Например, при установке головки 30ГД-1 в закрытый ящик функции корректора в прямой ветви петли ЭМОС может выполнять интегратор, а частоту среза петлевого усиления следует выбрать при этом равной 350…400 Гц (запас устойчивости по фазе-30…45°). Если петлей ЭМОС охвачена головка 6ГД-2 или блок из этих головок, то частоту среза выбирают равной 700…800 Гц.

В заключение следует сказать, что пользуясь приведенной выше методикой можно измерять АЧХ и ФЧХ излучения громкоговорителей-фазоинверторов. Для этого необходимы два микрофонных капсюля. Второй капсюль устанавливают в проходе инвертора, а сигналы с капсюлей подают на сумматор в соотношении, обратно пропорциональном площади диффузора НЧ головки и отверстия фазоинвертора. Точность измерений формы АЧХ излучения громкоговорителя этим способом в диапазоне частот до 500 Гц не уступает точности измерений в заглушенной камере.

Please activate Java…

характеристики ретро колонок для озвучки кинозалов

Имея на руках некоторое число старых и самых обыкновенных советских динамиков, мне захотелось собрать на них колонки (МАС — малогабаритная АС) и посмотреть, что можно получить из этой затеи. Считаю, что конструкция годится для повторения, затраты на комплектующие невелики. Если бы я применил редкие импортные динамики, возможность точного повторения была бы минимальной. Частотный диапазон готовой АС 40…20000 Гц.

↑ Выбор типа АС

С течением времени и накоплением определенного опыта, постепенно я пришел к выводу, что двухполоска – это хорошо, но для неё трудно найти подходящие динамики хорошо звучащие в достаточно широкой полосе частот.
Есть динамики 6ГД-2 и некоторые другие, но они дефицитны и малогабаритные АС на них точно не сделать, 6ГД-2 требуют ящиков размером с небольшой холодильник.

Чтобы получить более-менее низкую частоту на щите, он должен быть очень большим, это тоже не МАС. Для МАС остается только ФИ т. к. на мой взгляд, нет советских динамиков способных обеспечить бас в небольшом ЗЯ.

Все известные мне НЧ динамики имеют резиновый подвес (были с поролоном, но в данное время им требуется обязательная замена подвесов, да и объем ящика будет великоват для МАС) и плохо звучат на СЧ, а эти частоты для меня очень важны т. к. считаю, что именно они определяют общее качество звука.

Все советские МАС сделаны по двухполосной схеме, имеют высокую частоту раздела, примерно 5 кГц, поэтому звучат невыразительно из-за того, что «резиновый» НЧ динамик звучит выше 1…2 кГц далеко не лучшим образом.

Большинство промышленных АС, даже собранных по трехполосной схеме, тоже звучат на СЧ мутно т.к. в них обычно установлен «резиновый» 15ГД-11. Этим обстоятельством и вызвано огромное число статей по переделке 25АС, 35АС и их клонов. Поэтому для проекта был выбран трехполосный вариант с бумажным СЧ динамиком. Кроме того, я считаю, что для СЧ динамика лучшее оформление — щит или неглубокий ОЯ. Щит предпочтительнее по звуку, но неудобен по конструктиву.

Поэтому выбор типа колонок такой:

трехполоска, НЧ динамик в небольшом ящике с ФИ, СЧ динамик в небольшом неглубоком ОЯ, ВЧ динамик на крохотном щите.

↑ Что делать?

Предлагаю такой вариант. Из-за сложностей с пассивными фильтрами, сделать активный разделительный фильтр на частоту порядка 150 Гц и по два усилителя на канал. Для НЧ-звена усилитель можно попроще и помощнее, для СЧ-ВЧ маломощный высококачественный усилитель (хоть ламповый однотакт). Этот вариант позволяет применять вместе низкочувствительные басовики и СЧ-ВЧ динамики с высокой отдачей без того, чтобы душить до безобразия (уровня НЧ) чувствительность последних.
Отсюда в НЧ-звене могут использоваться самые разные головки в разном акустическом оформлении (проблемы и вопросы согласования по времени задержки останутся, но мы сейчас об этом не говорим).

В качестве СЧ-ВЧ звена применить широкополосник, хорошо воспроизводящий ВЧ, с рупорком. Пойдёт и ШП + пищалка, в качестве фильтра ВЧ только конденсатор. Да, может потребоваться подбор головок, но это реально т. к. широкополосники одного размера обычно имеют спад примерно на одной частоте. Я считаю, что это будет не трёхполоска в привычном понимании этого слова.

Я пробовал варианты с разными импортными и отечественными динамиками и результат макетов меня в целом удовлетворил.

Но вернёмся к нашим баранам — чистой двухполоске. В качестве СЧ-ВЧ можно применить модный сейчас автодинамик Alphard ETP-1623.

На мой взгляд, в пищалке он не нуждается, более того, он лучше звучит, если его ось отвернуть немного в сторону от слушателя. Мнения в Сети ест очень разные. Я могу отметить, что динамик на небольшом щите звучит весьма достойно. Я оцениваю его на твёрдую четверку при работе на небольшом щите и на той музыке, которую я слушаю. При смешной стоимости динамиков, это может быть решением многих проблем — нет забот с фильтрами и настройками, сателлиты на таких динамиках в небольших щитах могут звучать весьма прилично примерно от 150 Гц. Это и есть «дёшево и сердито».

Но басов у динамиков нет, вообще нет. Засовывать их в ЗЯ или ФИ нельзя, поэтому басовое звено необходимо.

Если будет интерес, я могу в дальнейшем привести результаты моих измерений Alphard ETP-1623 в моей комнате, в реальных условиях. Конечно, по сравнению с результатами в заглушенной комнате или в подобранных тепличных условиях, картинки могут ужаснуть, зато это будет правдой.

Сухой остаток:

Биампинг. Активные фильтры. Частота раздела 100…300 Гц. СЧ-ВЧ звено в открытом оформлении, питаемое от относительно маломощного высококачественного усилителя.

↑ Выбор динамиков

Выбор динамиков был вызван несколькими обстоятельствами. Имея по нескольку штук каждого типа динамиков, я мог сравнивать их характеристики и выбрать лучшие, оценить разницу между однотипными динамиками.
Динамики хотя и очень старые, но до сих пор доступные и весьма дешевые. Некоторые выпускаются и сегодня, но по поводу новодела ничего сказать не могу. У меня есть немало разных СЧ-ШП динамиков, но по разным причинам я отклонил их, выбрал 3 ГДШ2-8 (2ГД-40).

Выбор ВЧ динамиков был сильно ограничен. Самый доступный – 2ГД-36, он стоял в каждом телевизоре. Динамики 10ГД-35 и аналогичные в данном случае ставить нецелесообразно, кроме того, слишком большое число клонов ухудшает возможность повторения т. к. они несколько отличаются друг от друга. 3ГД-31 требует кардинальной доработки.

НЧ динамик 25ГДН3-4 (15ГД-14) для МАС — почти единственный. Лучшим выбором был бы 15ГД-17, но они весьма дефицитны, а 25ГДН3-4 стоят в 15АС-109 и множестве их клонов, поэтому доступны. Выбор НЧ динамика обусловлен и тем, что в 15АС-109 он звучит неплохо.

Наверное, можно поставить 10ГД-34, но он имеет более слабый магнит и заметно худшие характеристики. Остальные широко распространенные советские динамики для МАС, такие как 10ГД-30, не годятся т. к. требуют намного большего ящика. Можно поставить другой НЧ динамик, если ему достаточен ящик до 20 литров.

↑ 1970-е годы

Разгул транзисторизации и миниатюризации, погоня за параметрами в ущерб реальному качеству, которое нельзя или трудно было выразить в цифрах. Как тараканы из коробки посыпались разные ВИА, они были в каждом дворе и школе. Началось засилье электронных инструментов, электронного звука, транзисторных усилителей.
Транзисторы уверенно вытесняют лампы, их главное достоинство (как и сегодня у всяких гаджетов) – резкое уменьшение размеров и веса аппаратуры, возможность достаточно долго работать от автономного питания. Массово появились маленькие приёмнички


(и магнитофоны, большие и тяжёлые, но всё же переносные) с маленькими динамиками (звук пронзительный и орущий, но такой приёмник можно слушать на ходу, брать с собой на гулянку и т. д.).


Стерео вызвало создание пар отдельно стоящих акустических систем, в одном корпусе стерео толком не получить (попытки были).

В погоне за расширением диапазона в сторону НЧ стали делать закрытые ящики. Для них нужны были совершенно другие басовые динамики, чем раньше, и такие динамики, позволившие сделать басовитые маленькие АС, были сделаны!


10МАС-1 были предметом гордости (зависти), заявленный диапазон 63…18000 Гц казался фантастикой, казалось, что лучше быть уже ничего не может. Потрясённые новым звуком, басами, пищалками покупатели, как-то незаметно оттеснили на задний план субъективное качество звука, которое давало открытое оформление.

Думаю, ключ в том, что новая музыка лучше подходила именно под новый «транзисторный» звук, и почти все были счастливы.

Незаметно наступила новая эра. Один динамик уже не мог приемлемо воспроизвести весь диапазон, и его (диапазон) разделили на две (иногда три) части. Если раньше «маленькие» динамики только немного «помогали» основному щирокополоснику, то теперь диапазон звука большого динамика сдвинулся вниз, и он просто не мог воспроизводить высокие частоты.

Пришлось ставить более сложные фильтры (раньше хватало одной ёмкости). Динамики перестали быть универсальными и стали узкоспециализированными. В силу физических особенностей, типичная частота раздела стала 2 кГц т. е. в области максимальной чувствительности слуха ко всяким «бякам».

Выиграли в полосе частот, но получили букет проблем. Низкая чувствительность новых АС и требования к низкому выходному сопротивлению УМЗЧ привели к постепенному вытеснению ламповых усилителей. Это тоже не улучшило качество звука.

Справедливости ради надо вспомнить, что были АС на одном широкополосном динамике типа 10ГД-36,


роль ВЧ излучателя выполнял рупорок, но такие АС не получили массовую любовь населения (любители до сих пор пытаются применять их, но это другая тема).

Акустика

Новое поколение динамиков, способных работать в ЗЯ и неспособных по этой причине работать в ОЯ, звук стал закрытым, придушенным. Появились пищалки (раньше были редкостью), фильтры в АС стали обязательны.

Частотный диапазон заметно расширился в обе стороны. Динамики стали производить на большую мощность, но они утратили чувствительность.

Качество звука стало устраивать большинство обывателей (как сегодня, поэтому потуги сделать высококачественный звук массовым, не находят отклика у масс, которым бумбоксов хватает с головой). Появился стандарт Hi-Fi DIN 45000…

↑ Доработка динамиков

К сожалению, со временем, параметры динамиков ухудшаются, в первую очередь это касается НЧ динамиков из-за того, что их диффузор имеет наибольшую амплитуду колебаний. Резиновый подвес дубеет, токосъемные провода разрушаются.
При необходимости, для восстановления качества, надо отремонтировать динамики, особое внимание уделить подвесу. Вариант доработки я предлагал в статье «Доработка малогабаритных колонок 15АС-109 и им подобных».

Необходима также доработка СЧ динамиков. Гофр (весь диффузор пропитывать нельзя) пропитать жидким раствором герлена. Процесс подробно описан Шоровым и его последователями. Но этого оказалось недостаточно. При прослушивании собранных и настроенных колонок, звук был несколько жестковат. Причина оказалась в высокой акустической добротности динамиков. Пришлось применить ПАС, это дало заметный положительный результат.

Попытки доработать 2ГД-36 по методике улучшения 3ГД-31, положительного результата не дали.

↑ Разделительный фильтр АС

Мне было интересно попробовать модные последовательные фильтры, получить опыт работы с ними. Впечатления оказались неоднозначными. Могу точно заявить, что это не панацея. Для этих фильтров нужны динамики с ровными АЧХ в рабочей области и без значительных выбросов даже вне рабочего диапазона.
Мне не удалось ровно свести СЧ-ВЧ динамики на частоте около 5 кГц, вынуждено получилось только на частоте 8…9 кГц, что имеет свои недостатки. Раздел НЧ-СЧ на 500 Гц.

В отличие от параллельных фильтров, где фильтр для каждого динамика можно настраивать отдельно и независимо, здесь есть нежелательная взаимозависимость, что усложняет настройку. В итоге получился вот такой фильтр.

Схема последовательного фильтра АС
По заявлению автора такого решения, схема обладает наиболее гладкими стыками т. к. всё что отрезается фильтрами НЧ и ВЧ поступает на СЧ динамик. Мысль интересная и всё так и было бы, если вместо динамиков стояли резисторы. Но, как я много раз писал, динамики, как электромеханические устройства, обладают своим норовом и результат может не оправдать ожиданий.

↑ Конструкция АС

АС состоит из трех корпусов. Нижняя часть – ФИ объемом примерно 15 литров. Это больше общепринятого, но у меня были готовые ящики от купленных когда-то АС.


Пришлось подстраиваться под него. Труба ФИ получилась очень длинная – 27 см и пришлось ее делать Г-образной. Сделана из стандартной сантехнической трубы диаметром около 50 мм. Поскольку этот пластик клеить трудно, я сварил его паяльником, получилось достаточно прочно, уплотнение с корпусом сделано изолентой, шов изнутри обработан термоклеем.

Лицевая панель АС съемная.

СЧ динамик в ОЯ, желательно его делать минимально глубоким. ПАС выпилена из отрезка ламината, большое отверстие – под магнитную систему динамика, малые диаметром 10 мм для ПАС. Число отверстий некритично, можно сделать около 20.


Сначала я сделал с запасом, потом заклеивал их малярным скотчем. Акустическая добротность уменьшилась с 11 примерно до 1. Все делалось по рекомендациям Шорова. Материал взят от старой льняной простыни, натянут во влажном состоянии на ламинат, покрытый клеем 88-Lux. По периметру ткань закреплена скобами столярного степлера. При высыхании ткань дополнительно натягивается.

ВЧ динамик установлен на маленьком прямоугольном кусочке ламината.

Поскольку сделано три независимых корпуса, появилась возможность сдвига динамиков внутрь. СЧ сдвинут примерно на 4 см, ВЧ тоже на 4 см относительно СЧ. И если сдвиг СЧ динамика относительно НЧ мало влияет на форму измерительного импульса, то сдвиг ВЧ динамика достаточно заметен, величина сдвига выбрана оптимальной для прослушивания колонок с расстояния 2…2,5 метра.

Хочу отметить, что если все динамики разместить традиционно в одном корпусе, выполнить это смещение будет очень затруднительно. Представьте себе углубление в 8 см…

Можно спорить по поводу пользы такого решения, но оно примерялось в некоторых колонках очень давно и думаю, что от него отказались из-за нетехнологичности. Впрочем, такое решение применяется и сегодня, но не в деревянных, а литых корпусах – пластмассовых или металлических. Для этого углубление делается пологим, некоторые считают, что это рупор, но это не так – это способ сдвинуть динамики внутрь.

Думаю, меломаны разницу услышат, я не проводил специальных испытаний на музыке, а настраивал с помощью компьютерных программ и микрофона.

Высота колонки 73 см, если слушать сидя в кресле, подставка под колонку не нужна. Направление осей СЧ и ВЧ динамиков выбрано сознательно.

Если найдутся желающие повторить мои «15МАС-1», можно купить пару 15АС-109 в хорошем состоянии (клоны не годятся) под НЧ-боксы. Потребуется удалить ВЧ динамик и заглушить отверстие, можно использовать штатную трубу ФИ.

↑ Итоги

Благодаря комплексу вышеизложенных мер, получился хороший результат, выше ожиданий. Звук не отличный, т.к. для него нужны динамики более высокого класса, но хороший.
Думаю, лучше любой советской малогабаритной АС, что не удивительно т.к. они двухполосные. Что касается промышленных трехполосок, то здесь ситуация неоднозначная. Ясно, что по мощности (уровню громкости), мои колонки не могут тягаться с сериями клонов 25АС и 35АС. Не могут тягаться и по количеству баса, несмотря на то, что мои колонки работают примерно от 34 Гц по уровню -3 дБ, динамик такого малого диаметра, заметно уступает по мощи НЧ динамикам серии 25ГД, 30ГД.

Но 2ГД-36 звучит мягче, чем 10ГД-35. А главное преимущество — на СЧ. Резиновые 15ГД-11 звучат явно хуже, хотя и громче. Думаю, суммарный баланс в пользу этих МАС, но не для любителей убойного баса.

Для домашнего применения громкости данных колонок вполне достаточно, несмотря на низкую чувствительность 25ГДН3-4. А для дискотеки – нет. Но для дискотеки качество не нужно.

Целью моих опытов было опробовать некоторые приёмы и методы настройки, посмотреть, что можно сделать из дешевых и доступных динамиков, и при положительном результате предложить читателям «Датагора» новую статью.

Считаю, что конструкция годится для повторения, затраты на комплектующие невелики. Если бы я применил редкие импортные динамики, возможность точного повторения была бы минимальной. Частотный диапазон АС – минимально 40…20000 Гц, фактически, по стандартной методике, даже шире.

Колонки хорошо работают с усилителем В. Мосягина (MVV) на LM1875 по «помповой» схеме. Графиков измерений не даю, кто пожелает — измеряйте сами, например, по описанным мной на Датагоре методикам.

Спасибо за внимание!

Общие сведения

В настоящее время на различных форумах по аудиотематике идут бесконечные споры по созданию акустических систем на базе широкополосника 4ГД-35. Есть информация о невероятно хорошем и живом звучании подобных сборок, а также многочисленные примеры создания их своими руками за небольшие деньги. Встречаются конструкции в щите, рупоре, открытых и закрытых ящиках.

Некоторые умельцы ставят их в так называемую трубу Войта (TQWP), хорошо зарекомендовавшую себя при воспроизведении басов в небольших помещениях. Для поддержки высоких частот, через конденсатор в 1-2 мкФ, добавляется пищаль 2ГД-36. Примеры подобных самодельных колонок воплощены в жизнь уже многими меломанами.

Маркировка

Выпускался примерно с 1973 года на предприятии «Динамик» г.Гагарин, которое уже прекратило производство подобного оборудования. В разное время в его конструкцию вносились небольшие доработки и изменения. На первых изделиях символы «ГОСТ 9010-73» наносились на металлическую часть зеленой краской, вместе с печатью технического контроля «ОТК». Некоторые считают, что звук от них более качественный и объемный.

Позже появились модифицированные версии, с применяем требований другого стандарта — ГОСТ 9010-78. Они немного отличались визуально от своих предшественников, а на корпусе стоял красный штампик «СССР». В 80-xx на устройство наносится другая маркировка — «8ГДШ-1-4».

Технические параметры

Рассмотрим основные паспортные технические характеристики на 4ГД-35:

  • диапазон поддерживаемых частот: 63 – 12500Гц
  • мощность: рабочая 0,8 Вт; номинальная 4 Вт; кратковременная пиковая (PMPO) до 15 Вт; долговременная (RMS) 8 Вт;
  • чувствительность: 92дБ;
  • неравномерность АЧХ: 16дБ;
  • коэффициент гармоник (при 0,8 Вт): 125 Гц: 7 %; 200 – 300 Гц: 5%; 1000 – 8000 Гц: 3%
  • акустический импеданс (сопротивление): 4Ом;
  • полная добротность: 1,1-1,7;
  • резонансная частота в воздухе: 50-85 Гц;
  • размер: диаметр диффузор 200 мм; глубина 75,6 мм;
  • масса: 0,88 кг

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай | Реанимационная медицина | JAMA

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 г., в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов потребовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Цель Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения – 3 февраля 2020 г.

Открытия Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача в больнице подозревалась, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) – у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации – 7,0 дней и до ОРДС – 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и значимость В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента в Ухане и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенетический анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS). 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Huang et al. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были включены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические результаты (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с Берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или если при электрокардиографии и эхокардиографии были обнаружены новые аномалии. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача инфекции в больнице подозревалась, если в течение определенного периода времени заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазка из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для сохранения вируса, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы в ходе анализа RT-PCR в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 ‘. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5’-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 ‘. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд и увеличение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием тестов независимых групп t , когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений статистически значимым считалось двустороннее значение α менее 0,05. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, живот боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Были обнаружены многочисленные различия в лабораторных результатах между пациентами, поступившими в отделение интенсивной терапии, и теми, кто не поступил в отделение интенсивной терапии (таблица 2), включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ – медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт. Ст. (IQR, 103–234).

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Всего было выписано 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями был шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Для определения основных клинических признаков, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов наблюдалась выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 – из терапевтического и 5 – из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) – в отделении неотложной помощи и 2 (5%) – в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников этого отделения заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одной палате были инфицированы, и все они имели атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования свидетельствуют о возможности быстрой передачи вируса 2019-nCoV от человека к человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводится; R 0 указывает среднее количество дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем от каждого пациента инфекция передается двум.2 других человека. 15 Одна из причин быстрого распространения может быть связана с атипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам идентифицировать пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи – из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не входящими в ОИТ, пациенты, которые получали лечение в ОИТ, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До настоящего времени не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование мер индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передачу / инфекцию в больницах нельзя было окончательно доказать, но это предполагалось и предполагалось на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение интенсивной терапии (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктора Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, Ч. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Ченг, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: C. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом значительных исследований и разработок новых лекарственных средств в крупных национальных Научно-технические проекты Китая (2020ZX0

07 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Заразить Дис . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресса: берлинское определение. ЯМА . 2012; 307 (23): 2526-2533. doi: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой почечной недостаточности. Почки Интенсивное . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система – потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv

6. DOI: 10.1101 / 2020.01.30.

6

Валидация и международное признание новых или обновленных методов испытаний для оценки опасности

% PDF-1.6 % 1 0 obj> поток Acrobat Distiller 5.0 (Windows) 2005-08-18T16: 40: 56Z2014-02-25T10: 15-05: 002014-02-25T10: 15-05: 00PScript5.dll, версия 5.2.2application / pdf

  • OECD Guidance Document 34: Validation и международное признание новых или обновленных методов испытаний для оценки опасности
  • OECD
  • uuid: 5b5f026e-64f8-484d-beb8-eaeacfe15d03uuid: a950c347-9649-e748-b050-da0aa90fa75d конечный поток эндобдж 2 0 obj> / ProcSet [/ PDF / Text] / Font >>> / CropBox [0 0 595 842] / Parent 7 0 R / StructParents 2 / Rotate 0 / MediaBox [0 0 595 842] >> эндобдж 3 0 obj> поток HVmoHίXvX @ * a | &.yYlf7ypR : H | S۷ “監 Ҕ x $ .H8

    Клинические характеристики и исходы пациентов, перенесших операции в инкубационный период инфекции COVID-19

    Резюме

    Справочная информация

    Вспышка нового коронавирусного заболевания 2019 года (COVID-19) в Ухане, Китай, быстро распространилась по всему миру. На раннем этапе мы столкнулись с небольшим, но значимым числом пациентов, которым непреднамеренно были назначены плановые операции во время инкубационного периода COVID-19.Мы намеревались описать их клинические характеристики и исходы.

    Методы

    Мы ретроспективно проанализировали клинические данные 34 пациентов, перенесших плановые операции в период инкубации COVID-19 в больнице Жэньминь, больнице Чжуннань, больнице Тунцзи и центральной больнице в Ухане с 1 января по 5 февраля 2020 г.

    Результаты

    Из 34 оперированных пациентов средний возраст составлял 55 лет (IQR, 43–63), и 20 (58,8%) пациентов составляли женщины. У всех пациентов развилась пневмония COVID-19 вскоре после операции с отклонениями от нормы при компьютерной томографии грудной клетки.Общие симптомы включали лихорадку (31 [91,2%]), усталость (25 [73,5%]) и сухой кашель (18 [52,9%]). 15 (44,1%) пациентов потребовалась госпитализация в отделение интенсивной терапии (ОИТ) во время прогрессирования заболевания, а 7 пациентов (20,5%) умерли после поступления в ОИТ. По сравнению с пациентами, не получавшими ОИТ, пациенты ОИТ были старше, чаще имели сопутствующие заболевания, перенесли более сложные операции, а также имели более серьезные лабораторные отклонения (например, гиперлейкоцитемию, лимфопению). Наиболее частые осложнения у тех, кто не выжил, включали ОРДС, шок, аритмию и острую сердечную травму.

    Интерпретация

    В этом ретроспективном когортном исследовании 34 оперированных пациентов с подтвержденным COVID-19 15 (44,1%) пациентам потребовалось лечение в отделении интенсивной терапии, а уровень смертности составил 20,5%.

    Финансирование

    Национальный фонд естественных наук Китая.

    Ключевые слова

    COVID-19

    SARS-cov-2

    Хирургия

    Инкубационный период

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2020 Автор (ы). Опубликовано Elsevier Ltd.

    Рекомендуемые статьи

    Ссылки на статьи

    Корреляция между микроструктурными и магнитными свойствами наночастиц феррита шпинели, легированных Gd 3+

  • 1.

    S.W. Ли, К.С. Ким, Дж. Магн. Magn. Матер. 304 , ​​e418 (2006)

    ADS Статья Google Scholar

  • 2.

    G.S. Shahane, A. Kumar, M. Arora, R.P. Pant, K. Lal, J. Magn. Magn. Матер. 322 , ​​1015 (2010)

    ADS Статья Google Scholar

  • 3.

    М. Эльтабей, А. Massoud, C. Radu, J. Nanomater. 4

    , ​​1 (2014)

    Артикул Google Scholar

  • 4.

    С. Кумар, В. Сингх, С. Аггарвал, Великобритания, Мандал, Р.К. Котнала, Матер. Sci. Англ. B 166 , ​​76 (2010)

    Артикул Google Scholar

  • 5.

    C. Caizar, Mater. Sci. Англ. B 100 , ​​63 (2003)

    Артикул Google Scholar

  • 6.

    Z.Z. Минь Чжан, К. Лю, П. Чжан, X. Тан, X. Чжу, Ю. Сунь, Дж. Дай, адвокат. Матер. Sci. Англ. 609819 , ​​1–10 (2013)

    Google Scholar

  • 7.

    D. Carta, M.F. Casula, A. Falqui, D. Loche, G. Mountjoy, C. Sangregorio, A. Corrias, J. Phys. Chem. C 113 , ​​8606 (2009)

    Артикул Google Scholar

  • 8.

    R. Mohan, M.P. Гош, С. Мукерджи, Дж.Magn. Magn. Матер. 458 , ​​193–199 (2018)

    ADS Статья Google Scholar

  • 9.

    А. Аакаш, Д. Ройчоудхури, С. Дас, Мукерджи. Ceram. Int. 42 , ​​7742 (2016)

    Артикул Google Scholar

  • 10.

    С. Джоши, М. Кумар, С. Чокер, А. Кумар, М. Сингх, Дж. Магн. Magn. Матер. 426 , ​​252 (2017)

    ADS Статья Google Scholar

  • 11.

    S.K. Jacobo, S. Duhalde, H.R. Bertorello, J. Magn. Magn. Матер. 272 , ​​2253 (2004)

    ADS Статья Google Scholar

  • 12.

    Z.K. Хейба, М. Мохамед, Л. Арда, Н. Доган, Дж. Магн. Magn. Матер. 391 , ​​195 (2015)

    ADS Статья Google Scholar

  • 13.

    Б. Каур, М. Арора, А. Шанкар, А.К. Шривастава, Р.П. Пант, Advan.Матер. Lett. 3 , ​​399 (2012)

    Артикул Google Scholar

  • 14.

    A. Aakash, D. Roychowdhury, S.M. Дас, Дж. Сплав. Комп. 668 , ​​33 (2016)

    Артикул Google Scholar

  • 15.

    К.М. Бату, Д. Салах, Г. Кумар, А. Кумар, М. Сингх, М. Абд эль-Садек, Ф.А. Мир, А. Имран, Д.А. Джамиль, Дж. Магн. Magn. Матер. 411 , ​​91 (2016)

    ADS Статья Google Scholar

  • 16.

    Н.П. Aakash, R. Mohan, S. Mukherjee, J. Magn. Magn. Матер. 441 , ​​710 (2017)

    ADS Статья Google Scholar

  • 17.

    S.G. Kakade, R.C. Камбале, С.В. Раманн, Ю. Колекар, RSC Adv. 6 , ​​33308 (2016)

    Артикул Google Scholar

  • 18.

    A.M.M. Фареа, С. Кумар, К. Бату, А. Юсеф, К.Г. Ли, Алимуддин. J. Alloy. Комп. 464 , ​​361 (2008)

    Артикул Google Scholar

  • 19.

    П. Самойла, Л. Сакареску, А.И. Borhan, D. Timpu, M. Grigoras, N. Lupu, M. Zaltariov, V. Harabagiu, J. Magn. Magn. Матер. 378 , ​​92 (2015)

    ADS Статья Google Scholar

  • 20.

    X. Zhao, W. Wang, Y. Zhang, S. Wu, F. Li, P. Liu, Chem. Англ. J. 250 , ​​164 (2014)

    Статья Google Scholar

  • 21.

    В.К. Лахани, Т. Патак, Н.Х. Васоя, К.Б. Моди, Науки о твердом теле. 13 , ​​539 (2011)

    ADS Статья Google Scholar

  • 22.

    Р. Шарма, П. Такур, М. Кумар, П. Б. Бармен, П. Шарма, В. Шарма, Ceram. Int. 43 , ​​13661 (2017)

    Артикул Google Scholar

  • 23.

    З. Карими, Я. Мохаммадифар, Х. Шокроллахи, С.К. Асл, Дж. Юсефи, Л.Карими, Дж. Магн. Magn. Матер. 361 , ​​150 (2014)

    ADS Статья Google Scholar

  • 24.

    Г. Кумар, Дж. Шах, Р.К. Котнала, В. Сингх, Сарвина, Дж. Гарг, С.Э. Ширсат, К. Бату, М. Сингх, Mater. Res. Бык. 63 , ​​216 (2015)

    Артикул Google Scholar

  • 25.

    Р. Шарма, П. Такур, М. Кумар, Н. Такур, Н.С. Неги, П. Шарма, В.Шарма, Дж. Сплав. Комп. 684 , ​​569 (2016)

    Артикул Google Scholar

  • 26.

    Р. Кумар, М. Кар, Керам. Int. 42 , ​​6640 (2016)

    Артикул Google Scholar

  • 27.

    М.П. Ghosh, S. Mukherjee, J. Magn. Magn. Матер. 489 , ​​165320 (2019)

    Артикул Google Scholar

  • 28.

    А. Кумар, П. Шарма, Д. Варшней, Ceram. Int. 40 , ​​12855 (2014)

    Артикул Google Scholar

  • 29.

    Д. Варшней, К. Верма, Матер. Chem. Phys. 140 , ​​412 (2013)

    Артикул Google Scholar

  • 30.

    А. Самавати, М.К. Мустафа, А.Ф. Исмаил, M.H.D. Осман, М.А.Рахман, Mater. Экспресс 6 , ​​473 (2016)

    Артикул Google Scholar

  • 31.

    J.D. Baraliya, H.H. Joshi, Vib. Spectrosc. 74 , ​​75 (2014)

    Артикул Google Scholar

  • 32.

    А. Ахлават, В.Г. Sathe, J. Raman Spectrosc. 42 , ​​1087 (2011)

    ADS Статья Google Scholar

  • 33.

    M. Bini, C. Tondo, D. Capsoni, M.C. Моццати, Б. Альбини, П. Галинетто, Mater. Chem. Phys. 204 , ​​72 (2018)

    Артикул Google Scholar

  • 34.

    г. Рана, Калифорния Джоши, Дж. Сплав. Комп. 577 , ​​376 (2013)

    Артикул Google Scholar

  • 35.

    А. Кумар, М.А. Дар, П. Шарма, Д. Варшней, AIP Conf. Proc. 1591 , ​​1148 (2014)

    ADS Статья Google Scholar

  • 36.

    Дж. Чанд, Г. Кумар, П. Кумар, С.К. Шарма, М. Кнобель, М. Сингх, Дж. Сплав. Комп. 509 , ​​9638 (2011)

    Артикул Google Scholar

  • 37.

    Р.С. Ядав, И. Куритка, Я. Вилцакова, Я. Хавлица, Л. Калина, П. Урбанек, М. Маховский, Д. Шкода, М. Масар, М. Холек, Ультразвук. Sonochem 40 , ​​773 (2018)

    Артикул Google Scholar

  • 38.

    К.С. Рамакришна, Ч. Шринивас, Ч. Праджапат, С.С. Мина, М.В.К. Мехар, Д. Потукучи, Д. Састры, Керам. Int. 44 , ​​1193 (2018)

    Артикул Google Scholar

  • 39.

    С. Верма, Дж. Чанд, М. Сингх, Дж. Сплав. Комп. 679 , ​​358 (2016)

    Артикул Google Scholar

  • 40.

    С.Г. Гавас, С.С. Мина, П. Бхатт, В.М.С. Веренкар, Матер. Chem. Фронт. 2 , ​​300 (2018)

    Артикул Google Scholar

  • Влияние процесса гомогенизирующего отжига на микроструктуру и механические свойства литого магниевого сплава Mg-Gd-Y-Zr

    [1] ДИН Вэнь-цзян, ФУ Чжэн-и и ХУАН Ши-син.Магниевый сплав Наука и техника [M]. Пекин: Science Press, 2007. 121–126.

    [2] КАВАБАТА Т МАТСУДА К. Прогрессивные шаги в платформенной науке и технологии для усовершенствованных магниевых сплавов [J] Materials Science Forum , 2003, 419-422 : 3-12.

    [3] LUO A PEKGULERYUZ M O. Обзор литых магниевых сплавов для применения при повышенных температурах [J] Материаловедение , 1994,29 (12) 5271-5274.

    [4] ШАЛИНГ ПЕ Редкоземельные элементы в металлических материалах [J] Материаловедение , 1993 (1) 3-10.

    [5] ПЕН Цзянь, Чжан Дин-фэй, Ян Чун-мэй, ДИН Пэй-дао.Исследование гомогенизации слитка магниевого сплава ZK60 [J]. Материаловедение, 2004 (8) № 32-37.

    DOI: 10.4028 / 0-87849-968-7.341

    [6] KLEINER S BEFFORT O , UGGOWITZER P J Эволюция микроструктуры во время повторного нагрева экструдированного сплава Mg-Al-Zn до полутвердого состояния [J] Scripta Materialia , 2004–51 : 405-409.(c).

    DOI: 10.1016 / j.scriptamat.2004.05.010

    Проведение МРТ с усилением Gd ‑ EOB ‑ DTPA для диагностики узлов гепатоцеллюлярной карциномы 4 категории LI ‑ RADS с различным диаметром

    Введение

    Гепатоцеллюлярная карцинома (ГЦК) – глобальное заболевание проблема, и это основная причина смертности пациентов с циррозом печени. (1–3).Пациентам с циррозом печени настоятельно рекомендуется пройти рутинная визуализация печени для наблюдения за ГЦК (4). Согласно действующим рекомендациям, HCC может быть диагностированным с использованием типичных критериев визуализации, включая гиперваскуляризация в фазе печеночной артерии и вымывание в поздняя фаза динамической компьютерной томографии с контрастным усилением (КТ) и / или магнитно-резонансная томография (МРТ) (5–8). К улучшить согласованность визуализационной диагностики ГЦК, американский Колледж радиологии выпустил стандартизированную отчетность и данные система сбора данных, известная как система отчетов и данных визуализации печени (LI-RADS) в 2011 г. (9).Когда руководство было обновлено в 2014 г., гепатобилиарные контрастные вещества, включая гадоксетатную кислоту (Gd-EOB-DTPA) и гадобенат димеглумин (Gd-BOPTA) были включены в систему (10). Однако находки в гепатобилиарной фаза (HBP) – это дополнительные функции, которые можно применить для обновления или понизить категорию, используя правила разрешения конфликтов (11). Его можно использовать до LI-RADS 4, но не дальше (12).

    Недавно Chen et al (13) сообщили, что гипоинтенсивность АД может быть критерием, который может улучшить чувствительность LI-RADS при ГЦК. диагноз, при котором МРТ с усилением Gd-EOB-DTPA с визуализацией HBP и использовалась модифицированная версия LI-RADS 2014 года.Хотя LI-RADS важен для диагностики ГЦК (14), диагностическая эффективность МРТ с усилением Gd-EOB-DTPA в узелках разного диаметра не был адресован. Определение узелков категории LI-RADS 4 таково: наверное HCC. Самый важный фактор при диагностике очага Поражение печени необходимо для дифференциации LI-RAD категории 4 и 5 узелки, где категория 5 LI-RADS определенно соответствует HCC и LI-RADS категория 4 – вероятно, ГЦК (15). Таким образом, настоящее исследование направлено на оценку диагностических выполнение динамической МРТ с контрастным усилением Gd-EOB-DTPA LI-RADS 4 печеночных узелка разного диаметра.

    Материалы и методы
    Выбор пациентов

    Это ретроспективное исследование было одобрено Институциональный наблюдательный совет в соответствии с утвержденным рекомендации второй больницы Сянъя Центрального Юга Университет (Хунань, Китай) и соответствовал требованиям системы медицинского страхования Закон о переносимости и подотчетности (HIPAA). Письменное информирование согласие было получено от всех пациентов.

    Поиск в архиве изображений и коммуникации Системы (Вторая больница Сянъя Центрального Южного Университета) проводился с октября 2012 года по июнь 2016 года.Всего 778 пациенты с хроническим циррозом печени, перенесшие МРТ с усилением Gd-EOB-DTPA для обнаружения подозрения на печень Были зарегистрированы поражения. В качестве одного из основных критериев использования LI-RADS – это пациенты с циррозом печени, только были включены пациенты с циррозом печени (16). Критерии включения были следующие: i) Пациенты не получали местно-регионарную терапию, в том числе трансартериальная химиоэмболизация или радиочастотная абляция (РЧА), ii) размер узелков был ≤30 мм, iii) и количество узелков было ≤5 на МРТ.Каждому узелку была присвоена категория LI-RADS в соответствии с версия LI-RADS 2017 года: LI-RADS 1, определенно безвредная; LI-RADS 2, вероятно, доброкачественные; LI-RADS 3, промежуточная вероятность ГЦК; LI-RADS 4, вероятно, HCC, LI-RADS 5, определенно HCC, LI-RADS TIV, определенно опухоль в вене и LI-RADS M, вероятно, злокачественная, а не специфичен для ГЦК (17). Только LI-RADS В настоящее исследование были включены 4 узелка. После применения По критериям включения в исследование вошли 224 пациента. с 263 узелками.Исследуемая популяция состояла из 138 мужчин и 86 женщин в возрасте от 26 до 81 года и средним возрастом 53,3 ± 17,1 года.

    Техника МРТ

    МРТ было выполнено с использованием клинического 3,0 Тесла. сверхпроводящая МР-система (MAGNETOM Skyra; Siemens Healthineers, Эрланген, Германия) с 18-канальной корпусной матричной катушкой и встроенная 24-канальная матричная катушка. Комплексная МРТ протокол, включая T1-взвешенный градиент насыщения жира, вызванный последовательность эхо-сигналов и однократный сбор данных по полуфурье-взвешиванию по Т2 последовательность турбо спин-эхо, были получены до введения Gd-EOB-DTPA (Bayer Schering Pharma, Берлин, Германия).Динамический МРТ с контрастным усилением проводилась с использованием комбинации объемных интерполированное исследование задержки дыхания (VIBE) с контролируемым наложение спектров при параллельном отображении приводит к более высокому ускорению (CAIPIRINHA), совместное использование изображений с временным разрешением и чередованием стохастические траектории (TWIST), подавление жира по Диксону (CAIPIRINHA-Dixon-TWIST-VIBE и CDT-VIBE) в неусиленной фазе, артериальная фаза, портовенозная фаза (90 секунд), переходная фаза (180 секунд) и HBP (20 мин). Для того, чтобы то же самое фаза с контрастным усилением достигается у каждого пациента, МРТ автоматическая инжекторный насос использовался для введения Gd-EOB-DTPA через Локтевой внутривенный доступ 18 калибра в дозе 0.1 мл / кг тела вес и скорость введения 1 мл / сек. Параметры MR: перечислены в таблице I.

    Таблица I.

    Магнитно-резонансная последовательность параметры.

    Таблица I.

    Магнитно-резонансная последовательность параметры.

    угол поворота градус
    Параметры CDT-VIBE T2 HASTE
    TR / TE, мсек 3.8 / 1,2 2,000/80
    Подфазы 5 1
    Тип последовательности TWIST-VIBE HASTE
    Размер вокселя, мм 3 1,3 × 1,3 × 3,0 1,3 × 1,3 × 3,0
    FOV, мм 380 380
    Номер среза 72 72
    9 180
    Респираторный контроль Задержка дыхания Сработал
    Жир подавление Dixon Spectral насыщенность
    Временная разрешение, с 2.6
    TWIST размер k-center,% 20
    TWIST размер k-периферия,% 25
    Задержка дыхания время, с 20 10–15
    Анализ изображений

    Всего два радиолога с 20-летним стажем и 12-летний опыт визуализации печени случайным образом и независимо просмотрел все изображения. Оба радиолога не видели LI-RADS. категория и окончательный диагноз каждого узла.Основные критерии LI-RADS, включая паттерны усиления артериальной фазы, узелки диаметр, наличие или отсутствие смыва в воротной вене фаза, наличие или отсутствие капсулы и порог роста, были оценен. Из-за раннего улучшения паренхимы печени после введение Gd-EOB-DTPA, только фаза воротной вены гипоинтенсивность и непереходная фаза гипоинтенсивность была считается размытым внешним видом. Вспомогательные функции, которые благоприятствовали злокачественные новообразования, в том числе гипоинтенсивность переходной фазы, умеренно-умеренный Т2 гипер-интенсивность, ограниченная диффузия, мозаика архитектура, архитектура узелков в узелках, усиление короны и Также были рассмотрены внутриочаговые жировые отложения.Изображения были просмотрены независимо друг от друга, и диагностика каждого узелка проводилась в консенсус между двумя радиологами.

    Статистический анализ

    Статистический анализ выполнен с использованием программного обеспечения. SPSS (версия 20.0; IBM Corp., Армонк, Нью-Йорк, США). Каппа Коэна был проведен тест для оценки согласия между читателями Основные критерии LI-RADS, включая усиление артериальной фазы паттерны, наличие или отсутствие вымывания в воротной вене фаза, наличие или отсутствие капсул и паттерны усиления НВР.Коэффициент внутриклассовой корреляции (ICC) был использован для оценки соглашение между читателями об измерении диаметра конкреций. Согласие было классифицировано как плохое (K, 0–0,40), от удовлетворительного до хорошего (K, 0,40–0,75) или отлично (K,> 0,75). По результатам два радиолога, узелки диагностированы как вероятно или точно ГЦК были положительными результатами, и возможно или определенно не ГЦК узелки дали отрицательный результат. Чувствительность, специфичность, положительная прогностическая ценность (PPV) и отрицательная прогностическая ценность (NPV) для диагностики узелков ГЦК разного диаметра с помощью LI-RADS 4 были рассчитаны и выражены с достоверностью 95%. интервалы (CI).Уровень ложных срабатываний (FPR) также был рассчитано.

    Результаты
    Характеристики пациента

    Исследуемая популяция состояла из 138 мужчин и 86 человек. женщины в возрасте от 26 до 81 года и средним возрастом 53,3 ± 17,1 года. Из 263 узелков диаметр 173 HCC узелков 22,4 ± 7,1 мм. Диаметр 26 не злокачественных опухолей ГЦК. узелков составил 16,6 ± 6,5 мм, а диаметр оставшихся 64 доброкачественные узелки – 12,7 ± 4,3 мм. Узлы ГЦК были значительно больше по сравнению со злокачественными узелками без ГЦК (P <0.05) и доброкачественные узелки (P <0,05). В версии LI-RADS 2017 г. узелки, в первую очередь, на основе моделей усиления артериальной фазы (17). В соответствии с LI-RADS, данные по 263 конкрециям были разделены на два набора данных: Набор 1 (n = 86), которые содержат узелки с изо / гипоинтенсивностью в артериальной фаза (HCC, n = 42; без HCC, n = 44) и набор 2 (n = 177), которые содержат узелки с повышенной интенсивностью в артериальной фазе (ГЦК, n = 131; без ГЦК, n = 46). Типичный вид изображений наборов 1 и 2: обозначенные на фиг.1 и 2 соответственно. Из 86 узелков в наборе 1, 37 узелков были <20 мм в диаметре (набор 1А), и 49 узлов были Диаметром 20–30 мм (комплект 1Б). Из 177 узелков в наборе 2 68 узелки были <10 мм в диаметре (набор 2А), и 73 узелка были Диаметром 10–19 мм (комплект 2В). Еще 36 узелков были размером 20–30 мм. по диаметру (комплект 2С). Подробная информация указана в Таблица II.

    Таблица II.

    Клиническая характеристика 263 узелки.

    Таблица II.

    Клиническая характеристика 263 узелки.

    Переменные Всего (n = 263)
    Диаметр узелки, мм
    ГЦК 22,4 ± 7,1
    Без ГЦК злокачественная опухоль 16,6 ± 6,5
    Доброкачественные 12,7 ± 4,3
    Количество узелков, HCC / без HCC
    Набор 1 42/44
    Набор 1A 15/22
    Комплект 1B 27/22
    Набор 2 131/46
    Набор 2A 50/18
    Комплект 2B 53/20
    Комплект 2C 28/8
    Соглашение между читателями между двумя рецензенты

    Тест Каппа Коэна и ICC показали, что согласование между читателями основных критериев LI-RADS и HBP качество изображения варьировалось от удовлетворительного до хорошего и отличного.В частности, измерения диаметра конкреций показали отличное согласие между визуализацией LI-RADS и HBP со значением ICC 0,951. Другой характеристики, включая паттерны усиления АД, артериальную фазу образцы усиления и наличие или отсутствие вымывания, выставленные отличное согласие между читателями со значениями K 0,937, 0,814 и 0,762 соответственно. Наконец, наличие или отсутствие капсулы показывает хорошее или хорошее соответствие со значением K 0,681.

    Окончательный диагноз узелков

    Каждый из 263 узелков у 224 пациентов был окончательно диагностирован как ГЦК (173 узла у 146 пациентов) или без ГЦК (90 узлов у 78 пациентов).90 узелков без ГЦК были в дальнейшем был поставлен следующий диагноз: диспластические узелки высокой степени злокачественности (HGDN), 22 узелка у 22 пациентов; диспластические узелки низкой степени злокачественности (LGDN), 16 узелки у 16 ​​пациентов; регенеративные узелки, 14 узелков в 13 пациенты; метастазы в печень, 14 узелков у 9 пациентов; атипичный гемангиома – 7 узелков у 6 больных; атипичный внутрипеченочный холангиокарцинома – 10 узлов у 7 пациентов; комбинированный холангиокарцинома / ГЦК (cHCC-CCCs), 2 узла у 2 пациентов и гепатоцеллюлярная аденома, 5 узлов у 3 больных.Финал Диагноз узелков был поставлен на основании гистологического исследования. (хирургическая резекция, n = 23; биопсия, n = 161), срок наблюдения> 12 мес. (n = 9) или рецидив / метастаз опухоли после лечения (n = 70). Из 173 узелка ГЦК, 108 узлов подтверждены гистологическими исследованиями (хирургическая резекция, n = 13; биопсия, n = 95), при этом появилось 65 узелков во время рецидива опухоли после лечения. Из 90 не-ГЦК узелки, 76 узелков подтверждены гистологическим подтверждением (хирургическим резекция, n = 10; биопсия, n = 66), 9 узелков стабильного размера во время наблюдения, а во время опухоли появилось 5 узелков. рецидив / метастаз после лечения.Схема исследования Население показано на рис. 3.

    Диагностическое исполнение в каждом подгруппа

    На основании окончательной диагностики всех 263 узлов диагноз 123 узелков был истинно положительным (TP), 40 узелков были ложноположительный (FP) и 50 узелков были ложноотрицательными (FN) Результаты. Остальные 50 узелков дали истинно отрицательные (TN) результаты. Подробные результаты приведены в Таблице III.

    Таблица III.

    Результаты конкреций согласно окончательный диагноз.

    Таблица III.

    Результаты конкреций согласно окончательный диагноз.

    4 906
    Группы TP FP FN TN
    Набор 1A, n 9 14 5 8 20 9 7 13
    Набор 2A, n 31 9 19 9
    Набор 2B, n 6 7 9066 9066 9066 9066 906 9 13
    Set 2C, n 26 1 2 7
    Все население, n 123 40 50 50

    Для диагностики ГЦК чувствительность, специфичность, PPV и NPV МР, усиленного Gd-EOB-DTPA, для всего исследуемое население было 71.1% (95% ДИ, 63,6–77,6), 55,6% (95% ДИ, 44,7–65,9), 75,5% (95% ДИ, 68,0–81,7) и 50% (95% ДИ, 39,9–60,1), соответственно. Для набора 1B чувствительность, специфичность, PPV и NPV. были 74,1% (20/27), 59,1% (13/22), 69,0% (20/29) и 65,0% (13/20), соответственно. Для набора 2C чувствительность, специфичность, PPV и NPV. были 92,8% (26/28), 87,5% (7/8), 96,3% (26/27) и 77,8% (7/9), соответственно. При диагностическом исполнении набора 1 и набора 2 сравнивался, набор 2 показал относительно более высокую чувствительность, специфичность, PPV и NPV по сравнению с набором 1 в каждой подгруппе.В диагностическая эффективность МРТ узелков с усилением Gd-EOB-DTPA различные диаметры в наборе 1 и наборе 2 сведены в Таблицу IV. Для FPR узелки в наборе 2C показал самый низкий FPR во всех подгруппах (12,5%, 1/8). МРТ Изображение ложноположительного результата показано на рис. 4.

    Таблица IV.

    Диагностическая характеристика МРТ с усилением Gd-EOB-DTPA для узелков LI-RADS 4.

    Таблица IV.

    Диагностическая характеристика МРТ с усилением Gd-EOB-DTPA для узелков LI-RADS 4.

    Набор 1,% (95% CI) Набор 1B,% Набор 2A,% Набор 2B,% Набор 2C,%
    Чувствительность 60,0 (32,9–82,5) 74,1 (53,4–88,1) 62,0 (47,2–75,0) 69,8 (55,5–81,3) 92,8 (75,0–98,7)
    Специфичность 36.4 (18,0–59,1) 59,1 (36,7–78,5) 50,0 (26,8–73,2) 65,0 (40,9–83,7) 87,5 (46,7–99,3)
    PPV 39,1 (20,5–61,2) 69,0 (49,0–84,0) 77,5 (66,1–88,6) 84,1 (69,3–92,8) 96,3 (79,1–99,8)
    NPV 57,1 (29,6–81,2) 65,0 (40,9–83,7) 32,1 (16,6–52,4) 44,8 (26,9–64,0) 77,8 (40,2–96,0)
    Обсуждение

    Небольшие поражения печени сложнее охарактеризовать.Несколько исследований показали, что небольшие внутрипеченочные холангиокарцинома, гемангиома и метастазы могут имитировать характеристики усиления ГЦК (18–20). В отличие от категории LI-RADS 5, которая имеет низкое значение отсечки для диаметр (1 см), LI-RADS 4 применяет такую ​​же высокую вероятность ГЦК при поражениях разного размера, в том числе диаметром <1 см. Неясно, является ли уровень злокачественности и прогнозируемый способность LI-RADS 4 должна применяться к маленьким (<2 см) и большим поражения (> 2 см) или специфические особенности, такие как сочетание гипоинтенсивности АД и артериальной фазы гиперусиление может предоставить средства для улучшения специфичность.

    Результаты показали, что MR, усиленный Gd-EOB-DTPA обеспечивает более высокую диагностическую эффективность для узелков большего размера (> 2 см), чем меньшего размера (<2 см). В предыдущем исследовании диагноз ГЦК, Chen et al (13) показали, что гипоинтенсивность HBP была главный критерий LI-RADS, который может обеспечить чувствительность, специфичность, PPV и NPV 95, 96, 99 и 87% соответственно. В результаты настоящего исследования отличаются от результатов Chen et al. al (13). В данном исследовании, диагностическая эффективность достигает значений, указанных в Чен и др. (13), но только для узелки диаметром 20–30 мм с чувствительностью, специфичностью, PPV и NPV 92.8, 87,5, 96,3 и 77,8% соответственно. Различия в критериях включения, использованных в двух исследованиях, могут учитывать это несоответствие. Исследование Chen et al. (13) включены ЛИ-РАДС 1–5 категории узелки, в то время как только узелки категории LI-RADS 4 включены в настоящее исследование, которое может повлиять на чувствительность и специфичность расчет. Примечательно, что предыдущее исследование, проведенное Darnell et al. al (21) показал, что в пациентов с циррозом печени для диагностики ГЦК, результаты МРТ Узелки категории LI-RADS 4 и 5 имеют чувствительность 65.4% и специфичность 98,2%. Однако значение чувствительности в настоящее время исследование выше, чем значение, указанное Darnell et al. (21) (92,8% против 65,4%). Наоборот, специфичность ниже в настоящем исследовании (87,5% против 98,2%), что может быть связано с разными контрастными веществами, используемыми в двух исследования (Gd-EOB-DTPA против гадодиамида.

    Мы проанализировали FPR, чтобы определить, какие типы узелков было легче ошибочно диагностировано как ГЦК. Было обнаружено, что узелки диаметром 20–30 мм с гиперваскулярным рисунком самый низкий FPR (12.5%, 1/8). Однако для узелков диаметром <10 мм, FPR достигала 63,6% (14/22). Хотя у него есть Сообщалось, что МРТ с усилением Gd-EOB-DTPA способна обнаруживать гиповаскулярные поражения (22–24), узелки с усилением артериальной фазы остается основным элементом для HCC. Один из основных ложных срабатываний Результатом для гиповаскулярных узлов является диспластический узел. Высокий HGDN, в начальной фазе канцерогенеза может проявляться как гипоинтенсивность в артериальной фазе с постепенным усилением портальная венозная фаза из-за наличия портальной перфузии (25).С увеличением внутриузловая артериальная васкуляризация, паттерн усиления для HGDN имеет тенденцию к гиперваскуляризации (26). Это основная причина того, что HGDN имитировал HCC в настоящем исследовании. Другой главный ложноположительный Результат - внутрипеченочная холангиокарцинома. Сообщается что наиболее частый паттерн усиления внутрипеченочного холангиокарцинома в нормальной печени представляет собой тонкий периферический ободок с внутреннее неоднородное усиление во время динамической фазы (27). Однако внутрипеченочный холангиокарцинома у пациентов с циррозом печени или без него может различаются паттерном усиления (28).У пациентов с циррозом печени, внутрипеченочной холангиокарциномой. часто характеризуется как стабильный паттерн усиления, особенно для узелков <20 мм в диаметре (29,30). В настоящее исследование, большинство внутрипеченочных холангиокарцином случаи представляют собой образец улучшения, аналогичный предыдущим исследованиям (31). Гемангиома - еще одна заметная ложноположительный результат. Типичный образец улучшения для гемангиома - это отложенная фаза усиления внеклеточного контраста визуализация на основе агентов (32).Однако предыдущие исследования сообщают, что признак «псевдосмыва» может наблюдаться при гемангиоме во время переходной фазы с помощью Gd-EOB-DTPA в качестве контрастного агента, вероятно, благодаря отличным контраст печени и поражения по сравнению с внеклеточным контрастом агент (33,34). В настоящем исследовании «псевдосмывание» знак также наблюдается в некоторых случаях. Этот ложный вид может привести к ошибочной диагностике ГЦК. Во избежание ошибочного диагноза только гипоинтенсивность в фазе воротной вены рассматривалась как «Вымывание».

    В настоящем исследовании есть несколько ограничений. Во-первых, поскольку исследование проводилось ретроспективно, возможно, систематическая ошибка отбора в исследуемой популяции. Кроме того, исследование выборка была относительно небольшой, что могло привести к статистической ошибке. Во-вторых, не было получено гистологического подтверждения диагноза ГЦК. для всей исследуемой популяции, особенно для доброкачественных узлов, включая гемангиому и аденому, которые были диагностированы клиническими особенности наблюдения и изображения (35).Клинические диагностические справки, включая рецидив опухоли после лечения, может быть неадекватным для диагностики ГЦК. Таким образом, проспективное исследование с большим размер образца и гистологические доказательства для всех узелков должны быть выполнено в будущем. Кроме того, возможности визуализации узелки разного диаметра не оценивались. Дальше исследования могут быть сосредоточены на этом вопросе. Наконец, приемник работает характеристические кривые не использовались для оценки диагностических выполнение МРТ с усилением Gd-EOB-DTPA для категории LI-RADS 4 узелки, так как этот метод часто используется для непрерывных переменных (36).

    В заключение, МРТ с усилением Gd-EOB-DTPA полезна. для диагностики узлов HCC LI-RADS 4 категории. Тем не менее диагностические характеристики МРТ с усилением Gd-EOB-DTPA для LI-RADS 4 Категория узелков разного диаметра непостоянна. Для гиперваскулярные узелки LI-RADS 4 категории диаметром> 20 мм, МРТ с усилением Gd-EOB-DTPA полезна для диагностики ГЦК. Однако для гиповаскулярных узлов LI-RADS 4 категории диаметром <20 мм, МРТ с усилением Gd-EOB-DTPA может иметь ограниченное применение из-за низкая диагностическая эффективность и высокий FPR.

    Благодарности

    Не применимо.

    Финансирование

    Финансирование получено не было.

    Наличие данных и материалов

    Наборы данных, использованные и / или проанализированные в текущем исследования доступны у соответствующего автора на разумных запрос.

    Авторские взносы

    QT и CM проанализировали и интерпретировали данные пациента. КМ внес большой вклад в написание рукописи и согласился нести ответственность за все аспекты работы, чтобы вопросы относящиеся к точности или целостности любой части работы, должным образом расследованы и решены.Все авторы читают и одобрил окончательный вариант рукописи.

    Утверждение этических норм и согласие на участвовать

    Это ретроспективное исследование было одобрено Институциональный наблюдательный совет в соответствии с утвержденным рекомендации от Второй больницы Сянъя на центральном юге Университет (Хунань, Китай) и соответствовал требованиям системы медицинского страхования Закон о переносимости и подотчетности (HIPAA).

    Согласие на публикацию

    Письменное информированное согласие было получено от всех пациенты.

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересы.

    Глоссарий
    Сокращения
    Сокращения:

    MR

    магнитный резонанс

    LI-RADS

    Отчеты и данные визуализации печени Система

    HCC

    гепатоцеллюлярная карцинома

    PPV

    положительная прогностическая ценность

    ЧПС

    отрицательное прогнозное значение

    FPR

    частота ложных срабатываний

    CT

    компьютерная томография

    Gd-EOB-DTPA

    гадоксетатная кислота

    HBP

    гепатобилиарная фаза

    RFA

    радиочастотная абляция

    ICC

    коэффициент внутриклассовой корреляции

    HGDN

    диспластических узелка высокой степени

    LGDN

    Диспластические узелки низкой степени злокачественности

    cHCC-CCC

    комбинированная холангиокарцинома и гепатоцеллюлярная карцинома

    TP

    истинно положительный

    FP

    ложное срабатывание

    FN

    ложноотрицательный

    TN

    истинно отрицательное

    Список литературы

    1

    Пурыско А.С., Ремер Э.М., Коппа С.П., Леао Х.М., Thupili CR и Veniero JC: LI-RADS: анализ нового категоризация показателей печени у пациентов с терминальной стадией печени болезнь.Рентгенография. 32: 1977–1995. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

    2

    Уоллес М.С., Прин Д., Джеффри Г.П. и Адамс ЛА: Развитие эпидемиологии гепатоцеллюлярной карциномы: глобальный перспектива. Эксперт Рев Гастроэнтерол Гепатол. 9: 765–779. 2015.PubMed / NCBI

    3

    Ян М., Ха Дж, Агилар М., Бхукет Т., Лю Б., Gish RG, Cheung R и Wong RJ: когортные различия по рождению в стадия гепатоцеллюлярной карциномы при диагностике, лечении и долгосрочное выживание.J Hepatol. 64: 326–332. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

    4

    Гольдберг Д.С., Вальдеррама А., Камалакар Р., Сансгири С.С., Бабаджанян С. и Льюис Дж. Д.: Гепатоцеллюлярная карцинома. наблюдение за пациентами с циррозом печени, имеющими коммерческое здоровье страхование. J Clin Gastroenterol. 50: 258–265. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

    5

    Bruix J и Sherman M: Управление гепатоцеллюлярная карцинома: обновление.Гепатология. 53: 1020–1022. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    6

    Давенпорт М.С., Халатбари С., Лю П.С., Зрелен К.Е., Каза Р.К., Васник А.П., Аль-Хавари М.М., Глейзер Д.И., Стейн Э.Б., Патель Дж. И др.: Повторяемость диагностических функций и оценок. системы для гепатоцеллюлярной карциномы с использованием МРТ. Радиология. 272: 132–142. 2014. Просмотр статьи: Google Scholar: PubMed / NCBI

    7

    Леони С, Пискалья Ф, Гольфьери Р, Камаджи V, Vidili G, Pini P и Bolondi L: Влияние сосудистых и несосудистые данные по неинвазивной диагностике малых гепатоцеллюлярная карцинома по критериям EASL и AASLD.Am J Гастроэнтерол. 105: 599–609. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    8

    Халили К., Ким Т.К., Джанг Х.Дж., Хайдер М.А., Хан Л., Гуинди М. и Шерман М.: Оптимизация визуализации диагностики гепатоцеллюлярной карциномы 1-2 см: анализ диагностических производительность и использование ресурсов. J Hepatol. 54: 723–728. 2011 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    9

    Сантильян Ц., Черняк В и Сирлин Ц .: Категории LI-RADS: концепции, определения и критерии.Живот Радиол (Нью-Йорк). 43: 101–110. 2018. Просмотр статьи: Google Scholar: PubMed / NCBI

    10

    Сантильян К., Фаулер К., Коно Ю. и Черняк V: Основные функции LI-RADS: КТ, МРТ с внеклеточными агентами и МРТ с гепатобилиарными препаратами. Abdom Radiol (Нью-Йорк). 43: 75–81. 2018. Просмотр статьи: Google Scholar: PubMed / NCBI

    11

    Ча Ди, Чан К.М., Ким Ш., Кан Т.В. и Сон KD: Система отчетов и данных визуализации печени на КТ и гадоксетике кислотно-усиленная МРТ с диффузионно-взвешенной визуализацией.Eur Radiol. 27: 4394–4405. 2017. Просмотр статьи: Google Scholar: PubMed / NCBI

    12

    Граната V, Фуско Р, Аваллоне А, Каталано О, Филиче Ф., Леонгито М., Палая Р., Иззо Ф. и Петрилло А.: Майор и дополнительные функции магнитного резонанса LI-RADS для оценки HCC: An обзор и обновление. Заражение агентурным раком. 12: 232017. Просмотр статьи: Google Scholar: PubMed / NCBI

    13

    Чен Н.Х., Мотосуги У., Морисака Х., Итикава. С, Сано К., Итикава Т., Мацуда М., Фуджи Х. и Ониши Х.: добавленная стоимость изображения фазы гепатоцитов, усиленного гадоксетовой кислотой, на LI-RADS система диагностики гепатоцеллюлярной карциномы.Magn Reson Med Sci. 15: 49–59. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

    14

    Абд Алхалик Баша М., Абд Эль, Азиз Эль, Саммак Д. и Эль Саммак А.А.: Диагностическая эффективность печени система визуализации, отчетов и данных (LI-RADS) с компьютерной томографией в классификация небольших узелков (10–20 мм), обнаруженных при циррозе печень при скрининговом УЗИ. Clin Radiol. 72: 901.e1–901.e11. 2017. Просмотр статьи: Google Scholar

    15

    Митчелл Д.Г., Брюкс Дж., Шерман М. и Сирлин CB: LI-RADS (Система отчетов и данных визуализации печени): Резюме, обсуждение и консенсус рабочей группы по управлению LI-RADS и будущие направления.Гепатология. 61: 1056–1065. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

    16

    Santillan CS, Tang A, Cruite I, Shah A и Сирлин CB: Понимание LI-RADS: Праймер для практического использования. Magn Reson Imaging Clin N Am. 22: 337–352. 2014. Просмотр статьи: Google Scholar: PubMed / NCBI

    17

    Эльсайес К.М., Хукер Дж.С., Агронс М.М., Килар А.З., Тан А., Фаулер К.Дж., Черняк В., Башир М.Р., Коно Ю., До РК и др.: Версия LI-RADS для КТ и МРТ 2017: обновление.Рентгенография. 37: 1994–2017. 2017. Просмотр статьи: Google Scholar: PubMed / NCBI

    18

    Цянь Х, Ли С., Джи М и Линь Джи: МРТ характеристики для дифференциальной диагностики доброкачественных и злокачественные небольшие одиночные гиповаскулярные узелки в печени. Eur J Gastroen Hepat. 28: 749–756. 2016. Просмотр статьи: Google Scholar

    19

    Joo I, Lee JM, Lee SM, Lee JS, Park JY и Хан Дж.К .: Диагностическая точность отчетов и данных визуализации печени система (LI-RADS) v2014 для внутрипеченочного массообразования холангиокарциномы у пациентов с хроническим заболеванием печени на МРТ с усилением гадоксетовой кислоты.J. Магнитно-резонансная томография. 76: 1330–1338. 2016. Просмотр статьи: Google Scholar

    20

    Motosugi U, Ichikawa T, Onohara K, Sou H, Сано К., Мухи А. и Араки Т.: отличить метастазы в печени от гемангиома с использованием магнитного резонанса, усиленного гадоксетовой кислотой изображения. Invest Radiol. 46: 359–365. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    21

    Дарнелл А., Форнер А., Римола Дж., Рейг М., Garcia-Criado A, Ayuso C и Bruix J: отчеты о визуализации печени и информационная система с МРТ: оценка в узелках 20 мм или меньше обнаружен при циррозе печени при скрининговом УЗИ.Радиология. 275: 698–707. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

    22

    Ди Пьетропаоло М., Бриани С., Федеричи Г.Ф., Marignani M, Begini P, Delle Fave G и Iannicelli E: Сравнение диффузионно-взвешенная визуализация и МР-изображения с усилением гадоксетовой кислоты в оценка гепатоцеллюлярной карциномы и гиповаскулярной гепатоцеллюлярные узелки. Clin Imag. 39: 468–475. 2015. Просмотр статьи: Google Scholar

    23

    Мотосуги У, Баннас П, Сано К. и Ридер SB: МР-контрастные вещества гепатобилиарной системы при гиповаскулярной гепатоцеллюлярной карцинома.J. Магнитно-резонансная томография. 41: 251–265. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

    24

    Итикава С., Итикава Т., Мотосуги У., Сано К., Морисака Х., Эномото Н., Мацуда М., Фуджи Х. и Араки Т.: Присутствие гиповаскулярного узелка печени, демонстрирующего пониженную интенсивность изображение гепатоцитарной фазы является фактором риска гиперваскулярного гепатоцеллюлярная карцинома. J. Магнитно-резонансная томография. 39: 293–297. 2014 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    25

    Golfieri R, Renzulli M, Lucidi V, Corcioni B, Trevisani F и Bolondi L: Вклад гепатобилиарной от фазы МРТ с усилением Gd-EOB-DTPA до динамической МРТ при обнаружении гиповаскулярной мелкой (<= 2 см) ГЦК при циррозе печени.Eur Radiol. 21: 1233–1242. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    26

    Quaia E, de Paoli L, Pizzolato R, Angileri Р., Пантано Э., Деграсси Ф., Укмар М. и Кова М.А.: Предсказатели диагностика диспластических узлов у пациентов с циррозом печени на МРТ с усилением димеглумина и гадобенатом с динамическим и гепатобилиарная фаза. AJR Am J Roentgenol. 200: 553–562. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

    27

    Кан И, Ли Дж. М., Ким Ш., Хан Дж. К. и Чой BI: Внутрипеченочная холангиокарцинома с массообразованием: усиление паттерны на МР-изображениях, усиленных гадоксетовой кислотой.Радиология. 264: 751–760. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

    28

    Сюй Дж., Игараси С., Сасаки М., Мацубара Т., Йонеда Н, Козака К., Икеда Х, Ким Дж., Ю Э, Мацуи О и другие: Внутрипеченочные холангиокарциномы при циррозе являются гиперваскулярными в сравнение с таковыми в нормальной печени. Liver Int. 32: 1156–1164. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

    29

    Римола Дж., Форнер А., Рейг М., Вилана Р., де Lope CR, Ayuso C и Bruix J: Холангиокарцинома при циррозе печени: Отсутствие размытия контраста в задержанных фазах по магнитному резонансу визуализация позволяет избежать ошибочного диагноза гепатоцеллюлярной карциномы.Гепатология. 50: 791–798. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    30

    Joo I, Lee JM, Lee DH, Jeon JH, Han JK и Чой Б.И.: Неинвазивная диагностика гепатоцеллюлярной карциномы на МРТ с усилением гадоксетовой кислоты: возможна гипоинтенсивность гепатобилиарной фазу использовать как альтернативу вымыванию? Eur Radiol. 25: 2859–2868. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

    31

    Loyer EM, Chin H, DuBrow RA, David CL, Эфтехари Ф. и Чарнсангавей С: гепатоцеллюлярная карцинома и внутрипеченочная периферическая холангиокарцинома: паттерны усиления с четырехфазной спиральной КТ – сравнительное исследование.Радиология. 212: 866–875. 1999. Просмотр статьи: Google Scholar: PubMed / NCBI

    32

    Госима С, Канэмацу М, Кондо Х, Йокояма Р., Кадзита К., Цуге Й., Ширатори Й., Онозука М. и Морияма Н.: Гемангиома печени: корреляция типов усиления с результаты МРТ, взвешенные по диффузии, и кажущиеся коэффициенты диффузии. Eur J Radiol. 70: 325–330. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    33

    Татэяма А, Фукукура Й, Такуми К., Синдо T, Kumagae Y и Nakamura F: Гемангиомы печени: факторы ассоциирован с псевдосмываемым признаком на МРТ с усилением Gd-EOB-DTPA изображения.Magn Reson Med Sci. 15: 73–82. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

    34

    Ким Би, Бён Дж. Х., Ким Х. Дж., Вон Х. Дж., Ким С. И., Шин Ю.М. и Ким П.Н.: паттерны улучшения и псевдо-размывание гемангиомы печени на МРТ печени с гадоксетатом динатрия. Евро Радиол. 26: 191–198. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

    35

    Грациоли Л, Амброзини Р, Фриттоли Б, Грациоли М и Моронье М: первичные доброкачественные поражения печени.Eur J Радиол. 95: 378–398. 2017. Просмотр статьи: Google Scholar: PubMed / NCBI

    36

    Кумар Р. и Индраян А.: Приемник работает характеристическая кривая (ROC) для исследователей-медиков. Indian Pediatr. 48: 277–287. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    Разработка терапевтических антител для лечения заболеваний | Журнал биомедицинских наук

  • 1.

    Колер Г., Мильштейн К.Непрерывные культуры слитых клеток, секретирующих антитела заданной специфичности. Природа. 1975; 256: 495–7.

    CAS PubMed Статья PubMed Central Google Scholar

  • 2.

    Kaplon H, Reichert JM. Антитела, за которыми нужно следить в 2019 году. МАб. 2019; 11: 219–38.

    CAS PubMed Статья PubMed Central Google Scholar

  • 3.

    Общество антител.В: Утвержденные антитела. 27 июня 2019 г. https://www.antibodysociety.org/ По состоянию на 15 июля 2019 г.

  • 4.

    Lefranc MP. IMGT, Международная информационная система ImMunoGeneTics. Cold Spring Harb Protoc. 2011; 2011: 595–603.

    PubMed PubMed Central Google Scholar

  • 5.

    Эккер Д.М., Джонс С.Д., Левин Х.Л. Рынок терапевтических моноклональных антител. MAbs. 2015; 7: 9–14.

    CAS PubMed Статья PubMed Central Google Scholar

  • 6.

    Моррисон С.Л., Джонсон М.Дж., Герценберг Л.А., Ой VT. Молекулы химерных антител человека: мышиные антигенсвязывающие домены с доменами константной области человека. Proc Natl Acad Sci U S. A. 1984; 81: 6851–5.

    CAS PubMed PubMed Central Статья Google Scholar

  • 7.

    Foster RH, Wiseman LR. Абциксимаб. Обновленный обзор его использования при ишемической болезни сердца. Наркотики. 1998. 56: 629–65.

    CAS PubMed Статья PubMed Central Google Scholar

  • 8.

    Мэлони Д.Г., Грилло-Лопес А.Дж., Уайт Калифорния, Бодкин Д., Шильдер Р.Дж., Нейдхарт Дж.А. и др. Терапия моноклональными антителами к CD20 IDEC-C2B8 (ритуксимаб) у пациентов с рецидивом неходжкинской лимфомы низкой степени злокачественности. Кровь. 1997; 90: 2188–95.

    CAS PubMed Статья PubMed Central Google Scholar

  • 9.

    Мэлони Д.Г., Грилло-Лопес А.Дж., Бодкин Д.Д., Уайт К.А., Лайлз Т.М., Ройстон И. и др. IDEC-C2B8: результаты фазы I исследования множественных доз у пациентов с рецидивом неходжкинской лимфомы.J Clin Oncol. 1997; 15: 3266–74.

    CAS PubMed Статья PubMed Central Google Scholar

  • 10.

    Jones PT, Dear PH, Foote J, Neuberger MS, Winter G. Замена определяющих комплементарность областей в человеческом антителе на области, полученные от мыши. Природа. 1986; 321: 522–5.

    CAS PubMed Статья Google Scholar

  • 11.

    Цурушита Н., Хинтон ПР, Кумар С.Дизайн гуманизированных антител: от anti-Tac до Zenapax. Методы. 2005. 36: 69–83.

    CAS PubMed Статья Google Scholar

  • 12.

    Уотьер Х., Райхерт Дж. Эволюция терапевтических средств с использованием антител. В: Воан Т., Осборн Дж., Джаллал Б., редакторы. Белковая терапия. Вайнхайм: Wiley-VCH Verlag GmbH & Co, KGaA; 2017. с. 25–49.

    Глава Google Scholar

  • 13.

    Маккафферти Дж., Гриффитс А. Д., Винтер Дж., Чисвелл Д. Д.. Фаговые антитела: нитчатый фаг, демонстрирующий вариабельные домены антител. Природа. 1990; 348: 552–4.

    CAS PubMed Статья Google Scholar

  • 14.

    Smith GP. Нитевидный слитый фаг: новые векторы экспрессии, которые отображают клонированные антигены на поверхности вириона. Наука. 1985; 228: 1315–7.

    CAS PubMed Статья Google Scholar

  • 15.

    Wu CH, Liu IJ, Lu RM, Wu HC. Развитие и применение технологии пептидного фагового дисплея в биомедицине. J Biomed Sci. 2016; 23: 8.

    PubMed PubMed Central Статья CAS Google Scholar

  • 16.

    Кемпени Дж. Предварительные результаты ранних клинических испытаний полностью человеческого моноклонального антитела против TNFalpha D2E7. Ann Rheum Dis. 1999; 58 (Дополнение 1): I70–2.

    CAS PubMed PubMed Central Статья Google Scholar

  • 17.

    Бартлетт Б.Л., Тайринг, СК. Устекинумаб при хроническом бляшечном псориазе. Ланцет. 2008; 371: 1639–40.

    PubMed Статья Google Scholar

  • 18.

    Church LD, McDermott MF. Канакинумаб, полностью человеческое mAb против IL-1beta для потенциального лечения воспалительных заболеваний. Curr Opin Mol Ther. 2009; 11: 81–9.

    CAS PubMed Google Scholar

  • 19.

    Zhou H, Jang H, Fleischmann RM, Bouman-Thio E, Xu Z, Marini JC, et al.Фармакокинетика и безопасность голимумаба, полностью человеческого моноклонального антитела против TNF-альфа, у субъектов с ревматоидным артритом. J Clin Pharmacol. 2007. 47: 383–96.

    CAS PubMed Статья Google Scholar

  • 20.

    Coiffier B, Lepretre S, Pedersen LM, Gadeberg O, Fredriksen H, van Oers MH, et al. Безопасность и эффективность офатумумаба, полностью человеческого моноклонального анти-CD20-антитела, у пациентов с рецидивирующим или рефрактерным B-клеточным хроническим лимфолейкозом: исследование 1-2 фазы.Кровь. 2008; 111: 1094–100.

    CAS PubMed Статья Google Scholar

  • 21.

    Редди Г.К., Надлер Э., Джайн В.К. Деносумаб (AMG 162), полностью человеческое моноклональное антитело против активности лиганда RANK. Поддержка рака Ther. 2005; 3: 14–5.

    CAS PubMed Статья Google Scholar

  • 22.

    Morse MA. Оценка технологии: ипилимумаб, Medarex / Bristol-Myers Squibb.Curr Opin Mol Ther. 2005; 7: 588–97.

    CAS PubMed Google Scholar

  • 23.

    Wolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, et al. Ниволумаб плюс ипилимумаб при запущенной меланоме. N Engl J Med. 2013; 369: 122–33.

    CAS PubMed PubMed Central Статья Google Scholar

  • 24.

    Рот Е.М., Диллер П. Алирокумаб для гиперлипидемии: физиология ингибирования PCSK9, фармакодинамика и результаты клинических испытаний фазы I и II моноклонального антитела против PCSK9.Futur Cardiol. 2014; 10: 183–99.

    CAS Статья Google Scholar

  • 25.

    де Веерс М., Тай Ю.Т., ван дер Вир М.С., Баккер Дж.М., Винк Т., Якобс Д.К. и др. Даратумумаб, новое терапевтическое моноклональное антитело человека к CD38, вызывает уничтожение множественной миеломы и других гематологических опухолей. J Immunol. 2011; 186: 1840–8.

    PubMed Статья CAS Google Scholar

  • 26.

    Хираяма А., Хонарпур Н., Йошида М., Ямасита С., Хуанг Ф., Вассерман С.М. и др. Эффекты эволокумаба (AMG 145), моноклонального антитела к PCSK9, у пациентов с гиперхолестеринемией, принимающих статины, с высоким сердечно-сосудистым риском – основные результаты исследования YUKAWA 2 фазы. Circ J. 2014; 78: 1073–82.

    CAS PubMed Статья Google Scholar

  • 27.

    Чиоато А., Нозеда Э, Стивенс М., Гайтацис Н., Кляйншмидт А., Пико Х.Лечение блокирующим интерлейкин-17A антителом секукинумабом не влияет на эффективность вакцинации против гриппа и менингококка у здоровых субъектов: результаты открытого рандомизированного одноцентрового исследования в параллельных группах. Clin Vacc Immunol: CVI. 2012; 19: 1597–602.

    CAS Статья Google Scholar

  • 28.

    Chiorean EG, Sweeney C, Youssoufian H, Qin A, Dontabhaktuni A, Loizos N, et al. Фаза I исследования оларатумаба, моноклонального антитела против рецептора фактора роста тромбоцитов альфа (PDGFRalpha), у пациентов с развитыми солидными опухолями.Cancer Chemother Pharmacol. 2014; 73: 595–604.

    CAS PubMed Статья Google Scholar

  • 29.

    Папп К.А., Леонарди С., Ментер А., Ортонн Дж. П., Крюгер Дж. Г., Крикориан Дж. И др. Бродалумаб, антитело против рецептора интерлейкина-17 при псориазе. N Engl J Med. 2012; 366: 1181–9.

    CAS PubMed Статья Google Scholar

  • 30.

    Венцель С., Форд Л., Перлман Д., Спектор С., Шер Л., Скобиеранда Ф. и др.Дупилумаб при стойкой астме с повышенным уровнем эозинофилов. N Engl J Med. 2013; 368: 2455–66.

    CAS Статья Google Scholar

  • 31.

    Антония С., Гольдберг С.Б., Балманукян А., Чафт Дж. Э., Санборн Р. Э., Гупта А. и др. Безопасность и противоопухолевая активность дурвалумаба в сочетании с тремелимумабом при немелкоклеточном раке легкого: многоцентровое исследование, фаза 1b. Ланцет Онкол. 2016; 17: 299–308.

    CAS PubMed PubMed Central Статья Google Scholar

  • 32.

    Huizinga TW, Fleischmann RM, Jasson M, Radin AR, van Adelsberg J, Fiore S и др. Сарилумаб, полностью человеческое моноклональное антитело против IL-6Ralpha у пациентов с ревматоидным артритом и неадекватным ответом на метотрексат: эффективность и безопасность результаты рандомизированного исследования SARIL-RA-MOBILITY, часть A. Ann Rheum Dis. 2014; 73: 1626–34.

    CAS PubMed Статья Google Scholar

  • 33.

    Теппер С., Ашина М., Рейтер Ю., Брандес Дж. Л., Долезил Д., Зильберштейн С. и др.Безопасность и эффективность эренумаба для профилактического лечения хронической мигрени: рандомизированное двойное слепое плацебо-контролируемое исследование фазы 2. Lancet Neurol. 2017; 16: 425–34.

    CAS PubMed Статья Google Scholar

  • 34.

    Migden MR, Rischin D, Schmults CD, Guminski A, Hauschild A, Lewis KD, et al. Блокада PD-1 с помощью цемиплимаба при запущенной плоскоклеточной карциноме кожи. N Engl J Med. 2018; 379: 341–51.

    CAS PubMed Статья Google Scholar

  • 35.

    Лонберг Н., Тейлор Л.Д., Хардинг Ф.А., Трунстайн М., Хиггинс К.М., Шрамм С.Р. и др. Антиген-специфические человеческие антитела от мышей, содержащие четыре различных генетических модификации. Природа. 1994; 368: 856–9.

    CAS PubMed Статья Google Scholar

  • 36.

    Мендес М.Дж., Грин Л.Л., Корвалан Дж.Р., Джиа К.С., Мейнард-Карри К.Э., Ян XD и др. Функциональный трансплантат мегабазных локусов иммуноглобулина человека воспроизводит ответ человеческих антител у мышей.Нат Жене. 1997; 15: 146–56.

    CAS PubMed Статья Google Scholar

  • 37.

    Грин Л.Л., Харди М.С., Мейнард-Карри К.Э., Цуда Х., Луи Д.М., Мендес М.Дж. и др. Антиген-специфические человеческие моноклональные антитела мышей, сконструированные с использованием YAC тяжелой и легкой цепей человеческого Ig. Нат Жене. 1994; 7: 13–21.

    CAS PubMed Статья Google Scholar

  • 38.

    Морони М., Веронезе С., Бенвенути С., Маррапез Дж., Сарторе-Бьянки А., Ди Николантонио Ф. и др.Число копий гена рецептора эпидермального фактора роста (EGFR) и клинический ответ на лечение антиEGFR при колоректальном раке: когортное исследование. Ланцет Онкол. 2005; 6: 279–86.

    CAS PubMed Статья Google Scholar

  • 39.

    Гибсон ТБ, Ранганатан А., Гротей А. Результаты рандомизированного испытания фазы III панитумумаба, полностью человеческого моноклонального антитела против рецептора эпидермального фактора роста, при метастатическом колоректальном раке. Clin Colorectal Cancer.2006; 6: 29–31.

    PubMed Статья Google Scholar

  • 40.

    Labrijn AF, Janmaat ML, Reichert JM, Parren PWHI. Биспецифические антитела: механистический обзор конвейера. Nat Rev Drug Discov. 2019; 18: 585–608.

    CAS PubMed Статья Google Scholar

  • 41.

    Хейсс М.М., Мурава П., Коралевский П., Кутарская Е., Колесник О.О., Иванченко В.В. и др. Трифункциональные антитела катумаксомаб для лечения злокачественного асцита, вызванного эпителиальным раком: результаты проспективного рандомизированного исследования II / III фазы.Int J Cancer. 2010; 127: 2209–21.

    CAS PubMed PubMed Central Статья Google Scholar

  • 42.

    Gokbuget N, Dombret H, Bonifacio M, Reichle A, Graux C, Faul C и др. Блинатумомаб для минимальной остаточной болезни у взрослых с В-клеточным предшественником острого лимфобластного лейкоза. Кровь. 2018; 131: 1522–31.

    PubMed PubMed Central Статья CAS Google Scholar

  • 43.

    Oldenburg J, Mahlangu JN, Kim B., Schmitt C, Callaghan MU, Young G, et al. Профилактика эмицизумаба при гемофилии А с помощью ингибиторов. N Engl J Med. 2017; 377: 809–18.

    CAS PubMed Статья Google Scholar

  • 44.

    Kyowa Hakko Kirin Co. Ltd. Консолидированный финансовый отчет (МСФО) за 2018 финансовый год. 2019, 5 февраля.

  • 45.

    Грило А.Л., Манталарис А. Рынок моноклональных антител, становящийся все более человеческим и прибыльным.Trends Biotechnol. 2019; 37: 9–16.

    CAS PubMed Статья Google Scholar

  • 46.

    Donini C, D’Ambrosio L, Grignani G, Aglietta M, Sangiolo D. Контрольные точки иммунитета нового поколения для лечения рака. J Thorac Dis. 2018; 10: S1581 – S601.

    PubMed PubMed Central Статья Google Scholar

  • 47.

    Сатор П. Безопасность и переносимость адалимумаба для лечения псориаза: обзор 15-летнего реального опыта.Ther Adv Chronic Dis. 2018; 9: 147–58.

    CAS PubMed PubMed Central Статья Google Scholar

  • 48.

    Burmester GR, Panaccione R, Gordon KB, McIlraith MJ, Lacerda AP. Адалимумаб: долгосрочная безопасность у 23 458 пациентов по результатам глобальных клинических испытаний ревматоидного артрита, ювенильного идиопатического артрита, анкилозирующего спондилита, псориатического артрита, псориаза и болезни Крона. Ann Rheum Dis. 2013; 72: 517–24.

    CAS PubMed Статья Google Scholar

  • 49.

    Замора-Атенза С., Диас-Торне С., Гели С., Диас-Лопес С., Ортис М.А., Моя П. и др. Адалимумаб регулирует внутриклеточную продукцию TNF-альфа у пациентов с ревматоидным артритом. Arthritis Res Ther. 2014; 16: R153.

    PubMed PubMed Central Статья CAS Google Scholar

  • 50.

    Pardoll DM. Блокада иммунных контрольных точек в иммунотерапии рака. Нат Рев Рак. 2012; 12: 252–64.

    CAS PubMed PubMed Central Статья Google Scholar

  • 51.

    Ван С., Тудиум КБ, Хан М., Ван XT, Хуанг Х., Фейнгерш Д. и др. Характеристика in vitro антитела против PD-1 ниволумаба, BMS-936558, и токсикология in vivo у нечеловеческих приматов. Cancer Immunol Res. 2014; 2: 846–56.

    CAS PubMed Статья Google Scholar

  • 52.

    Анселл С.М., Лесохин А.М., Боррелло И., Халвани А., Скотт Э.С., Гутьеррес М. и др. Блокада PD-1 ниволумабом при рецидивирующей или рефрактерной лимфоме Ходжкина.N Engl J Med. 2015; 372: 311–9.

    Артикул CAS Google Scholar

  • 53.

    Патнаик А., Канг С.П., Раско Д., Пападопулос К.П., Элассайс-Шаап Дж., Бирам М. и др. Исследование фазы I пембролизумаба (MK-3475; моноклональные антитела против PD-1) у пациентов с развитыми солидными опухолями. Clin Cancer Res. 2015; 21: 4286–93.

    CAS PubMed Статья Google Scholar

  • 54.

    Nghiem PT, Bhatia S, Lipson EJ, Kudchadkar RR, Miller NJ, Annamalai L, et al. Блокада PD-1 пембролизумабом при запущенной карциноме из клеток Меркеля. N Engl J Med. 2016; 374: 2542–52.

    CAS PubMed PubMed Central Статья Google Scholar

  • 55.

    Голдберг С.Б., Геттингер С.Н., Махаджан А., Чианг А.С., Хербст Р.С., Сзнол М. и др. Пембролизумаб для пациентов с меланомой или немелкоклеточным раком легкого и нелеченными метастазами в мозг: ранний анализ нерандомизированного открытого исследования фазы 2.Ланцет Онкол. 2016; 17: 976–83.

    CAS PubMed PubMed Central Статья Google Scholar

  • 56.

    Велчети В., Чандвани С., Чен Х, Пиетанза М.С., Берк Т. Монотерапия пембролизумабом первой линии при метастатическом PD-L1-положительном НМРЛ: анализ реального времени на лечение. Иммунотерапия. 2019; 11: 889–901.

    CAS PubMed Статья Google Scholar

  • 57.

    Рек М., Родригес-Абреу Д., Робинсон А.Г., Хуэй Р., Чоши Т., Фулоп А. и др. Пембролизумаб против химиотерапии при PD-L1-положительном немелкоклеточном раке легкого. N Engl J Med. 2016; 375: 1823–33.

    CAS PubMed Статья Google Scholar

  • 58.

    Morgensztern D, Herbst RS. Ниволумаб и пембролизумаб при немелкоклеточном раке легкого. Clin Cancer Res. 2016; 22: 3713–7.

    CAS PubMed Статья Google Scholar

  • 59.

    Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США. FDA одобрило новое превентивное лечение мигрени. 2018, 17 мая.

  • 60.

    Paemeleire K, MaassenVanDenBrink A. mAb пептидного пути, связанного с геном кальцитонина, и профилактика мигрени. Curr Opin Neurol. 2018; 31: 274–80.

    CAS PubMed Статья PubMed Central Google Scholar

  • 61.

    Liang YL, Khoshouei M, Deganutti G, Glukhova A, Koole C, Peat TS, et al.Крио-ЭМ структура активного рецептора CGRP человека в комплексе с Gs-белком. Природа. 2018; 561: 492–7.

    CAS PubMed PubMed Central Статья Google Scholar

  • 62.

    Эдвинссон Л., Хаанес К.А., Варфвиндж К., Краузе Д.Н. CGRP как цель новых методов лечения мигрени – успешный перевод из лаборатории в клинику. Nat Rev Neurol. 2018; 14: 338–50.

    CAS PubMed Статья PubMed Central Google Scholar

  • 63.

    Мигоне Т.С., Субраманиан Г.М., Чжун Дж., Хили Л.М., Кори А., Девалараджа М. и др. Раксибакумаб для лечения ингаляционной формы сибирской язвы. N Engl J Med. 2009; 361: 135–44.

    CAS PubMed Статья Google Scholar

  • 64.

    Malley R, DeVincenzo J, Ramilo O, Dennehy PH, Meissner HC, Gruber WC, et al. Уменьшение количества респираторно-синцитиального вируса (RSV) в трахеальном аспирате у интубированных младенцев с помощью гуманизированного моноклонального антитела к белку F RSV.J Infect Dis. 1998. 178: 1555–61.

    CAS PubMed Статья Google Scholar

  • 65.

    Эму Б., Фессель Дж., Шредер С., Кумар П., Ричмонд Дж., Вин С. и др. Фаза 3 исследования ибализумаба для лечения ВИЧ-1 с множественной лекарственной устойчивостью. N Engl J Med. 2018; 379: 645–54.

    CAS PubMed Статья Google Scholar

  • 66.

    Санофи ЭЛ. FDA рассмотрит изатуксимаб как потенциальное средство для лечения рецидивирующей / рефрактерной множественной миеломы.Paris, 2019.

  • 67.

    Richardson PG, Attal M, Campana F, Le-Guennec S, Hui AM, Risse ML, et al. Изатуксимаб плюс помалидомид / дексаметазон в сравнении с помалидомидом / дексаметазоном при рецидивирующей / рефрактерной множественной миеломе: дизайн исследования ICARIA фазы III. Будущее Онкол. 2018; 14: 1035–47.

    CAS PubMed Статья Google Scholar

  • 68.

    Новартис АГ. Финансовые результаты Novartis за 2 квартал 2018 г. 18 июля 2018 г. https: // www.novartis.com/news/novartis-financial-results-q2-2018, дата обращения 15 июля 2019 г.

  • 69.

    TESARO Inc. TESARO объявляет презентации данных на Конгрессе ESMO 2018. 20 октября 2018 г. https://www.globenewswire.com/news-release/2018/10/20/1624331/0/en/TESARO-Announces-Data-Presentations-at-ESMO-2018-Congress.html По состоянию на 15 июля 2019.

  • 70.

    TG Therapeutics I. TG Therapeutics объявляет об обновлении исследования фазы 3 UNITY-CLL. 25 сентября 3018 г. http://ir.tgtherapeutics.com/news-releases/news-release-details/tg-therapeutics-announces-update-regarding-unity-cll-phase-3 По состоянию на 15 июля 2019 г.

  • 71.

    Горман С.Д., Кларк МР. Гуманизация моноклональных антител для терапии. Semin Immunol. 1990; 2: 457–66.

    CAS PubMed PubMed Central Google Scholar

  • 72.

    Mountain A, Adair JR. Инженерные антитела для терапии. Biotechnol Genet Eng Rev.1992; 10: 1–142.

    CAS PubMed Статья PubMed Central Google Scholar

  • 73.

    Queen C, Schneider WP, Selick HE, Payne PW, Landolfi NF, Duncan JF и др. Гуманизированное антитело, связывающееся с рецептором интерлейкина 2. Proc Natl Acad Sci U S. A. 1989; 86: 10029–33.

    CAS PubMed PubMed Central Статья Google Scholar

  • 74.

    Choi Y, Hua C, Sentman CL, Ackerman ME, Bailey-Kellogg C. Гуманизация антител с помощью компьютерного дизайна белков на основе структуры. MAbs. 2015; 7: 1045–57.

    CAS PubMed PubMed Central Статья Google Scholar

  • 75.

    Olimpieri PP, Marcatili P, Tramontano A. Tabhu: инструменты для гуманизации антител. Биоинформатика. 2015; 31: 434–5.

    CAS PubMed Статья PubMed Central Google Scholar

  • 76.

    Swindells MB, Porter CT, Couch M, Hurst J, Abhinandan K, Nielsen JH, et al. abYsis: интегрированная последовательность и структура антитела – управление, анализ и прогноз. J Mol Biol. 2017; 429: 356–64.

    CAS PubMed Статья PubMed Central Google Scholar

  • 77.

    Abhinandan KR, Martin ACR. Анализ «степени человечности» последовательностей антител. J Mol Biol. 2007; 369: 852–62.

    CAS PubMed Статья PubMed Central Google Scholar

  • 78.

    Пелат Т., Бедуэль Х., Рис А.Р., Креннелл С.Дж., Лефранк М.П., ​​Туллиер П. Гуманизация зародышевой линии нечеловеческого антитела приматов, которое нейтрализует токсин сибирской язвы, in vitro и in Silico Engineering. J Mol Biol. 2008. 384: 1400–7.

    CAS PubMed Статья PubMed Central Google Scholar

  • 79.

    Thullier P, Huish O, Pelat T, Martin ACR. Человечность последовательностей антител макака. J Mol Biol. 2010; 396: 1439–50.

    CAS PubMed Статья PubMed Central Google Scholar

  • 80.

    Гао Ш., Хуанг К., Ту Х., Адлер А.С. Оценка человечности моноклональных антител и ее применения. BMC Biotechnol. 2013; 13:55.

    CAS PubMed PubMed Central Статья Google Scholar

  • 81.

    Ducancel F, Muller BH. Молекулярная инженерия антител для терапевтических и диагностических целей. MAbs. 2012; 4: 445–57.

    PubMed PubMed Central Статья Google Scholar

  • 82.

    Harding FA, Stickler MM, Razo J, DuBridge RB. Иммуногенность гуманизированных и полностью человеческих антител: остаточная иммуногенность находится в областях CDR. MAbs. 2010; 2: 256–65.

    PubMed PubMed Central Статья Google Scholar

  • 83.

    Hansel TT, Kropshofer H, Singer T, Mitchell JA, George AJ. Безопасность и побочные эффекты моноклональных антител. Nat Rev Drug Discov. 2010; 9: 325.

    CAS PubMed Статья PubMed Central Google Scholar

  • 84.

    Вальдманн Х. Моноклональные антитела человека: преимущества гуманизации. Методы Мол биол. 1904; 2019: 1–10.

    Google Scholar

  • 85.

    Rebello PRUB, Hale G, Friend PJ, Cobbold SP, Waldmann H.Ответы антиглобулинов на крысиные и гуманизированные моноклональные антитела кампат-1, используемые для лечения отторжения трансплантата1. Трансплантация. 1999; 68: 1417–149.

    CAS PubMed Статья PubMed Central Google Scholar

  • 86.

    Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L, et al. Многонациональное исследование эффективности и безопасности гуманизированных моноклональных антител против HER2 у женщин с метастатическим раком молочной железы со сверхэкспрессией HER2, который прогрессировал после химиотерапии по поводу метастатического заболевания.J Clin Oncol. 1999; 17: 2639–48.

    CAS PubMed Статья PubMed Central Google Scholar

  • 87.

    Джекиш С., Ким С.Б., Семиглазов В., Меличар Б., Пивот Х, Хилленбах С. и др. Сравнение подкожного и внутривенного введения трастузумаба при HER2-положительном раке молочной железы на ранней стадии: обновленные результаты исследования фазы III HannaH. Энн Онкол. 2015; 26: 320–5.

    CAS PubMed Статья PubMed Central Google Scholar

  • 88.

    Harding FA, Stickler MM, Razo J, DuBridge RB. Иммуногенность гуманизированных и полностью человеческих антител: остаточная иммуногенность находится в областях CDR. mAbs. 2010; 2: 256–65.

    PubMed PubMed Central Статья Google Scholar

  • 89.

    Bender NK, Heilig CE, Dröll B, Wohlgemuth J, Armbruster F-P, Heilig B. Иммуногенность, эффективность и побочные эффекты адалимумаба у пациентов с РА. Rheumatol Int. 2007. 27: 269–74.

    CAS PubMed Статья PubMed Central Google Scholar

  • 90.

    West RL, Zelinkova Z, Wolbink GJ, Kuipers EJ, Stokkers PC, van der Woude CJ. Иммуногенность отрицательно влияет на исход лечения адалимумабом при болезни Крона. Алимент Pharmacol Ther. 2008. 28: 1122–6.

    CAS PubMed Статья PubMed Central Google Scholar

  • 91.

    Кей Дж., Маттесон Э.Л., Дасгупта Б., Нэш П., Дурез П., Холл С. и др. Голимумаб у пациентов с активным ревматоидным артритом, несмотря на лечение метотрексатом: рандомизированное двойное слепое плацебо-контролируемое исследование с диапазоном доз. Ревматоидный артрит. 2008. 58: 964–75.

    CAS PubMed Статья PubMed Central Google Scholar

  • 92.

    Пармли С.Ф., Смит Г.П. Отбираемые антителами нитчатые фаговые векторы fd: аффинная очистка генов-мишеней.Ген. 1988. 73: 305–18.

    CAS PubMed Статья PubMed Central Google Scholar

  • 93.

    Clackson T, Hoogenboom HR, Griffiths AD, Winter G. Получение фрагментов антител с использованием библиотек фагового дисплея. Природа. 1991; 352: 624–8.

    CAS PubMed Статья PubMed Central Google Scholar

  • 94.

    Воан Т.Дж., Уильямс А.Дж., Притчард К., Осборн Дж.К., Поуп А.Р., Эрншоу Дж.С. и др.Человеческие антитела с суб-наномолярной аффинностью, выделенные из большой библиотеки неиммунизированных фаговых дисплеев. Nat Biotechnol. 1996; 14: 309–14.

    CAS PubMed Статья PubMed Central Google Scholar

  • 95.

    Breitling F, Dubel S, Seehaus T, Klewinghaus I, Little M. Вектор поверхностной экспрессии для скрининга антител. Ген. 1991; 104: 147–53.

    CAS PubMed Статья PubMed Central Google Scholar

  • 96.

    Barbas CF, Kang AS, Lerner RA, Benkovic SJ. Сборка комбинаторных библиотек антител на фаговых поверхностях: сайт гена III. Proc Natl Acad Sci U S. A. 1991; 88: 7978–82.

    CAS PubMed PubMed Central Статья Google Scholar

  • 97.

    Nixon AE, Sexton DJ, Ladner RC. Лекарства, полученные на основе фагового дисплея: от идентификации кандидатов до клинической практики. MAbs. 2014; 6: 73–85.

    PubMed Статья PubMed Central Google Scholar

  • 98.

    Sheets MD, Amersdorfer P, Finnern R, Sargent P, Lindqvist E, Schier R, et al. Эффективное конструирование большой библиотеки неиммунных фаговых антител: получение одноцепочечных человеческих антител с высоким сродством к белковым антигенам. Proc Natl Acad Sci U S. A. 1998; 95: 6157–62.

    CAS PubMed PubMed Central Статья Google Scholar

  • 99.

    Лу Р.М., Чанг Ю.Л., Чен М.С., Ву Х.С. Одноцепочечные наночастицы, конъюгированные с антителом против c-Met, для нацеленной на опухоль визуализации и доставки лекарств in vivo.Биоматериалы. 2011; 32: 3265–74.

    CAS PubMed Статья PubMed Central Google Scholar

  • 100.

    Брэдбери АРМ, Сидху С., Дюбель С., Маккафферти Дж. Помимо естественных антител: сила технологий отображения in vitro. Nat Biotechnol. 2011; 29: 245–54.

    CAS PubMed PubMed Central Статья Google Scholar

  • 101.

    Лернер Р.А. Библиотеки комбинаторных антител: новые достижения, новые иммунологические идеи.Nat Rev Immunol. 2016; 16: 498–508.

    CAS PubMed Статья Google Scholar

  • 102.

    Weber M, Bujak E, Putelli A, Villa A, Matasci M, Gualandi L, et al. Высокофункциональная синтетическая библиотека фагового дисплея, содержащая более 40 миллиардов клонов человеческих антител. PLoS One. 2014; 9: e100000.

    PubMed PubMed Central Статья CAS Google Scholar

  • 103.

    Ли Т.Й., Ву Х.С., Цао Т.С. и Линь В. Fountain Biopharma Inc., правопреемник. Антитела к интерлейкину-6 Патент США 9 234035. 2016 12 января.

  • 104.

    Ву ХК, Лу Р.М., Чиу С.Й., Лю И.Дж. и Чанг Ю.Л .; Academia Sinica, правопреемник. Антитело против рецептора 2 фактора роста эндотелия сосудов (VEGFR2) и способы его применения для обнаружения VEGFR2 и для ингибирования роста опухоли, ангиогенеза опухоли и / или индукции цитотоксичности раковых клеток. Патент США US 10,196,447. 2018 5 февраля.

  • 105.

    de Haard HJ, van Neer N, Reurs A, Hufton SE, Roovers RC, Henderikx P и др. Большая фаговая библиотека неиммунизированных человеческих Fab-фрагментов, которая позволяет быстро выделять и кинетический анализ высокоаффинных антител. J Biol Chem. 1999; 274: 18218–30.

    PubMed Статья Google Scholar

  • 106.

    Knappik A, Ge L, Honegger A, Pack P, Fischer M, Wellnhofer G, et al. Полностью синтетические библиотеки комбинаторных антител человека (HuCAL) на основе модульных консенсусных каркасов и CDR, рандомизированных с помощью тринуклеотидов.J Mol Biol. 2000. 296: 57–86.

    CAS PubMed Статья Google Scholar

  • 107.

    Rothe C, Urlinger S, Lohning C, Prassler J, Stark Y, Jager U, et al. Библиотека комбинаторных антител человека HuCAL GOLD сочетает в себе диверсификацию всех шести CDR в соответствии с естественной иммунной системой с новым методом отображения для эффективного отбора высокоаффинных антител. J Mol Biol. 2008; 376: 1182–200.

    CAS PubMed Статья Google Scholar

  • 108.

    Chan CE, Lim AP, MacAry PA, Hanson BJ. Роль фагового дисплея в открытии терапевтических антител. Int Immunol. 2014; 26: 649–57.

    CAS PubMed Статья Google Scholar

  • 109.

    Чан С.Э., Чан А.Х., Лим А.П., Хансон Б.Дж. Сравнение эффективности отбора антител из полусинтетических scFv и неиммунных библиотек фаговых дисплеев Fab против белков-мишеней для быстрой разработки диагностических иммуноанализов. J Immunol Methods.2011; 373: 79–88.

    CAS PubMed Статья Google Scholar

  • 110.

    Wrublewski DT. Анализ для научных библиотекарей Нобелевской премии по химии 2018 г .: Направленная эволюция ферментов и фаговый дисплей пептидов и антител. Sci Technol Libr. 2019: 1–19.

  • 111.

    Батлле Э., Клеверс Х. Снова о раковых стволовых клетках. Nat Med. 2017; 23: 1124.

    CAS PubMed PubMed Central Статья Google Scholar

  • 112.

    Swaminathan SK, Niu L, Waldron N, Kalscheuer S, Zellmer DM, Olin MR, et al. Идентификация и характеристика нового scFv, распознающего CD133 человека и мыши. Drug Deliv Transl Res. 2013; 3: 143–51.

    CAS PubMed PubMed Central Статья Google Scholar

  • 113.

    Нильвебрант Дж., Куку Дж., Бьоркелунд Н., Нестор М. Отбор и характеризация in vitro человеческих фрагментов CD44v6-связывающих антител. Biotechnol Appl Biochem.2012; 59: 367–80.

    CAS PubMed Статья Google Scholar

  • 114.

    Баскар С., Сущак Ю.М., Самия И., Сринивасан Р., Чайлдс Р.В., Павлетич С.З. и др. Лекарственное средство с человеческими моноклональными антителами и платформа для открытия мишеней для В-клеточного хронического лимфоцитарного лейкоза на основе аллогенной трансплантации гемопоэтических стволовых клеток и фагового дисплея. Кровь. 2009. 114: 4494–502.

    CAS PubMed PubMed Central Статья Google Scholar

  • 115.

    Zhu X, Bidlingmaier S, Hashizume R, James CD, Berger MS, Liu B. Идентификация интернализующих одноцепочечных антител человека, нацеленных на клетки сферы опухоли головного мозга. Mol Cancer Ther. 2010; 9: 2131–41.

    CAS PubMed PubMed Central Статья Google Scholar

  • 116.

    Ларсен С.А., Мелдгаард Т., Фридриксдоттир А.Дж., Ликкемарк С., Поулсен П.С., Овергаард Л.Ф. и др. Выбор антитела, специфичного для субпопуляции рака молочной железы, с использованием фагового дисплея на срезах ткани.Immunol Res. 2015; 62: 263–72.

    CAS PubMed PubMed Central Статья Google Scholar

  • 117.

    Sun Y, Shukla GS, Weaver D, Pero SC, Krag DN. Селекция фагового дисплея на гистологических препаратах опухолей с помощью лазерной микродиссекции. J Immunol Methods. 2009; 347: 46–53.

    CAS PubMed PubMed Central Статья Google Scholar

  • 118.

    Ларсен С.А., Мелдгаард Т., Ликкемарк С., Мандруп О.А., Кристенсен П.Отбор антител, специфичных к клеточному типу, на срезах тканей с использованием фагового дисплея. J Cell Mol Med. 2015.

  • 119.

    Su Y, Bidlingmaier S, Lee N-K, Liu B. Объедините выбор библиотеки фаговых антител на образцах тканей пациентов с микродиссекцией лазерного захвата для идентификации новых человеческих антител, нацеленных на клинически значимые опухолевые антигены. В: Хуст М., Лим Т.С., редакторы. Фаговый дисплей: методы и протоколы. Нью-Йорк: Springer New York; 2018. с. 331–47.

    Глава Google Scholar

  • 120.

    Weiner GJ. Создание более эффективных терапевтических средств на основе моноклональных антител. Нат Рев Рак. 2015; 15: 361–70.

    CAS PubMed PubMed Central Статья Google Scholar

  • 121.

    Розенблюм Д., Джоши Н., Тао В., Карп Дж. М., Пир Д. Прогресс и проблемы в направлении адресной доставки лекарств от рака. Nat Commun. 2018; 9: 1410.

    PubMed PubMed Central Статья CAS Google Scholar

  • 122.

    Караччоло Г. Липосомальные наномедицины, одобренные клинически: уроки, извлеченные из биомолекулярной короны. Наноразмер. 2018; 10: 4167–72.

    CAS PubMed Статья Google Scholar

  • 123.

    Бесерил Б., Поул М.А., Маркс Дж. Д.. К отбору интернализующих антител из фаговых библиотек. Biochem Biophys Res Commun. 1999; 255: 386–93.

    CAS PubMed Статья Google Scholar

  • 124.

    Рот А., Драммонд, округ Колумбия, Конрад Ф, Хейс М.Э., Кирпотин Д.Б., Бенц С.К. и др. Опосредованная одноцепочечным антителом анти-CD166 внутриклеточная доставка липосомальных препаратов к клеткам рака простаты. Mol Cancer Ther. 2007; 6: 2737–46.

    CAS PubMed Статья Google Scholar

  • 125.

    Маруяма Т., Паррен П.В., Санчес А., Ренсинк И., Родригес Л.Л., Хан А.С. и др. Рекомбинантные человеческие моноклональные антитела к вирусу Эбола. J Infect Dis. 1999; 179 (Приложение 1): S235–9.

    CAS PubMed Статья Google Scholar

  • 126.

    Flego M, Di Bonito P, Ascione A, Zamboni S, Carattoli A, Grasso F, et al. Создание фрагментов человеческих антител, распознающих отдельные эпитопы нуклеокапсидного (N) белка SARS-CoV, с использованием подхода фагового дисплея. BMC Infect Dis. 2005; 5: 73.

    PubMed PubMed Central Статья CAS Google Scholar

  • 127.

    Кан X, Ян Б.А., Ху Y, Чжао Х., Сюн В., Ян И и др. Человеческие нейтрализующие Fab-молекулы против коронавируса тяжелого острого респираторного синдрома, генерируемого фаговым дисплеем. Clin Vacc Immunol: CVI. 2006; 13: 953–7.

    CAS Статья Google Scholar

  • 128.

    Мараско В.А., Суи Дж. Рост и потенциал терапевтических средств противовирусными моноклональными антителами человека. Nat Biotechnol. 2007; 25: 1421–34.

    CAS PubMed Статья Google Scholar

  • 129.

    Лернер РА. Изготовление иммунитета к болезням в пробирке: волшебная пуля реализована. Angew Chem Int Ed. 2006; 45: 8106–25.

    CAS Статья Google Scholar

  • 130.

    Чжан Х, Ци Х, Чжан Кью, Цзэн Х, Ши Зи, Цзинь Цзинь и др. Одноцепочечное Fv-антитело человека 4F5, распознающее консервативный эпитоп HA1, обладает широкой нейтрализующей способностью против вирусов гриппа A H5N1 различных клад. Антивир Рес 2013; 99: 91–9.

    CAS PubMed Статья Google Scholar

  • 131.

    Kashyap AK, Steel J, Oner AF, Dillon MA, Swale RE, Wall KM, et al. Библиотеки комбинаторных антител от выживших после вспышки птичьего гриппа H5N1 в Турции раскрывают стратегии нейтрализации вируса. Proc Natl Acad Sci U S. A. 2008; 105: 5986–91.

    CAS PubMed PubMed Central Статья Google Scholar

  • 132.

    Chen Z, Wang J, Bao L, Guo L, Zhang W, Xue Y, et al. Человеческие моноклональные антитела, нацеленные на гликопротеин гемагглютинина, могут нейтрализовать вирус гриппа H7N9.Nat Commun. 2015; 6.

  • 133.

    Ван Дж., Чен З., Бао Л., Чжан В., Сюэ И, Панг Х и др. Характеристика двух человеческих моноклональных антител, нейтрализующих вирусы гриппа A H7N9. J Virol. 2015.

  • 134.

    Коттен М., Уотсон С.Дж., Зумла А.И., Makhdoom HQ, Палсер А.Л., Онг С.Х. и др. Распространение, циркуляция и эволюция коронавируса ближневосточного респираторного синдрома. mBio. 2014; 5.

  • 135.

    Тан XC, Agnihothram SS, Jiao Y, Stanhope J, Graham RL, Peterson EC, et al.Идентификация нейтрализующих антител человека против БВРС-КоВ и их роль в адаптивной эволюции вируса. Proc Natl Acad Sci U S. A. 2014; 111: E2018 – E26.

    CAS PubMed PubMed Central Статья Google Scholar

  • 136.

    Lim CC, Woo PCY, Lim TS. Разработка стратегии панорамирования фагового дисплея с использованием сырых антигенов: выделение человеческих антител к нуклеопротеину БВРС-КоВ. Научный доклад 2019; 9: 6088.

    PubMed PubMed Central Статья CAS Google Scholar

  • 137.

    Уокер Л.М., Бертон ДР. Пассивная иммунотерапия вирусных инфекций: в бой вступают «суперантитела». Nat Rev Immunol. 2018; 18: 297–308.

    CAS PubMed PubMed Central Статья Google Scholar

  • 138.

    Кеннеди П.Дж., Оливейра С., Гранха П.Л., Сарменто Б. Моноклональные антитела: технологии для ранних открытий и инженерии. Crit Rev Biotechnol. 2018; 38: 394–408.

    CAS PubMed Статья Google Scholar

  • 139.

    Weinblatt ME, Keystone EC, Furst DE, Moreland LW, Weisman MH, Birbara CA и др. Адалимумаб, полностью человеческое моноклональное антитело против фактора некроза опухоли альфа, для лечения ревматоидного артрита у пациентов, принимающих одновременно метотрексат: исследование ARMADA. Ревматоидный артрит. 2003. 48: 35–45.

    CAS PubMed Статья Google Scholar

  • 140.

    Линдсли CW. Прогнозы и статистика по наиболее продаваемым лекарствам в мире и США в 2018 году и прогноз на 2024 год.ACS Chem Neurosci. 2019; 10: 1115.

    CAS PubMed Статья Google Scholar

  • 141.

    Эдвардс Б.М., Бараш С.К., Мейн С.Х., Чой Г.Х., Минтер Р., Ульрих С. ​​и др. Замечательная гибкость репертуара человеческих антител; выделение более тысячи различных антител к одному белку BLyS. J Mol Biol. 2003. 334: 103–18.

    CAS PubMed Статья Google Scholar

  • 142.

    Sanz I, Yasothan U, Kirkpatrick P. Belimumab. Nat Rev Drug Discov. 2011; 10: 335.

    CAS PubMed Статья Google Scholar

  • 143.

    Димитров Д.С., Маркс Ю.Д. Терапевтические антитела: текущее состояние и будущие тенденции – скоро ли смена парадигмы? Методы Мол биол. 2009; 525: 1-27 xiii.

    CAS PubMed PubMed Central Статья Google Scholar

  • 144.

    Диас-Серрано А., Санчес-Торре А., Пас-Арес Л. Нецитумумаб для лечения распространенного немелкоклеточного рака легкого. Будущее Онкол. 2019; 15: 705–16.

    CAS PubMed Статья Google Scholar

  • 145.

    Арриета О., Затараин-Баррон З.Л., Кардона А.Ф., Кармона А., Лопес-Мехиа М. Рамуцирумаб в лечении немелкоклеточного рака легких. Экспертное мнение Drug Saf. 2017; 16: 637–44.

    PubMed Статья CAS Google Scholar

  • 146.

    Aprile G, Ferrari L, Cremolini C, Bergamo F, Fontanella C, Battaglin F и др. Рамуцирумаб для лечения рака желудка, колоректальной аденокарциномы и других злокачественных новообразований желудочно-кишечного тракта. Эксперт Rev Clin Pharmacol. 2016; 9: 877–85.

    CAS PubMed Статья Google Scholar

  • 147.

    Лю Д., Хименес Х, Чжан Х., Болен П., Витте Л., Чжу З. Отбор высокоаффинных нейтрализующих антител человека к VEGFR2 из большой библиотеки фаговых дисплеев антител для антиангиогенезной терапии.Int J Cancer. 2002; 97: 393–9.

    CAS PubMed Статья Google Scholar

  • 148.

    Лу Д., Шен Дж., Виль М.Д., Чжан Х., Хименес Х, Болен П. и др. Адаптация отбора in vitro для пикомолярного аффинного человеческого антитела, направленного против рецептора 2 фактора роста эндотелия сосудов, для повышения нейтрализующей активности. J Biol Chem. 2003; 278: 43496–507.

    CAS PubMed Статья Google Scholar

  • 149.

    Frenzel A, Schirrmann T, Hust M. Человеческие антитела, полученные на основе фагового дисплея, в клинической разработке и терапии. MAbs. 2016; 8: 1177–94.

    CAS PubMed PubMed Central Статья Google Scholar

  • 150.

    Boyerinas B, Jochems C, Fantini M, Heery CR, Gulley JL, Tsang KY, et al. Антитело-зависимая клеточная цитотоксическая активность нового анти-PD-L1-антитела Авелумаб (MSB0010718C) на опухолевых клетках человека. Cancer Immunol Res.2015.

  • 151.

    Rodriguez-Vida A, Bellmunt J. Avelumab для лечения уротелиального рака. Эксперт Rev Anticancer Ther. 2018; 18: 421–9.

    CAS PubMed Статья Google Scholar

  • 152.

    Benson J, Cunningham M, Duchala C., Giles-Komar JM, Luo J, Rycyzyn MA и др .; Janssen Biotech Inc., правопреемник. Антитела против IL-23, композиции, методы и применение. Патент США US7807414B2. 2009.

  • 153.

    Бенсон Дж., Картон Дж., Каннингем М., Орловский Ю.И., Раухенбергер Р. и Свит Р.; Janssen Biotech Inc., правопреемник. Композиции антител против IL-23. Патент США US9714287B2. 2016.

  • 154.

    Мачадо А., Торрес Т. Гуселкумаб для лечения псориаза. Биопрепараты. 2018; 32: 119–28.

    CAS PubMed Статья Google Scholar

  • 155.

    Борк К., Менг Г., Штаубах П., Хардт Дж. Наследственный ангионевротический отек: новые данные о симптомах, пораженных органах и течении.Am J Med. 2006; 119: 267–74.

    PubMed Статья Google Scholar

  • 156.

    Чикарди М., Банерджи А., Брачо Ф., Мальбран А., Розенкранц Б., Ридл М. и др. Икатибант, новый антагонист рецепторов брадикинина, при наследственном ангионевротическом отеке. N Engl J Med. 2010; 363: 532–41.

    CAS PubMed PubMed Central Статья Google Scholar

  • 157.

    Busse PJ, Farkas H, Banerji A, Lumry WR, Longhurst HJ, Sexton DJ, et al.Ланаделумаб для профилактического лечения наследственного ангионевротического отека с дефицитом ингибитора C1: обзор доклинических исследований и исследований фазы I. BioDrugs. 2019; 33: 33–43.

    CAS PubMed Статья Google Scholar

  • 158.

    Сюй Ц., Суй Дж., Тао Х, Чжу К., Мараско, Вашингтон. Антитела против CXCR4 человека претерпевают замену VH, проявляют функциональную сульфатию V-области и определяют антигенную гетерогенность CXCR4. J Immunol. 2007. 179: 2408–18.

    CAS PubMed Статья Google Scholar

  • 159.

    Шихан Дж. И Мараско В.А. Дисплей фагов и дрожжей. Microbiol Spectr. 2015; 3: Эйд-0028-2014.

  • 160.

    Bradbury AR, Marks JD. Антитела из библиотек фаговых антител. J Immunol Methods. 2004; 290: 29–49.

    CAS PubMed Статья Google Scholar

  • 161.

    Джонс А.Р., Штутц С.К., Чжоу Й., Маркс Д.Д., Шуста Е.В.Идентификация селективных одноцепочечных фрагментов антител через гематоэнцефалический барьер. Biotechnol J. 2014; 9: 664–74.

    CAS PubMed PubMed Central Статья Google Scholar

  • 162.

    Брюггеманн М., Осборн М.Дж., Ма Б., Хайр Дж., Авис С., Лундстром Б. и др. Продукция человеческих антител у трансгенных животных. Arch Immunol Ther Exp (Warsz). 2015; 63: 101–8.

    CAS Статья Google Scholar

  • 163.

    Осборн MJ, Ma B, Avis S, Binnie A, Dilley J, Yang X и др. Антитела IgG с высоким сродством развиваются естественным образом у крыс с нокаутом по Ig, несущих локусы человеческого IgH / Igkappa / Iglambda зародышевой линии, несущие участок CH крысы. J Immunol. 2013; 190: 1481–90.

    CAS PubMed PubMed Central Статья Google Scholar

  • 164.

    Ли ЕС, Лян К., Али Х., Бейлисс Л., Бисли А., Блумфилд-Гердес Т. и др. Полная гуманизация локусов иммуноглобулинов мыши делает возможным эффективное открытие терапевтических антител.Nat Biotechnol. 2014; 32: 356–63.

    CAS PubMed Статья Google Scholar

  • 165.

    Мерфи А.Дж., Макдональд Л.Е., Стивенс С., Кароу М., Дор А.Т., Побурский К. и др. Мыши с мегабазной гуманизацией своих генов иммуноглобулинов вырабатывают антитела так же эффективно, как и нормальные мыши. Proc Natl Acad Sci U S. A. 2014; 111: 5153–8.

    CAS PubMed PubMed Central Статья Google Scholar

  • 166.

    Alt FW, Кейт Блэкуэлл Т., Янкопулос Г.Д. Гены иммуноглобулинов у трансгенных мышей. Тенденции Genet. 1985; 1: 231–6.

    CAS Статья Google Scholar

  • 167.

    Брюггеманн М., Каски Х.М., Тил С., Вальдманн Х., Уильямс Г.Т., Сурани М.А. и др. Репертуар моноклональных антител с тяжелыми цепями человека от трансгенных мышей. Proc Natl Acad Sci U S. A. 1989; 86: 6709–13.

    CAS PubMed PubMed Central Статья Google Scholar

  • 168.

    Тейлор Л.Д., Кармак С.Э., Шрамм С.Р., Машайех Р., Хиггинс К.М., Куо С.К. и др. Трансгенная мышь, которая экспрессирует множество иммуноглобулинов тяжелой и легкой цепей человека. Nucleic Acids Res. 1992; 20: 6287–95.

    CAS PubMed PubMed Central Статья Google Scholar

  • 169.

    Chen J, Trounstine M, Alt FW, Young F, Kurahara C, Loring JF и др. Перестройка гена иммуноглобулина у мышей с дефицитом В-клеток, вызванная направленной делецией локуса JH.Int Immunol. 1993; 5: 647–56.

    CAS PubMed Статья Google Scholar

  • 170.

    Чен Дж., Трунстин М., Курахара С., Янг Ф., Куо С.К., Сюй Й. и др. Развитие В-клеток у мышей, у которых отсутствует один или оба гена легкой цепи каппа иммуноглобулина. EMBO J. 1993; 12: 821–30.

    CAS PubMed PubMed Central Статья Google Scholar

  • 171.

    Davies NP, Rosewell IR, Richardson JC, Cook GP, Neuberger MS, Brownstein BH, et al.Создание мышей, экспрессирующих легкие цепи антител человека, путем введения искусственной хромосомы дрожжей, содержащей центральную область локуса каппа иммуноглобулина человека. Биотехнология (N Y). 1993; 11: 911–4.

    CAS Google Scholar

  • 172.

    Choi TK, Hollenbach PW, Pearson BE, Ueda RM, Weddell GN, Kurahara CG, et al. Трансгенные мыши, содержащие фрагмент гена иммуноглобулина тяжелой цепи человека, клонированный в искусственной хромосоме дрожжей.Нат Жене. 1993; 4: 117–23.

    CAS PubMed Статья Google Scholar

  • 173.

    Якобовиц А., Амадо Р.Г., Ян Х, Роскос Л., Шваб Г. От технологии XenoMouse до панитумумаба, первого полностью человеческого антитела, полученного от трансгенных мышей. Nat Biotechnol. 2007; 25: 1134–43.

    CAS PubMed Статья Google Scholar

  • 174.

    Хоффман В., Лаккис Ф.Г., Чаласани Г.В-клетки, антитела и многое другое. Clin J Am Soc Nephrol. 2016; 11: 137–54.

    CAS PubMed Статья Google Scholar

  • 175.

    Диаз М., Казали П. Соматическая гипермутация иммуноглобулина. Curr Opin Immunol. 2002; 14: 235–40.

    CAS PubMed PubMed Central Статья Google Scholar

  • 176.

    Nimmerjahn F, Ravetch JV. Fc-рецепторы как регуляторы иммунитета.Adv Immunol. 2007; 96: 179–204.

    CAS PubMed Статья PubMed Central Google Scholar

  • 177.

    Tyagi P. Недавние результаты и продолжающиеся испытания панитумумаба (ABX-EGF), полностью человеческого антитела против рецептора эпидермального фактора роста, при метастатическом колоректальном раке. Clin Colorectal Cancer. 2005; 5: 21–3.

    PubMed Статья PubMed Central Google Scholar

  • 178.

    Den Broeder, Alfons, et al. Одноразовое плацебо-контролируемое исследование полностью человеческого антитела против фактора некроза опухоли-альфа адалимумаба (D2E7) у пациентов с ревматоидным артритом. J Rheumatol. 2002. 29 (11): 2288–98.

  • 179.

    Тьяги, Прита, Чу Э, Джайн В.К. Недавние результаты и продолжающиеся испытания панитумумаба (ABXEGF), полностью человеческого антитела против рецептора эпидермального фактора роста, при метастатическом колоректальном раке. Clin Colorectal Cancer. 2005. 5 (1): 21–23.

    PubMed Статья PubMed Central Google Scholar

  • 180.

    Дин, Чанхай. Белимумаб, человеческое моноклональное антитело против BLyS для потенциального лечения воспалительных аутоиммунных заболеваний. Экспертное мнение Biol Ther. 2008. 8 (11): 1805–14.

    CAS PubMed Статья PubMed Central Google Scholar

  • 181.

    Крупицкая, Елена, Вейкли, ГА. Рамуцирумаб, полностью человеческое mAb к трансмембранной сигнальной тирозинкиназе VEGFR-2 для потенциального лечения рака. Curr Opin исследует наркотики.2009. 10 (6): 597–605.

  • 182.

    Kuenen, Bart, et al. Фармакологическое исследование фазы I нецитумумаба (IMC-11F8), полностью человеческого моноклонального антитела IgG1, направленного против EGFR, у пациентов с запущенными солидными злокачественными новообразованиями. Clin Cancer Res. 2010. 16 (6): 1915–23.

  • 183.

    Макдермотт, Дэвид Ф. и др. Атезолизумаб, антитело против лиганда 1 запрограммированной смерти, при метастатическом почечно-клеточном раке: долгосрочная безопасность, клиническая активность и иммунные корреляты из исследования фазы Ia.J Clin Oncol. 2016; 34 (8): 833–42.

    CAS PubMed Статья PubMed Central Google Scholar

  • 184.

    Boyerinas, Benjamin, et al. Зависимая от антител цитотоксическая активность нового антитела против PD-L1 авелумаба (MSB0010718C) в отношении опухолевых клеток человека. Cancer Immun Res. 2015; 3 (10): 1148–57.

    CAS PubMed PubMed Central Статья Google Scholar

  • 185.

    Sofen, Howard, et al. Гуселкумаб (IL-23-специфическое mAb) демонстрирует клинический и молекулярный ответ у пациентов с псориазом средней и тяжелой степени. J Allergy Clin Immunol. 2014; 133 (4): 1032–40.

  • 186.

    Аль-Салама, Заина Т. Эмапалумаб: первое глобальное одобрение. Наркотики. 2019; 79 (1): 99–103.

    CAS PubMed Статья PubMed Central Google Scholar

  • 187.

    Kreitman, Robert J, et al. Моксетумомаб пасудотокс при рецидивирующем / рефрактерном волосатоклеточном лейкозе.Лейкемия. 2018; 32 (8): 1768.

  • 188.

    Берарди Р., Онофри А., Пистелли М., Маккарони Е., Скартоцци М., Пьерантони С. и др. Панитумумаб: доказательства его использования при лечении метастатического колоректального рака. Core Evid. 2010; 5: 61–76.

    CAS PubMed PubMed Central Статья Google Scholar

  • 189.

    Wong IT, Shojania K, Dutz J, Tsao NW. Клинико-экономический обзор секукинумаба при бляшечном псориазе средней и тяжелой степени.Эксперт Rev Pharmacoecon Outcomes Res. 2016; 16: 153–66.

    PubMed Статья PubMed Central Google Scholar

  • 190.

    Гибни Г.Т., Хамид О., Луцки Дж., Ольшански А.Дж., Митчелл Т.С., Гаевски Т.Ф. и др. Фаза 1/2 исследования эпакадостата в комбинации с ипилимумабом у пациентов с неоперабельной или метастатической меланомой. J Immunother Cancer. 2019; 7: 80.

    PubMed PubMed Central Статья Google Scholar

  • 191.

    Brahmer JR, Hammers H, Lipson EJ. Ниволумаб: нацелен на PD-1 для усиления противоопухолевого иммунитета. Будущее Онкол. 2015; 11: 1307–26.

    CAS PubMed Статья PubMed Central Google Scholar

  • 192.

    Adedokun OJ, Xu Z, Gasink C, Jacobstein D, Szapary P, Johanns J, et al. Фармакокинетика и взаимосвязь между воздействием и ответом устекинумаба у пациентов с болезнью Крона. Гастроэнтерология. 2018; 154: 1660–71.

    CAS PubMed Статья PubMed Central Google Scholar

  • 193.

    Скотт CT. Мыши с человеческим прикосновением. Nat Biotechnol. 2007; 25: 1075–7.

    CAS PubMed Статья PubMed Central Google Scholar

  • 194.

    Legouffe E, Liautard J, Gaillard JP, Rossi JF, Wijdenes J, Bataille R, et al. Ответ человеческого антимышиного антитела на инъекцию мышиных моноклональных антител против IL-6. Clin Exp Immunol. 1994; 98: 323–329.

    CAS PubMed PubMed Central Статья Google Scholar

  • 195.

    Аман П., Элин-Хенрикссон Б., Кляйн Г. Чувствительность нормальных популяций В-лимфоцитов человека к вирусу Эпштейна-Барра. J Exp Med. 1984; 159: 208–20.

    CAS PubMed Статья PubMed Central Google Scholar

  • 196.

    Traggiai E, Becker S, Subbarao K, Kolesnikova L, Uematsu Y, Gismondo MR, et al. Эффективный метод получения человеческих моноклональных антител из В-клеток памяти: эффективная нейтрализация коронавируса SARS. Nat Med.2004; 10: 871–5.

    CAS PubMed Статья PubMed Central Google Scholar

  • 197.

    Bonsignori M, Hwang KK, Chen X, Tsao CY, Morris L, Gray E, et al. Анализ клональной линии передачи конформационных эпитопов V2 / V3 оболочки ВИЧ-1, широко нейтрализующих антитела и их предполагаемых немутантных общих предков. J Virol. 2011; 85: 9998–10009.

    CAS PubMed PubMed Central Статья Google Scholar

  • 198.

    Купперс Р., Чжао М., Хансманн М.Л., Раевски К. Отслеживание развития В-клеток в зародышевых центрах человека путем молекулярного анализа отдельных клеток, взятых из гистологических срезов. EMBO J. 1993; 12: 4955–67.

    CAS PubMed PubMed Central Статья Google Scholar

  • 199.

    Смит К., Гарман Л., Враммерт Дж., Чжэн Нью-Йорк, Капра Дж. Д., Ахмед Р. и др. Быстрое образование полностью человеческих моноклональных антител, специфичных к вакцинирующему антигену.Nat Protoc. 2009. 4: 372–84.

    CAS PubMed PubMed Central Статья Google Scholar

  • 200.

    Обиакор Х., Сегал Д., Дассо Дж. Ф., Боннер Р.Ф., Малекафзали А., Маг Р.Г. Сравнение методов микродиссекции с помощью гидравлического и лазерного захвата для сбора единичных В-клеток, ПЦР и секвенирования антитела VDJ. Анальная биохимия. 2002. 306: 55–62.

    CAS PubMed Статья Google Scholar

  • 201.

    Тиллер Т., Меффре Э., Юрасов С., Цуйджи М., Нуссенцвейг М.С., Вардеманн Х. Эффективная генерация моноклональных антител из единичных В-клеток человека с помощью ОТ-ПЦР одиночных клеток и клонирования экспрессионного вектора. J Immunol Methods. 2008; 329: 112–24.

    CAS PubMed Статья Google Scholar

  • 202.

    Вардеманн Х., Юрасов С., Шефер А., Янг Дж. В., Меффре Э., Нуссенцвейг М.С. Преобладающая продукция аутоантител ранними предшественниками В-клеток человека.Наука. 2003; 301: 1374–7.

    CAS PubMed Статья Google Scholar

  • 203.

    Lagerkvist AC, Furebring C, Borrebaeck CA. Отдельные антиген-специфические В-клетки, используемые для создания Fab-фрагментов с использованием CD40-опосредованной амплификации или прямого клонирования ПЦР. Биотехники. 1995; 18: 862–9.

    CAS PubMed Google Scholar

  • 204.

    Battye FL, Light A, Tarlinton DM.Сортировка и клонирование отдельных клеток. J Immunol Methods. 2000; 243: 25–32.

    CAS PubMed Статья Google Scholar

  • 205.

    Scheid JF, Mouquet H, Feldhahn N, Walker BD, Pereyra F, Cutrell E, et al. Метод идентификации связывания gp140 ВИЧ В-клеток памяти в крови человека. J Immunol Methods. 2009; 343: 65–7.

    CAS PubMed Статья Google Scholar

  • 206.

    Herzenberg LA, Parks D, Sahaf B, Perez O, Roederer M, Herzenberg LA. История и будущее сортировщика клеток с активацией флуоресценции и проточной цитометрии: взгляд из Стэнфорда. Clin Chem. 2002; 48: 1819–27.

    CAS PubMed Google Scholar

  • 207.

    Лундквист А., Хорлинг Дж., Атлин Л., Розен А., Никлассон Б. Нейтрализация человеческих моноклональных антител против вируса Пуумала, возбудителя эпидемической нефропатии: новый метод с использованием покрытых антигеном магнитных шариков для выделения специфических В-клеток.J Gen Virol. 1993. 74 (Pt 7): 1303–10.

    CAS PubMed Статья Google Scholar

  • 208.

    Корреа И., Илиева К.М., Крешоли С., Ломбарди С., Фигини М., Чунг А. и др. Оценка антиген-конъюгированных флуоресцентных шариков для идентификации антиген-специфичных В-клеток. Фронт Иммунол. 2018; 9: 493.

    PubMed PubMed Central Статья CAS Google Scholar

  • 209.

    Weitkamp JH, Kallewaard N, Kusuhara K, Feigelstock D., Feng N, Greenberg HB, et al. Получение рекомбинантных человеческих моноклональных антител к ротавирусу из единичных антигенспецифических В-клеток, отобранных с помощью флуоресцентных вирусоподобных частиц. J Immunol Methods. 2003. 275: 223–37.

    CAS PubMed Статья Google Scholar

  • 210.

    Wu X, Yang ZY, Li Y, Hogerkorp CM, Schief WR, Seaman MS, et al. Рациональный дизайн оболочки позволяет идентифицировать широко нейтрализующие человеческие моноклональные антитела к ВИЧ-1.Наука. 2010. 329: 856–61.

    CAS PubMed PubMed Central Статья Google Scholar

  • 211.

    Scheid JF, Mouquet H, Feldhahn N, Seaman MS, Velinzon K, Pietzsch J, et al. Широкое разнообразие нейтрализующих антител, выделенных из В-клеток памяти у ВИЧ-инфицированных. Природа. 2009; 458: 636–40.

    CAS PubMed Статья Google Scholar

  • 212.

    Smith SA, de Alwis AR, Kose N, Jadi RS, de Silva AM, Crowe JE Jr. Изоляция B-клеток памяти, специфичных для вируса денге, с живым вирусным антигеном от людей после естественного заражения выявляет присутствие различных новых функциональных групп клоны антител. J Virol. 2014; 88: 12233–41.

    PubMed PubMed Central Статья CAS Google Scholar

  • 213.

    Woda M, Friberg H, Currier JR, Srikiatkhachorn A, Macareo LR, Green S, et al.Динамика В-клеток, специфичных к вирусу денге (DENV), в ответ на инфекции серотипа 1 DENV, с использованием проточной цитометрии с мечеными вирионами. J Infect Dis. 2016; 214: 1001–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 214.

    Coronella JA, Telleman P, Truong TD, Ylera F, Junghans RP. Амплификация IgG VH и VL (Fab) из одиночных человеческих плазматических клеток и В-клеток. Nucleic Acids Res. 2000; 28: E85.

    CAS PubMed PubMed Central Статья Google Scholar

  • 215.

    Враммерт Дж., Смит К., Миллер Дж., Лэнгли В.А., Кокко К., Ларсен С. и др. Быстрое клонирование высокоаффинных человеческих моноклональных антител против вируса гриппа. Природа. 2008; 453: 667–71.

    CAS PubMed PubMed Central Статья Google Scholar

  • 216.

    Джин А., Одзава Т., Тадзири К., Обата Т., Кондо С., Киношита К. и др. Быстрый и эффективный метод манипуляции с отдельными клетками для скрининга антиген-специфических антител-секретирующих клеток периферической крови человека.Nat Med. 2009; 15: 1088–92.

    CAS PubMed Статья Google Scholar

  • 217.

    Love JC, Ronan JL, Grotenbreg GM, van der Veen AG, Ploegh HL. Метод микрогравирования для быстрого отбора отдельных клеток, продуцирующих антиген-специфические антитела. Nat Biotechnol. 2006; 24: 703–7.

    CAS PubMed Статья Google Scholar

  • 218.

    Огунний А.О., Стори К.М., Папа Э., Гильен Э., Лав Дж.Скрининг отдельных гибридом методом микрогравировки для обнаружения моноклональных антител. Nat Protoc. 2009; 4: 767–82.

    CAS PubMed PubMed Central Статья Google Scholar

  • 219.

    Таджири К., Киши Х., Токимицу Й., Кондо С., Одзава Т., Киношита К. и др. Клеточно-микроматричный анализ антиген-специфических В-клеток: анализ экспрессии и специфичности рецептора антигена в отдельных клетках. Цитометрия А. 2007; 71: 961–7.

    PubMed Статья CAS Google Scholar

  • 220.

    Tokimitsu Y, Kishi H, Kondo S, Honda R, Tajiri K, Motoki K и др. Анализ отдельных лимфоцитов с помощью чипа с микролунками. Цитометрия А. 2007; 71: 1003–10.

    PubMed Статья CAS Google Scholar

  • 221.

    Smith K, Crowe SR, Garman L, Guthridge CJ, Muther JJ, McKee E, et al. Человеческие моноклональные антитела, полученные после вакцинации AVA, обеспечивают нейтрализацию, блокируя расщепление фурина, но не предотвращая олигомеризацию.Вакцина. 2012; 30: 4276–83.

    CAS PubMed PubMed Central Статья Google Scholar

  • 222.

    Chi X, Li J, Liu W., Wang X, Yin K, Liu J, et al. Получение и характеристика человеческих моноклональных антител, направленных на защитный антиген сибирской язвы, после вакцинации вакциной с рекомбинантным защитным антигеном. Clin Vacc Immunol: CVI. 2015; 22: 553–60.

    CAS Статья Google Scholar

  • 223.

    Рудкин Ф.М., Разиунайте И., Уоркман Х., Эссоно С., Бельмонте Р., МакКаллум Д.М. и др. Моноклональные антитела против Candida, полученные из единичных человеческих В-клеток, усиливают фагоцитоз и защищают от диссеминированного кандидоза. Nat Commun. 2018; 9: 5288.

    CAS PubMed PubMed Central Статья Google Scholar

  • 224.

    Cox KS, Tang A, Chen Z, Horton MS, Yan H, Wang XM, et al. Быстрое выделение нейтрализующих денге антител из отсортированных по единичным клеткам антиген-специфических культур В-клеток памяти человека.MAbs. 2016; 8: 129–40.

    CAS PubMed Статья Google Scholar

  • 225.

    Иидзука А., Комияма М., Тай С., Осита С., Курусу А., Куме А. и др. Идентификация антигенспецифических человеческих моноклональных антител цитомегаловируса (CMV) pp65 с использованием клонирования гена одного антитела на основе В-клеток от пациентов с меланомой. Immunol Lett. 2011; 135: 64–73.

    CAS PubMed Статья Google Scholar

  • 226.

    Tian C, Luskin GK, Dischert KM, Higginbotham JN, Shepherd BE, Crowe JE Jr. Иммунодоминантность генного сегмента антитела Vh2–46 в первичном репертуаре ротавирус-специфических В-клеток человека снижается в компартменте памяти посредством соматической мутации недоминантные клоны. J Immunol. 2008. 180: 3279–88.

    CAS PubMed Статья Google Scholar

  • 227.

    Ди Ниро Р., Месин Л., Раки М., Чжэн Нью-Йорк, Лунд-Йохансен Ф., Лундин К. Э. и др.Быстрое образование специфических для ротавируса моноклональных антител человека из слизистой оболочки тонкого кишечника. J Immunol. 2010; 185: 5377–83.

    PubMed Статья CAS Google Scholar

  • 228.

    Бейли М.Дж., Дуэхр Дж., Дулин Х., Броккер Ф., Браун Дж.А., Арумеми Ф.О. и др. Человеческие антитела, нацеленные на NS1 вируса Зика, обеспечивают защиту от болезни на мышиной модели. Nat Commun. 2018; 9: 4560.

    PubMed PubMed Central Статья CAS Google Scholar

  • 229.

    Буши Р.Т., Муди М.А., Найсли Н.Л., Хейнс Б.Ф., Алам С.М., Кейр С.Т. и др. Терапевтическое антитело против рака, полученное из одиночных В-клеток человека. Cell Rep. 2016; 15: 1505–13.

    CAS PubMed PubMed Central Статья Google Scholar

  • 230.

    Корти Д., Мисаси Дж., Мулангу С., Стэнли Д.А., Канекиё М., Воллен С. и др. Защитная монотерапия против летальной инфекции вируса Эбола с помощью мощно нейтрализующего антитела. Наука. 2016; 351: 1339–42.

    CAS PubMed Статья Google Scholar

  • 231.

    Риджал П., Элиас С.К., Мачадо С.Р., Сяо Дж., Шимански Л., О’Дауд В. и др. Терапевтические моноклональные антитела против инфекции вируса Эбола, полученные от вакцинированных людей. Cell Rep. 2019; 27: 172–86 e7.

    CAS PubMed Статья Google Scholar

  • 232.

    Борнхольдт З.А., Тернер Х.Л., Мурин С.Д., Ли В., Сок Д., Судерс Калифорния и др.Выделение мощных нейтрализующих антител от человека, пережившего вспышку вируса Эбола в 2014 году. Наука. 2016; 351: 1078–83.

    CAS PubMed PubMed Central Статья Google Scholar

  • 233.

    Awi NJ, Teow SY. Антитело-опосредованная терапия против ВИЧ / СПИДа: где мы сейчас находимся? J Pathog. 2018; 2018: 8724549.

    PubMed PubMed Central Статья CAS Google Scholar

  • 234.

    Ногалес А., Пипенбринк М.С., Ван Дж., Ортега С., Басу М., Фусиле С.Ф. и др. Высокоэффективное и широко нейтрализующее человеческое моноклональное антитело против гриппа h2. Научный доклад 2018; 8: 4374.

    PubMed PubMed Central Статья CAS Google Scholar

  • 235.

    Fu Y, Zhang Z, Sheehan J, Avnir Y, Ridenour C, Sachnik T, et al. Широко нейтрализующие антитела против гриппа демонстрируют постоянную способность гемагглютинин-специфических В-клеток памяти к эволюции.Nat Commun. 2016; 7: 12780.

    CAS PubMed PubMed Central Статья Google Scholar

  • 236.

    Накамура Г., Чай Н., Парк С., Чианг Н., Лин З, Чиу Х и др. Метод обогащения плазмобластов человека in vivo позволяет быстро идентифицировать терапевтические антитела против гриппа А. Клеточный микроб-хозяин. 2013; 14: 93–103.

    CAS PubMed Статья Google Scholar

  • 237.

    Чай Н., Свем Л. Р., Парк С., Накамура Г., Чианг Н., Эстевес А. и др. Широко защитное терапевтическое антитело против вируса гриппа B с двумя механизмами действия. Nat Commun. 2017; 8: 14234.

    CAS PubMed PubMed Central Статья Google Scholar

  • 238.

    Gilman MS, Castellanos CA, Chen M, Ngwuta JO, Goodwin E, Moin SM, et al. Быстрое профилирование репертуаров антител к RSV из В-клеток памяти естественно инфицированных взрослых доноров.Sci Immunol. 2016; 1.

    PubMed PubMed Central Статья Google Scholar

  • 239.

    Goodwin E, Gilman MSA, Wrapp D, Chen M, Ngwuta JO, Moin SM, et al. Младенцы, инфицированные респираторно-синцитиальным вирусом, вырабатывают мощные нейтрализующие антитела, у которых отсутствует соматическая гипермутация. Иммунитет. 2018; 48: 339–49 e5.

    CAS PubMed PubMed Central Статья Google Scholar

  • 240.

    Дориа-Роуз Н.А., Джойс М.Г. Стратегии управления процессом созревания аффинности антител. Curr Opin Virol. 2015; 11: 137–47.

    CAS PubMed PubMed Central Статья Google Scholar

  • 241.

    Eisen HN. Повышение аффинности антител: как антитела с низким сродством, продуцируемые на ранних этапах иммунного ответа, сопровождаются антителами с высоким сродством позже и в ответах B-клеток памяти. Cancer Immunol Res. 2014; 2: 381–92.

    CAS PubMed Статья Google Scholar

  • 242.

    Sliwkowski MX, Mellman I. Терапия антителами при раке. Наука. 2013; 341: 1192–8.

    CAS PubMed Статья Google Scholar

  • 243.

    Макабе К., Наканиши Т., Цумото К., Танака Ю., Кондо Х., Умецу М. и др. Термодинамические последствия мутаций в остатках зоны верньера гуманизированного антитела мыши против рецептора эпидермального фактора роста человека, 528.J Biol Chem. 2008. 283: 1156–66.

    CAS PubMed Статья Google Scholar

  • 244.

    Hoogenboom HR. Отбор и скрининг библиотек рекомбинантных антител. Nat Biotechnol. 2005; 23: 1105–16.

    CAS PubMed Статья Google Scholar

  • 245.

    Хо М., Крейтман Р.Дж., Онда М., Пастан И. Эволюция антител in vitro, нацеленная на горячие точки зародышевой линии, для повышения активности иммунотоксина против CD22.J Biol Chem. 2005; 280: 607–17.

    CAS PubMed Статья Google Scholar

  • 246.

    Thie H, Voedisch B, Dübel S, Hust M, Schirrmann T. Созревание сродства с помощью фагового дисплея. В: Димитров А.С., редактор. Терапевтические антитела. Тотова: Humana Press; 2009. с. 309–22.

    Глава Google Scholar

  • 247.

    Steinwand M, Droste P, Frenzel A, Hust M, Dübel S, Schirrmann T.Влияние формата фрагмента антитела на созревание аффинности IgG на основе фагового дисплея. MAbs. 2013; 6: 204–18.

    PubMed Central Статья PubMed Google Scholar

  • 248.

    Low NM, Holliger PH, Winter G. Имитация соматической гипермутации: аффинное созревание антител, отображаемых на бактериофаге, с использованием штамма бактериального мутатора. J Mol Biol. 1996. 260: 359–68.

    CAS PubMed Статья Google Scholar

  • 249.

    Marks JD. Созревание аффинности антител путем перетасовки цепей. Методы Мол биол. 2004; 248: 327–43.

    CAS PubMed Google Scholar

  • 250.

    Nielsen UB, Marks JD. Созревание аффинности фаговых антител. В: Clackson T, Lowman HB, редакторы. Фаговый дисплей: практический подход. Оксфорд: издательство Оксфордского университета; 2004. с. 360.

    Google Scholar

  • 251.

    Saunders KO.Концептуальные подходы к модуляции эффекторных функций антител и периода полужизни циркуляции. Фронт Иммунол. 2019; 10: 1296.

    PubMed PubMed Central Статья Google Scholar

  • 252.

    Келли РФ, Мэн Ю.Г. Способы конструирования и идентификации вариантов IgG1 с улучшенным связыванием FcRn или эффекторной функцией. Методы Мол биол. 2012; 901: 277–93.

    CAS PubMed Статья Google Scholar

  • 253.

    Лю З., Гунасекаран К., Ван В., Разинков В., Секиров Л., Ленг Е. и др. Асимметричная инженерия Fc значительно усиливает эффекторную функцию антителозависимой клеточной цитотоксичности (ADCC) и стабильность модифицированных антител. J Biol Chem. 2014; 289: 3571–90.

    CAS PubMed Статья Google Scholar

  • 254.

    Monnet C, Jorieux S, Souyris N, Zaki O, Jacquet A, Fournier N, et al. Комбинированная инженерия глико- и белок-Fc одновременно увеличивает цитотоксичность и время полужизни терапевтического антитела.MAbs. 2014; 6: 422–36.

    PubMed PubMed Central Статья Google Scholar

  • 255.

    Мимура Ю., Като Т., Салдова Р., О’Флаэрти Р., Изуми Т., Мимура-Кимура Ю. и др. Инженерия гликозилирования терапевтических антител IgG: проблемы безопасности, функциональности и эффективности. Белковая клетка. 2018; 9: 47–62.

    CAS PubMed Статья Google Scholar

  • 256.

    Li T, DiLillo DJ, Bournazos S, Giddens JP, Ravetch JV, Wang LX. Модуляция эффекторной функции IgG с помощью Fc-гликановой инженерии. Proc Natl Acad Sci U S. A. 2017; 114: 3485–90.

    CAS PubMed PubMed Central Статья Google Scholar

  • 257.

    Chen CL, Hsu JC, Lin CW, Wang CH, Tsai MH, Wu CY, et al. Кристаллическая структура гомогенной гликоформы IgG-Fc с N-гликаном, разработанной для максимизации антителозависимой клеточной цитотоксичности.ACS Chem Biol. 2017; 12: 1335–45.

    PubMed Статья CAS Google Scholar

  • 258.

    Lin CW, Tsai MH, Li ST, Tsai T.I, Chu KC, Liu YC, et al. Общая структура гликанов иммуноглобулина G для усиления эффекторных функций. Proc Natl Acad Sci U S. A. 2015; 112: 10611–6.

    CAS PubMed PubMed Central Статья Google Scholar

  • 259.

    Нери Д.Слияния антитело-цитокин: универсальные продукты для модуляции противоопухолевого иммунитета. Cancer Immunol Res. 2019; 7: 348–54.

    PubMed Статья Google Scholar

  • 260.

    Бек А., Гетч Л., Дюмонте С., Корвайя Н. Стратегии и проблемы для следующего поколения конъюгатов антитело-лекарственное средство. Nat Rev Drug Discov. 2017; 16: 315.

    CAS PubMed Статья Google Scholar

  • 261.

    Larson SM, Carrasquillo JA, Cheung N-KV, Press OW. Радиоиммунотерапия опухолей человека. Нат Рев Рак. 2015; 15: 347.

    CAS PubMed PubMed Central Статья Google Scholar

  • 262.

    Labrijn AF, Janmaat ML, Reichert JM, Parren PWHI. Биспецифические антитела: механистический обзор конвейера. Nat Rev Drug Discov. 2019.

  • 263.

    Ohradanova-Repic A, Nogueira E, Hartl I, Gomes AC, Preto A, Steinhuber E, et al.Липосомы, функционализированные фрагментами Fab-антитела, для специфического нацеливания на антиген-положительные клетки. Наномедицина. 2018; 14: 123–30.

    CAS PubMed Статья Google Scholar

  • 264.

    Лу Р-М, Чанг И-Л, Чен М-С, Ву Х-К. Одноцепочечные наночастицы, конъюгированные с антителом против c-Met, для нацеленной на опухоль визуализации и доставки лекарств in vivo. Биоматериалы. 2011; 32: 3265–74.

    CAS PubMed Статья PubMed Central Google Scholar

  • 265.

    Июнь CH, Саделайн М. Терапия с химерными антигенными рецепторами. N Engl J Med. 2018; 379: 64–73.

    CAS PubMed Статья Google Scholar

  • 266.

    June CH, O’Connor RS, Kawalekar OU, Ghassemi S, Milone MC. CAR Т-клеточная иммунотерапия рака человека. Наука. 2018; 359: 1361–5.

    CAS PubMed Статья Google Scholar

  • 267.

    Neelapu SS, Locke FL, Bartlett NL, Lekakis LJ, Miklos DB, Jacobson CA, et al.Axicabtagene Ciloleucel CAR Т-клеточная терапия при резистентной крупноклеточной B-лимфоме. N Engl J Med. 2017; 377: 2531–44.

    CAS PubMed PubMed Central Статья Google Scholar

  • 268.

    Schuster SJ, Bishop MR, Tam CS, Waller EK, Borchmann P, McGuirk JP, et al. Tisagenlecleucel при рецидивирующей или рефрактерной диффузной крупноклеточной лимфоме у взрослых. N Engl J Med. 2019; 380: 45–56.

    CAS PubMed Статья Google Scholar

  • 269.

    Park JH, Rivière I, Gonen M, Wang X, Sénéchal B, Curran KJ, et al. Долгосрочное наблюдение за терапией CD19 CAR при остром лимфобластном лейкозе. N Engl J Med. 2018; 378: 449–59.

    CAS PubMed PubMed Central Статья Google Scholar

  • 270.

    Maude SL, Laetsch TW, Buechner J, Rives S, Boyer M, Bittencourt H, et al. Tisagenlecleucel у детей и подростков с В-клеточной лимфобластной лейкемией. N Engl J Med. 2018; 378: 439–48.

    CAS PubMed PubMed Central Статья Google Scholar

  • 271.

    Brudno JN, Kochenderfer JN. Т-клеточная терапия химерного антигенного рецептора лимфомы. Нат Рев Клин Онкол. 2017; 15:31.

    PubMed Статья CAS Google Scholar

  • 272.

    Chen IC, Chiu YK, Yu CM, Lee CC, Tung CP, Tsou YL, et al. Высокопроизводительное открытие нейтрализующих антител к вирусу гриппа из библиотек синтетических антител, отображаемых на фаге.Научный доклад 2017; 7: 14455.

    PubMed PubMed Central Статья CAS Google Scholar

  • 273.

    Баррето К., Марутачалам Б.В., Хилл В., Хоган Д., Сазерленд А.Р., Кусалик А. и др. Идентификация и реконструкция комбинаций CDR антител на основе результатов отбора фагов с помощью секвенирования нового поколения. Nucleic Acids Res. 2019.

  • 274.
  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *