Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Содержание

Шкаф ШПЭСМ-3М с пароувлажнением

Шкафы пекарные предназначены для выпечки хлебобулочных и кондитерких изделий, жарки мяса, птицы, рыбы, запекания кулинарных изделий, блюд из овощей, круп, фруктов, полуфабрикатов. Шкафы ШПЭСМ-3М, с пароувлажнением, снабжены переключателями для регулировки мощьности ТЕН (верх, низ), благодаря чему достигается слабый, средний или сильный нагрев. Это позволяет использовать шкафы для приготовления блюд, требующих различной интенсивности нагрева вверху и внизу камеры, а также для медленного нагрева, что дает возможность применять любую камеру шкафа для расстойки теста или сушки изделий. Шкаф пекарский электрический, 3-х секционный, черн.металл, дверцы оцинк.металл, разм.противней 450х650х20, Температура, до 300С°


Характеристики

Модель ШПЭСМ-3М (с п/ув)

Вес брутто 383

Вес нетто 382

Габариты 1200x1040x1500 мм

Габариты в упаковке 1200x1040x1600 мм полиэтилен, без поддона

Напряжение 380 В

Потребляемая мощность 15,6кВт

Производительность 60шт/час

Производитель Торгмаш, Люберцы

Шкаф пекарский электрический ШПЭСМ-3

Характеристики

  • Производитель Торгмаш (Люберцы)
  • Модель
    ШПЭСМ-3
  • Количество секций 3
  • Формат емкостей противни 450х650 мм
  • Напряжение, В 380
  • Мощность, кВт 15,6
  • Габариты (ДхШхВ), мм 1200 x1040x1500
  • Вес, кг 382
  • Артикулt1579
  • Срок поставки
    в наличии

Описание товара

Пекарский шкаф ШПЭСМ-3 — это профессиональный аппарат для выпечки хлебобулочных изделий (булочек, рогаликов, пирожков). Данное устройство можно встретить на предприятиях общепита, в столовых, кафе, на минипекарнях или в кондитерских цехах. Это объясняется тем, что пекарский шкаф имеет простую конструкцию и для эксплуатации не потребуется специально обучать персонал.
Технические особенности

Устройство. Электрический пекарский шкаф имеет три камеры, каждая из которых работает независимо и вмещает 60 белых батонов. ТЭНы, размещенные в двух зонах (верхней и нижней), осуществляют нагрев. Каждый ярус укомплектован собственным регулятором температуры, она варьируется от 50 до 300 градусов. Передняя и боковые панели изготовлены из черного металла, а дверцы сделаны из оцинкованного.

Рабочий процесс. Противни или хлебопекарные формы устанавливаются в камеры, где на продукт оказывается тепловое воздействие. Нагретый воздух перемещается самостоятельно, без внешнего влияния. Параметры температуры задаются оператором при помощи терморегуляторов.

Преимущества модели ШПЭСМ-3:
удобство в использовании. Шкаф снабжен переключателями, предназначенными для регулировки мощности нагревательных элементов. Благодаря этому достигается сильный, слабый или средний нагрев, поэтому оборудование можно использовать для приготовления блюд, которые требуют различной степени нагрева внизу и вверху камеры. Кроме того, агрегат применяется для медленного нагревания, поэтому в камере можно расстаивать тесто; высокая производительность. Аппарат мощностью 15600 Вт в час производит 60 белых батонов, поэтому устройство может использоваться на пищевых предприятиях со средним объемом работ. 

Отзывы о товаре Шкаф пекарский электрический ШПЭСМ-3

Отзывов о данном товаре не найдено.


Добавить отзыв

Похожие товары

Похожие производители

Шкаф пекарский - Махачкала +7988-29-29-100

Вы здесь: > Оборудование для ВЫПЕЧКИ, ПЕКАРНИ > Печи подовые > ТОРГМАШ > Шкаф пекарский ШПЭСМ-3М С ПАРОУВЛАЖНЕНИЕМ

Описание Шкаф пекарский ШПЭСМ-3М С ПАРОУВЛАЖНЕНИЕМ

Шкаф пекарский ШПЭСМ-3М снабжен переключателями для регулировки мощьности ТЕН (верх, низ), благодаря чему достигается слабый, средний или сильный нагрев.

Это позволяет использовать шкафы для приготовления блюд, требующих различной интенсивности нагрева вверху и внизу камеры, а так же для медленного нагрева, что дает возможность применять любую камеру шкафа для расстойки теста или сушки изделий.

Предназначен для выпечки хлебобулочных и кондитерких изделий, жарки мяса, птицы, рыбы, запекания кулинарных изделий, блюд из овощей, круп, фруктов, полуфабрикатов. 

3 пекарные камеры. Модель снабжена дополнительными переключателями, позволяющими автономно включать группы ТЭНов (верх, низ) и регулировать интенсивность их нагрева. Внутренний размер пекарной камеры 1000х760х180 мм.

Рабочая температура в пекарной камере 100-300 С. Время разогрева камеры до 280 С - не более 40 мин. Материал облицовки дверей - оцинкованная сталь.

В комплекте противни (борт с 4-х сторон) из конструкционной стали размером 650х450х20 мм, подставка под шкаф.

Производительность 54 кг/час.  Производительность выпечки формового хлеба в смену, 60 шт. /час. Размер противня 470х660х20.

Характеристики Шкаф пекарский ШПЭСМ-3М С ПАРОУВЛАЖНЕНИЕМ

Ширина

1200 мм

Мощность

15,6 кВт

Глубина

1040 мм

Напряжение

380 В

Высота

1500 мм

Вес

382 кг

Отзывы о Шкаф пекарский ШПЭСМ-3М С ПАРОУВЛАЖНЕНИЕМ

ШПЭСМ-3-02М для ресторанов и кафе в Москве

← →

Комплектация:
  • Шкаф пекарский - 1 шт.
Особенности:
  • По специальному требованию все шкафы могут быть укомплектованы пароувлажнением.
  • Нагревание происходит за счет ТЭНов расположенных в камере пекарского шкафа. Пекарские шкафы могут работать как самостоятельно, так и в составе технологических линий производства.
 

Цена по запросу

Купить

Заполните форму заказа и наш менеджер перезвонит вам в течение дня. Все необходимые аксессуары и другие товары, вы сможете добавить к заказу при телефонном разговоре с менеджером.

Получить скидку

Отправьте нам запрос на выбранный Вами товар с ценой, которая могла бы Вас заинтересовать, и мы постараемся предложить удовлетворяющий Вас вариант по данному товару или подобрать его функциональный аналог.

Отправьте нам запрос на выбранный Вами товар с ценой, которая могла бы Вас заинтересовать, и мы постараемся предложить удовлетворяющий Вас вариант по данному товару или подобрать его функциональный аналог.

Закажите бесплатную консультацию!
И в течение 15 минут с вами свяжется наш консультант.

Напряжение, В
380
Вес, кг 340
Установленная мощность, кВт 10,4
Габаритные размеры (мм) 1205х1040х1205
Диапазон регулирования температуры, град. С до 300
Количество пекарных камер, шт. 2
Масса в упаковке, кг - massa_v_upakovke_kg 374

И в течение 15 минут с вами свяжется наш консультант.

Закажите бесплатную консультацию!
И в течение 15 минут с вами свяжется наш консультант.

 
Описание товара:

Шкафы пекарские ШПЭСМ-3-02М предназначены для выпечки хлебобулочных и кондитерких изделий, жарки мяса, птицы, рыбы, запекания кулинарных изделий, блюд из овощей, круп, фруктов, полуфабрикатов.

Шкафы снабжены переключателями для регулировки мощности ТЕН (верх, низ), благодаря чему достигается слабый, средний или сильный нагрев. Это позволяет использовать шкафы для приготовления блюд, требующих различной интенсивности нагрева вверху и внизу камеры, а также для медленного нагрева, что дает возможность применять любую камеру шкафа для расстойки теста или сушки изделий. 

Ненормальное количество сперматозоидов - Специалист по мужской репродуктивной системе в Лос-Анджелесе

Для большинства мужчин или пар, обращающихся за лечением от бесплодия, одним из первых действий, которые предпринимают наши специалисты по репродуктивности, является заказ полного анализа спермы. Эта серия лабораторных тестов оценивает образец эякулята, точно измеряя множество факторов, чтобы определить, есть ли аномальное количество сперматозоидов или другие проблемы, которые могут повлиять на способность мужчины стать отцом ребенка.

Поскольку результаты анализа спермы могут со временем меняться, ваш специалист по мужскому фертильности в Лос-Анджелесе может пожелать повторить анализ, чтобы получить полную и точную информацию об аномальном количестве сперматозоидов или любом другом мужском факторе, который может способствовать бесплодию.

Аномальное количество сперматозоидов - лишь часть истории

Анализ спермы не просто определяет, имеет ли партнер-мужчина низкое или ненормальное количество сперматозоидов. Эти комплексные тесты измеряют несколько факторов, связанных с качеством, количеством и движением сперматозоидов, и могут указать, нормально ли функционирует мужская репродуктивная система.

  • Общий объем . Нормальный объем 2-4 мл. Очень низкий объем может указывать на проблему с выделением семенной жидкости, закупорку протоков или проблему с простатой.
  • Количество сперматозоидов . Нормальный диапазон составляет от 40 до 300 миллионов сперматозоидов на мл жидкости. Хотя количество менее 15 миллионов считается ненормальным, количество от 20 до 30 миллионов может быть достаточным для достижения беременности, если другие факторы сперматозоидов в норме.
  • Подвижность и скорость . Обычно должно двигаться не менее 40-50% сперматозоидов. Качество движения, оцениваемое по шкале от 0 до 4, должно быть 2 или выше.
  • Морфология . По крайней мере, 4% сперматозоидов должны иметь нормальную форму для плавания и оплодотворения.При использовании строгого морфологического теста Крюгера нормальный результат - 14% или более сперматозоидов имеют головку нормальной формы.
  • Разжижение . Нормальный результат - разжижение коагулированного эякулята в течение 20 минут после эякуляции. Проблемы с разжижением могут быть вызваны проблемами с семенными пузырьками или повышенным уровнем лейкоцитов.
  • Семенная фруктоза . Если сперматозоиды не видны, этот тест может помочь выявить наличие закупорки или структурных аномалий.

В зависимости от результатов анализа спермы могут быть заказаны дополнительные тесты, например:

  • Культуры для выявления заболеваний, передающихся половым путем или бактериальных инфекций
  • Генетические тесты для проверки хромосомных аномалий или генетических нарушений
  • Анализы крови для определения уровня тестостерона и других гормонов

В зависимости от результатов анализов некоторым мужчинам с аномальным количеством сперматозоидов может потребоваться посещение уролога для дальнейшего обследования и оценки.

Пройдите тестирование и получите ответы

Чтобы узнать больше об аномальном количестве сперматозоидов или назначить встречу со специалистом по мужскому фертильности в Лос-Анджелесе, свяжитесь с нами.

Dupont и 3M сталкиваются с растущим списком судебных исков о загрязнении воды - Quartz

Нью-Гэмпшир - последний штат, который подал иск против ряда компаний, включая Dupont и 3M, за их роль в общенациональном кризисе загрязнения питьевой воды. В иске утверждается, что загрязненная вода является результатом производства и использования перфторированных химикатов, группы из более чем 4000 соединений, известных под общим названием PFAS.

Иск в Нью-Гэмпшире, объявленный в среду (29 мая), присоединяется к нескольким другим групповым искам и искам штата по всей стране.

В жалобах утверждается, что компании «не предупредили об опасности своей продукции». Они также утверждают, что компании знали, что выброс соединений в окружающую среду «сделает грунтовые и поверхностные воды непригодными для питья».

ПФАС используются для производства широкого спектра продуктов, особенно всего, что предназначено для придания поверхностей антипригарным или жаропрочных.Они использовались для создания водонепроницаемой одежды и обуви на протяжении десятилетий (Gore-Tex, например, пообещал удалить все перфторированные соединения из своего снаряжения к 2023 году - на веб-сайте Gore-Tex они упоминаются как PFC). Известным соединением группы является ПФОК, перфторированное соединение, которое используется для изготовления тефлонового антипригарного покрытия Dupont.

Другое из этих соединений, известное как ПФОС, является основным ингредиентом широко применяемой противопожарной пены, что привело к широкому распространению загрязнения вокруг военных баз, аэропортов и учебных центров пожарных.На данный момент Пентагон обнаружил ПФОС в подземных и питьевых водах на 126 военных базах.

Чтобы понять, что здесь происходит, нужно понимать масштаб проблемы. За последнее десятилетие многие штаты США и страны по всему миру постепенно осознали, что перед ними стоит серьезная проблема загрязнения воды. ПФАС были и в некоторых случаях продолжают оставаться широко используемыми химическими веществами, которые не разлагаются в окружающей среде, и последствия воздействия на здоровье повышенных уровней этого вещества только начинают изучаться.

ПФАС в настоящее время обнаруживаются в низких концентрациях в крови практически каждого человека. Центры США по контролю и профилактике заболеваний обнаружили ПФОК в крови почти каждого человека, которого они тестировали. В США PFAS загрязняет питьевую воду около 19 миллионов человек в 43 штатах.

Виновные компании - такие как DuPont и 3M - знали о потенциальных последствиях для здоровья, но, как и Exxon с изменением климата, предпочли не публиковать свои выводы. Сегодня исследования связывают повышенное воздействие ПФАС с повышенным риском рака, бесплодием и задержкой развития.Одно исследование показало, что молодые люди, живущие недалеко от участка PFAS в Венето, Италия, имели меньшие пенисы и меньшее количество сперматозоидов.

Противопожарная пена является предметом судебного разбирательства в Нью-Гэмпшире, в котором говорится о загрязнении грунтовых вод возле базы ВВС Пиз и на нескольких пожарных станциях по всему штату.

В иске упоминаются компании 3M, DuPont, Chemours Company, Chemguard Inc. и ряд розничных продавцов противопожарных пен в том, что они поставили под угрозу общественное благосостояние своей продукцией.

Нью-Гэмпшир присоединяется к постоянно растущему списку тяжущихся сторон. В Нью-Йорке и Нью-Джерси продолжаются судебные процессы против 3M, Dupont и других компаний, которые производили и использовали составы PFAS. В 2017 году DuPont и его дочернее предприятие Chemours урегулировали иск с примерно 3500 жителями в Огайо и Западной Вирджинии, согласившись заплатить 671 миллион долларов за загрязнение территории вокруг производственного предприятия в Паркерсбурге, Западная Вирджиния.

Коллективные иски в отношении лиц, подвергшихся воздействию воды, загрязненной PFAS, возникли в Колорадо, Мичигане, Нью-Йорке и Пенсильвании.В прошлом году был подан общенациональный иск. В 2018 году Северная Каролина урегулировала свой иск на сумму 13 миллионов долларов и требование о том, чтобы Chemours обеспечила «постоянные запасы питьевой воды» для жителей, чьи колодцы были загрязнены.

Этот пост был обновлен, чтобы прояснить постепенный отказ Gore-Tex от перфторированных компаундов: компания исключила ПФОК из своего оборудования в 2013 году. Она пообещала постепенно исключить другие перфторированные соединения из своего оборудования к 2023 году.

Жюри Пенсаколы присуждает 7 долларов.1M in bellwether

Jim Little, Pensacola News Journal Опубликовано в 6:00 по московскому времени 4 мая 2021 г.

ЗАКРЫТЬ

Более 230 000 военнослужащих и ветеранов могли получить миллионы убытков против 3M Co. после того, как жюри Пенсакола признало транснациональную корпорацию виновной в потере слуха из-за дефектных беруш, которые компания продавала военным в течение 12 лет.

В пятницу жюри присяжных присудило компенсацию на сумму более 7,1 миллиона долларов трем бывшим военнослужащим из Кентукки и Джорджии в первом «первоочередном судебном процессе» масштабного и сложного судебного процесса против компании.

Если вердикт останется в силе - и если аналогичные вердикты будут достигнуты в ходе других судебных процессов - 3M может выплатить миллионы военнослужащим, которые использовали беруши Combat Arms версии 2 (CAEv2).

3M и ее дочерняя компания Aearo Technologies продали беруши Министерству обороны с 2003 по 2015 год, и они стали стандартными берушами для военнослужащих, несущих службу на передовых позициях в Ираке и Афганистане.

Судебный процесс 3M сосредоточен в Пенсаколе: Судья Пенсаколы взвешивает иск, в котором утверждается, что беруши 3M повредили слух ветеранов

Купить фото

В иске утверждается, что производитель 3M поставил дефектные беруши в США.С. военнослужащих и нанесли ущерб слуху тысячам военнослужащих, ветеранов и гражданских лиц. (Фото: Специально для журнала Pensacola News Journal)

Беруши в форме футбольного мяча были разработаны так, чтобы блокировать все звуки, когда они вставлены в одну сторону, и пропускать разговорные звуки, когда они вставляются в другую сторону. Но, согласно иску, 3M скрыла от правительства важную информацию об их правильном использовании.

Документы показали, что в ходе судебного процесса против 3M в 2016 году, в ходе которого осведомители были осведомлены о недостатках конструкции продукта. В иске 2016 года компания 3M рассчиталась с правительством и выплатила 9,1 миллиона долларов, не принимая на себя никаких обязательств.

Иск 2016 года привел к подаче текущего иска в Окружной суд США в Пенсаколе. В иске утверждается, что военнослужащие и гражданские подрядчики, которые использовали беруши, постоянно теряли слух, полагая, что их защищают беруши 3M.

Иск - это так называемое массовое деликтное разбирательство в нескольких округах (MDL), когда каждый человек с иском должен подать иск в суд.Дело привлекло более 230 000 истцов, став крупнейшим массовым правонарушением в леях в истории США.

Чтобы рассмотреть так много истцов, суд отбирает нескольких для участия в полном судебном разбирательстве, известном как судебные разбирательства, чтобы увидеть, будут ли претензии выдержаны перед присяжными, и, если они будут доказаны, какой размер ущерба присудит присяжные.

В пятницу присяжные в Пенсаколе установили, что компания 3M несет ответственность в первом из по крайней мере трех запланированных судебных разбирательств. После пятинедельного судебного разбирательства присяжные присудили истцам, Льюису Киферу и Люку Эстесу из Джорджии, а также Стивену Хакеру из Кентукки в общей сложности 7 долларов.1 миллион.

Эстес получила 36 000 долларов за медицинские расходы, 147 500 долларов за потерянный заработок, 167 000 долларов за боль и страдания и 2,1 миллиона долларов за штрафные убытки против 3M.

Кифер получил компенсацию в размере 40 000 долларов США за медицинские расходы, 120 000 долларов США за упущенную выгоду, 160 000 долларов США за боль и страдания и 2,1 миллиона долларов за возмещение убытков против компании 3M.

Hacker был награжден 160 000 долларов за боль и страдания и 2,1 миллиона долларов в качестве штрафных санкций против 3M.

3M и ее поверенные утверждали, что беруши были разработаны в соответствии с государственными спецификациями и не были дефектными.

Адвокаты истцов - Брайан Эйлсток из Пенсаколы; Шелли Хатсон в Хьюстоне, штат Техас; и Кристофер Сигер из Риджфилд-Парка, штат Нью-Джерси, - заявили, что истцы проявили храбрость, служа своей стране, а теперь выступили против 3M.

«Доказательства очевидны: компания 3M знала, что их беруши неисправны, но они позволили нашим военнослужащим получить эти изменяющие жизнь травмы», - говорится в заявлении. «Мы с нетерпением ждем начала второго судебного процесса над лидером 17 мая и полного возложения на 3M ответственности за ущерб, который они причинили тем, кто служил нашей стране.«

Дополнительные судебные процессы также пройдут в Пенсаколе.

3M опубликовала заявление после вынесения вердикта, в котором говорится, что она по-прежнему уверена в своей позиции и готова защищать себя в других предстоящих судебных процессах. обжаловать приговор по этому делу.

«Мы не считаем, что истцы выполнили свое бремя доказывания того, что продукт CAEv2 был сконструирован с дефектами или по небрежности или причинил предполагаемые травмы каждому истцу», - говорится в заявлении 3M.«Хотя мы разочарованы и не согласны с сегодняшними приговорами, они являются лишь первым шагом в этом судебном процессе».

Джим Литтл можно связаться по электронной почте [email protected] com и 850-208-9827.

Прочтите или поделитесь этой историей: https://www.pnj.com/story/news/local/pensacola/2021/05/04/pensacola-jury-awards-7-million-bellwether-trial-over-3 -m-military-беруши / 4927255001/

заявление о позиции Итальянского общества андрологии и сексуальной медицины (SIAMS) (Società Italiana di Andrologia e Medicina della Sessualità)

J Endocrinol Invest.2020 27 мая: 1–5.

, 1 , 2 , 3 , 3 , 3 , 4 , 5 , 6 , 7 , 8 , 940 9014 , 7 , 11 , 3 , 12 и 3

G. Corona

1 Отделение эндокринологии, Медицинское отделение, Госпиталь Маджоре-Беллария, Ларго Нигризоли 2, 40133 Болонья, Италия 9

E. Baldi

2 Кафедра экспериментальной и клинической медицины, Университет Флоренции, Флоренция, Италия

A.

М. Исидори

3 Кафедра экспериментальной медицины, Римский университет «Сапиенца», Рим, Италия

Д. Паоли

3 Кафедра экспериментальной медицины, Римский университет «Сапиенца», Рим, Италия

Ф. Паллотти

3 Отделение экспериментальной медицины, Римский университет «Сапиенца», Рим, Италия

Л. Де Сантис

4 Отделение ЭКО, акушерско-гинекологическое отделение, Научный институт Сан-Рафаэле, Университет Вита-Салюте, Милан, Италия

F.Франкавилла

5 Отделение андрологии, Департамент клинической медицины, общественного здравоохранения, наук о жизни и окружающей среде, Университет Л'Акуила, Л'Акуила, Италия

С. Ла Виньера

6 Департамент клинической и экспериментальной медицины , Университет Катании, Катания, Италия

R. Selice

7 Медицинский факультет, Отделение андрологии и репродуктивной медицины, Университет Падуи, Падуя, Италия

L.

Caponecchia

8 Андрология и патофизиология Отделение репродукции, больница Санта-Мария-Горетти, Латина, Италия

R.Пивонелло

9 Отделение медицинской клиники и хирургии, Отдел эндокринологии, Отделение андрологии и медицины, производственное и женское основание (FERTISEXCARES), Неаполитанский университет; Сотрудники кафедры санитарного просвещения и устойчивого развития ЮНЕСКО, Университет Федерико II, Неаполь, Италия

А. Ферлин

10 Кафедра клинических и экспериментальных наук, Отделение эндокринологии и метаболизма, Университет Брешии, Брешия, Италия

С.Foresta

7 Кафедра медицины, Отделение андрологии и репродуктивной медицины, Университет Падуи, Падуя, Италия

EA Jannini

11 Кафедра эндокринологии и медицинской сексологии (ENDOSEX), Кафедра системной медицины Университета Rome Tor Vergata, Roma, Италия

A. Lenzi

3 Кафедра экспериментальной медицины, Римский университет «Сапиенца», Рим, Италия

M.

Maggi

12 Отделение эндокринологии, Отдел экспериментальных клинических и биомедицинских наук `` Марио Серио '', Университет Флоренции, Флоренция, Италия

F.Ломбардо

3 Отделение экспериментальной медицины, Римский университет Сапиенца, Рим, Италия

1 Отделение эндокринологии, Медицинское отделение, Госпиталь Маджоре-Беллария, Ларго Нигризоли 2, 40133 Болонья, Италия

2 Отделение Экспериментальная и клиническая медицина, Университет Флоренции, Флоренция, Италия

3 Кафедра экспериментальной медицины, Римский университет «Сапиенца», Рим, Италия

4 Отделение ЭКО, акушерско-гинекологическое отделение, Научный институт Сан-Рафаэле, Vita- Университет Салюте, Милан, Италия

5 Отделение андрологии, Департамент клинической медицины, общественного здравоохранения, наук о жизни и окружающей среде, Университет Л'Акуила, Л'Акуила, Италия

6 Департамент клинической и экспериментальной медицины, Университет Катании, Катания, Италия

7 Медицинский факультет, Отделение андрологии и репродукции M edicine, Университет Падуи, Падуя, Италия

8 Отделение андрологии и патофизиологии репродукции, Больница Санта-Мария Горетти, Латина, Италия

9 Dipartimento di Medicina Clinica e Chirurgia, Sezione di Endocrinologia, Unit e Medicina della Riproduzione e della Sessualità Maschile e Femminile (FERTISEXCARES), Университет Федерико II в Неаполе; Сотрудники кафедры ЮНЕСКО по санитарному просвещению и устойчивому развитию, Университет Федерико II, Неаполь, Италия

10 Кафедра клинических и экспериментальных наук, Отдел эндокринологии и метаболизма, Университет Брешии, Брешия, Италия

11 Кафедра Эндокринология и медицинская сексология (ENDOSEX), Департамент системной медицины, Римский университет Тор Вергата, Рим, Италия

12 Отделение эндокринологии, Отдел экспериментальных клинических и биомедицинских наук `` Марио Серио '', Университет Флоренции, Флоренция, Италия

Автор, ответственный за переписку.

Поступила в редакцию 24 апреля 2020 г .; Принято 2 мая 2020 г. . Эти разрешения предоставляются на период, пока Всемирная организация здравоохранения (ВОЗ) объявила COVID-19 глобальной пандемией.

Эта статья цитируется в других статьях в PMC.

Abstract

Цель

Недавняя пандемия тяжелого острого респираторного синдрома (SARS), вызванного коронавирусом (CoV) 2 (SARS-CoV-2), вызвала ряд опасений в репродуктивной медицине.Целью этого обзора является обобщение имеющихся доказательств, обеспечивающих официальную позицию Итальянского общества андрологии и сексуальной медицины (SIAMS)

Методы

Был проведен всесторонний поиск в библиотеках Pubmed, Web of Science, Embase, Medline и Cochrane. Из-за ограниченности доказательств и отсутствия исследований было невозможно сформулировать рекомендации в соответствии с критериями Оксфордского уровня доказательности 2011 года.

Результаты

Некоторые молекулярные характеристики SARS-CoV-2 могут оправдать присутствие вируса в яичках и возможные изменения сперматогенеза и эндокринной функции. Сообщалось об орхите как о возможном осложнении инфекции SARS-CoV, но аналогичные данные не поступали в отношении SARS-CoV-2. В качестве альтернативы орхит может быть результатом васкулита, поскольку COVID-19 связан с аномалиями свертывания крови, а сегментарная васкуляризация яичек может быть причиной орхитоподобного синдрома. Наконец, имеющиеся данные не подтверждают наличие SARS-CoV-2 в семенной жидкости плазмы инфицированных субъектов.

Заключение

Данные, полученные из других инфекций SARS-CoV, предполагают, что пациентам, вылечившимся от COVID-19, особенно в репродуктивном возрасте, следует рекомендовать андрологическую консультацию и оценку функции гонад, включая анализ спермы.Исследования на более крупных когортах инфицированных в настоящее время субъектов должны подтвердить (или исключить) наличие рисков для мужских гамет, предназначенных либо для криоконсервации в жидком азоте, либо для методов вспомогательной репродукции.

Ключевые слова: SARS-CoV-2, COVID-19, криоконсервация спермы, мужская фертильность

Введение

Коронавирусы (CoV) - это одноцепочечные РНК-вирусы, названные так в честь коронавируса, придаваемого шипами гликопротеина вокруг вирусная оболочка, которую можно наблюдать с помощью электронного микроскопа. Семейство Coronaviridae включает несколько родов (от α до δ ), которые способны поражать человека и других позвоночных: α-CoV и β-CoV могут поражать человека и различных млекопитающих, заражая дыхательную, желудочно-кишечную и центральную нервную систему, а γ-CoV и δ-CoV в основном поражают птиц [1, 2]. После вспышки тяжелого острого респираторного синдрома (SARS) -CoV на юге Китая в 2002 году коронавирусы были признаны причиной нескольких эпидемий во всем мире.Недавно в центре той же страны, в Ухане [3], появился новый штамм вируса, положивший начало пандемии, которая в настоящее время уносит более двух миллионов человек по всему миру, более 100 000 смертей и число которых продолжает расти с каждым днем ​​[4 ]. Италия - одна из стран с наиболее серьезным заболеванием, в ней зарегистрировано до 160 000 случаев заболевания и более 20 000 случаев смерти [5]. Этот новый вирусный штамм принадлежит к роду β-CoV и получил название SARS-CoV-2. Согласно современным данным, клинические проявления SARS-CoV-2 обычно характеризуются лихорадкой, кашлем, заложенностью носа, астенией, аносмией, агевзией и одышкой. Инфекция может в дальнейшем развиваться с появлением системных симптомов, характеризующихся сердечно-сосудистой коагуляцией и поражением печени, а также атипичной пневмонией, которая может потребовать госпитализации [6]. Относительно высокая частота этих опасных для жизни осложнений, наряду с высокой степенью передачи и быстрым глобальным распространением, вызвала серьезные отклики со стороны мировых властей, что привело к серьезным ограничениям в попытке контролировать пандемию коронавирусной болезни (COVID-19) [7] .С целью сдерживания болезни исследователи активизировались во всем мире для выяснения путей передачи вируса и проверки диагностических тестов для быстрого выявления инфицированных субъектов. Имеются доказательства присутствия РНК SARS-CoV-2 в различных биологических матрицах, таких как образцы стула, кровь и моча: в стуле, в частности, наблюдается относительно высокий уровень обнаружения с более длительным временем выведения, чем мазки из носоглотки из дыхательных выделений; кровь и моча, напротив, по-видимому, имеют очень низкую частоту обнаружения вирусной РНК [8–10]. Тем не менее, это говорит о том, что теоретически возможны пути заражения, отличные от воздушно-капельных. Присутствие SARS-CoV-2 в семенной жидкости может иметь сексуальные и репродуктивные последствия [11] и отражаться в инфекции и передаче COVID-19, но этот вопрос до сих пор недостаточно изучен. Криоконсервация спермы обычно используется для сохранения мужской фертильности и лечения бесплодия пар в нескольких клинических условиях [12]. Цитотоксические агенты, используемые при раке или некоторых хирургических вмешательствах, могут нарушать сперматогенез и изменять эякуляцию.Кроме того, хирургическое извлечение спермы у пациентов с азооспермией представляет собой еще одно специфическое показание для замораживания спермы [13]. В то время как обычное или микрохирургическое извлечение спермы у пациентов с обструктивной или необструктивной азооспермией можно легко отложить из-за пандемии, криоконсервацию спермы нельзя отложить у онкологических больных, которым необходимо начать химиотерапию. В последнем случае криобанки спермы представляют собой единственный шанс сохранить фертильность пациентки.

Исходя из вышеупомянутых соображений, возможность того, что SARS-CoV-2 может быть идентифицирован в семенной жидкости, имеет важное значение для репродуктивной медицины, особенно в отношении вспомогательной репродукции и криоконсервации гамет, где существует большая степень неопределенности [14, 15 ].Целью данной статьи является обобщение имеющихся доказательств, обеспечивающих официальную позицию Итальянского общества андрологии и сексуальной медицины (SIAMS).

Методы

Был проведен всесторонний поиск в библиотеках Pubmed, Web of Science, Embase, Medline и Cochrane по следующим ключевым словам: ("testis" [MeSH Terms] OR "testis" [All Fields]) AND ("sars virus «[Термины MeSH] ИЛИ (« sars »[Все поля] И« вирус »[Все поля]) ИЛИ« sars virus »[Все поля] ИЛИ (« sars »[Все поля] И« cov »[Все поля]) ИЛИ "сарсков" [Все поля]).

Из-за ограниченного уровня доказательств и отсутствия хорошего качества и дизайна исследования составить рекомендации в соответствии с критериями Oxford 2011 Levels of Evidence было невозможно. Тем не менее, были представлены конкретные заявления, резюмирующие позицию SIAMS на основе обсуждения имеющихся данных советом экспертов в данной области.

Патогенетические механизмы заражения SARS-CoV-2: основа для локализации яичек

Как сообщалось ранее, SARS-CoV-2 представляет собой новый β-коронавирус, имеющий 80% гомологии последовательности с более ранним вирусом SARS-CoV, вызвавшим вспышку SARS в 2003 г. [16].Однако SARS-CoV-2 имеет отличные характеристики. Его трехмерная структура демонстрирует более компактную конфигурацию, которая увеличивает его сродство к связыванию ангиотензинпревращающего фермента 2 (ACE2), который служит вирусным рецептором [17]. Кроме того, SARS-Cov-2 представляет собой многоосновный сайт расщепления (фурином), увеличивающий способность вируса проникать в клетки. Все эти особенности могут объяснить, по крайней мере частично, самое сильное клиническое воздействие по сравнению с другим коронавирусом [17].

ACE2 высоко экспрессируется в широком диапазоне тканей человека, включая семенники [18]. В частности, в яичках экспрессия ACE2 была документально подтверждена на клетках семенных протоков, а также на сперматогониях, клетках Лейдига и Сертоли, подтверждая потенциальные риски, связанные с инфекцией SARS-CoV-2 в репродуктивной системе [18]. Кроме того, домены фурина экспрессируются в придатках яичка различных домашних млекопитающих, включая человека, что дополнительно поддерживает риск локализации SARS-CoV-2 в гениталиях [19]. Если SARS-CoV-2 использует рецептор SARS-CoV ACE2 для входа в клетку, трансмембранная протеаза, серин 2 (TMPRSS2) для белка S, инициирует такую ​​интернализацию, что приводит к усиленному выделению SARS-CoV-2 в клетках, экспрессирующих этот тип II. трансмембранная сериновая протеаза [20].TMPRSS2 высоко экспрессируется в эпителиальных клетках простаты, включая апикальную плазматическую мембрану клеток просвета простаты. Его экспрессия регулируется андрогенами (очевидно, что андроген-чувствительные элементы - единственный известный усилитель промотора этого гена), а также выделяется в сперму как компонент простасом, органеллоподобных пузырьков, которые могут облегчить функцию сперматозоидов и улучшить мужское воспроизводство [21]. .

SARS-CoV-2 и мужская фертильность

Орхит S-1 был зарегистрирован как возможное осложнение инфекции SARS-CoV.Аналогичных результатов для SARS-CoV-2 не поступало.

Функцию яичек S-2, включая концентрацию тестостерона и сперматозоидов, следует контролировать у пациентов, выздоровевших от SARS-CoV-2.

S-3 имеющиеся данные не подтверждают наличие SARS-CoV-2 в семенной жидкости инфицированных субъектов.

Доказательства

Как сообщалось ранее, присутствие ACE2 во взрослых клетках Лейдига в семенниках было доказано давно, с предполагаемой регуляторной ролью стероидогенеза [22], но его точной функцией, а также ролью для всего ренин- Система ангиотензина в регуляции функции яичек была исследована в отношении гендерных различий, но еще не выяснена полностью [23].Возможно, что связывание вируса с этой металлопротеазой может нарушить функцию яичек, и последующее воспаление может привести к эпидидимоорхиту с длительным повреждением яичек и нарушением сперматогенеза. Хотя такое явление еще не было описано для SARS-CoV-2, оно было зарегистрировано для аналогичного коронавируса SARS-CoV [24]. В качестве альтернативы орхит может быть результатом васкулита, поскольку COVID-19 связан с аномалиями свертывания крови, а сегментарная васкуляризация яичек может быть причиной орхитоподобного синдрома.Эти наблюдения показывают, что крайне важно контролировать репродуктивные функции мужчин, выздоровевших с COVID-19, на предмет каких-либо отклонений, которые могут повлиять на фертильность в будущем. Соответственно, ограниченные доказательства документально подтверждают, что по сравнению со здоровыми мужчинами того же возраста с нормальной фертильностью у пациентов с COVID-19 наблюдалось значительное повышение уровня ЛГ в сыворотке и резкое снижение соотношения тестостерона (Т) к лютеинизирующему гормону (ЛГ), поддерживая наличие субклинического или компенсированного гипогонадизма [25].Последнее подтверждается эпидемиологическим наблюдением более высокой частоты осложнений у пожилых мужчин с диабетом, страдающих гипогонадизмом [26]. Наконец, известно, что повышение уровня ЛГ увеличивает васкуляризацию яичек [27]. Еще одна горячая тема - это безопасность и возможные последствия использования репродуктивных клеток у субъектов, инфицированных SARS-CoV-2: недостаток знаний в настоящее время не позволяет нам провести тщательный и исчерпывающий анализ рисков в отношении возможных неблагоприятных событий в краткосрочной или долгосрочной перспективе.О возможном присутствии SARS-CoV-2 еще не сообщалось, и существует лишь несколько отчетов о случаях, посвященных расследованию этой проблемы. Недавно Paoli et al. [28] сообщили об отсутствии вирусной РНК в семенной жидкости мужчины с COVID-19 в анамнезе. Это также подтвердили Pan et al. [29] в небольшой группе китайских испытуемых. Последнее исследовательское письмо от Li et al. [30] обратили внимание на сообщения о 6 случаях положительных образцов спермы на SARS-CoV-2 в тяжелых случаях COVID-19 (около 16% протестированных субъектов).Однако были высказаны некоторые опасения по поводу методологических вопросов [31].

Замечания и дальнейшая перспектива

Важно понимать, что все доступные данные о конкретных эффектах SARS-CoV-2 на функцию яичек получены из клинических случаев или серий случаев, которые представляют собой серьезное ограничение для анализа данных. Следовательно, чтобы сделать окончательные выводы, необходимы дальнейшие исследования. Однако данные, полученные из других инфекций SARS-CoV, предполагают, что пациентам, переболевшим COVID-19, особенно в репродуктивном возрасте, следует рекомендовать андрологические и сексологические консультации и оценку функции гонад, включая исследование спермы [11].Кроме того, следует подчеркнуть, что результаты исследований Paoli et al., Pan et al. и Ли и др. [28–30] могут позволить предположить, что клиренс SARS-CoV-2 в семенной жидкости частично совпадает с клиническим выздоровлением или что вирус никогда не присутствовал в семенной жидкости субъекта. Оценка присутствия SARS-CoV-2 в семенных образцах особенно важна для криоконсервации спермы, поскольку вирусы, хранящиеся в жидком азоте, сохраняют свои патогенные свойства [32]. По этой причине исследования в более крупных когортах инфицированных в настоящее время субъектов должны подтвердить (или исключить) наличие рисков для мужских гамет, предназначенных либо для криоконсервации в жидком азоте, либо для методов вспомогательной репродукции.

Финансирование

Финансирование данной рукописи не использовалось.

Соблюдение этических стандартов

Конфликт интересов

От имени всех авторов автор-корреспондент заявляет об отсутствии конфликта интересов.

Этическое одобрение

Эта статья не содержит исследований с участием людей или животных, выполненных кем-либо из авторов.

Информированное согласие

Для исследования не требуется информированного согласия.

Примечания

Примечания издателя

Springer Nature сохраняет нейтралитет в отношении юрисдикционных претензий на опубликованных картах и ​​институциональной принадлежности.

Информация для авторов

G. Corona, электронная почта: ti. [email protected]

Э. Балди, электронная почта: [email protected]

Исидори А.М., электронная почта: [email protected]

Д. Паоли, электронная почта: [email protected]

Ф. Паллотти, электронная почта: [email protected]

Л. Де Сантис, электронная почта: [email protected]

Ф. Франкавилла, электронная почта: [email protected]

S. La Vignera, электронная почта: [email protected]

Р. Селице, электронная почта: [email protected]

L. Caponecchia, электронная почта: [email protected]

Р. Пивонелло, электронная почта: [email protected]

А. Ферлин, электронная почта: [email protected]

К. Фореста, электронная почта: [email protected]

Э. А. Джаннини, электронная почта: [email protected]

А. Лензи, электронная почта: [email protected]

М. Магги, электронная почта: [email protected] oiram.

Ф. Ломбардо, электронная почта: [email protected]

Ссылки

1. Ашур Х.М., Эльхатиб В.Ф., Рахман М.М., Эльшабрави Х.А.Анализ недавнего нового коронавируса 2019 года (SARS-CoV-2) в свете прошлых вспышек коронавируса человека. Патог (Базель, Швейцария). 2020; 9 (3): 186. DOI: 10.3390 / pathogens

86. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 2. Peng X, Xu X, Li Y, Cheng L, Zhou X, Ren B. Пути передачи 2019-nCoV и меры контроля в стоматологической практике. Int J Oral Sci. 2020; 12: 9. DOI: 10.1038 / s41368-020-0075-9. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Корман В.М., Ландт О., Кайзер М. и др.Обнаружение нового коронавируса 2019 года (2019-nCoV) методом ОТ-ПЦР в реальном времени. Euro Surveill. 2020; 25 (3): 2000045. DOI: 10.2807 / 1560-7917.ES.2020.25.3.2000045. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Zheng S, Fan J, Yu F и др. Динамика вирусной нагрузки и тяжесть заболевания у пациентов, инфицированных SARS-CoV-2, в провинции Чжэцзян, Китай, январь – март 2020 г . : ретроспективное когортное исследование. BMJ. 2020; 369: m1443. DOI: 10.1136 / bmj.m1443. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Ling Y, Xu S-B, Lin Y-X и др.Устойчивость и клиренс вирусной РНК у пациентов, прошедших реабилитацию с новым коронавирусным заболеванием 2019 г. Chin Med J (Engl) 2020 doi: 10.1097 / CM9.0000000000000774. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Xie C, Jiang L, Huang G и др. Сравнение различных образцов для обнаружения нового коронавируса 2019 года с помощью тестов амплификации нуклеиновых кислот. Int J Infect Dis. 2020; 93: 264–267. DOI: 10.1016 / j.ijid.2020.02.050. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11. Аверса А., Джаннини Е.А.COVID-19 или торжество моногамии? Минерва Эндокринол. 2020 DOI: 10.23736 / S0391-1977.20.03207-1. [PubMed] [CrossRef] [Google Scholar] 12. Хезавехей М., Шарафи М., Кучесфахани Х.М., Хенкель Р., Агарвал А., Эсмаили В., Шахверди А. Криоконсервация спермы: обзор современной молекулярной криобиологии и передовых подходов. Репродукция Биомед онлайн. 2018; 37: 327–339. DOI: 10.1016 / j.rbmo.2018.05.012. [PubMed] [CrossRef] [Google Scholar] 13. Corona G, Minhas S, Giwercman A, Bettocchi C, Dinkelman-Smit M, Dohle G, Fusco F, Kadioglou A, Kliesch S, Kopa Z, Krausz C, Pelliccione F, Pizzocaro A, Rassweiler J, Verze P, Vignozzi L, Вайднер В., Магги М., Софикитис Н.Восстановление спермы и результаты ИКСИ у мужчин с необструктивной азооспермией: систематический обзор и метаанализ. Обновление Hum Reprod. 2019; 25: 733–757. DOI: 10.1093 / humupd / dmz028. [PubMed] [CrossRef] [Google Scholar] 15. Де Сантис Л., Анастази А., Чимадомо Д., Клингер Ф. Г., Ликата Е., Писатуро В., Соса Фернандес Л., Скарика С. COVID-19: взгляд итальянских эмбриологов, управляющих лабораторией ЭКО в чрезвычайной ситуации пандемии. Hum Reprod (Оксфорд, Англия) 2020; 35 (4): 1004–1005. DOI: 10,1093 / humrep / deaa074. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Чжу На, Чжан Динюй, Ван Вэньлин, Ли Синван, Ян Бо, Сун Цзиндун, Чжао Сян, Хуан Баоин, Ши Вэйфэн, Лу Роцзянь, Ню Пейхуа, Чжань Фасянь, Ма Сюэцзюнь, Ван Даянь, Сюй Вэньбо, У Гуйчжэнь, Гао Джордж Ф. , Тан Вэньцзе. Новый коронавирус от пациентов с пневмонией в Китае, 2019. Медицинский журнал Новой Англии. 2020; 382 (8): 727–733. DOI: 10.1056 / NEJMoa2001017. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Шан Дж, Йе Г, Ши К., Ван И, Ло С., Айхара Х, Гэн К., Ауэрбах А., Ли Ф. Структурная основа распознавания рецепторов SARS-CoV-2.Природа. 2020 doi: 10.1038 / s41586-020-2179-у. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Wang Z, Xu X. scRNA-seq Профилирование семенников человека показывает присутствие рецептора ACE2, мишени для инфекции SARS-CoV-2 в сперматогониях, клетках Лейдига и Сертоли. Ячейки. 2020; 9 (4): E920. DOI: 10,3390 / ячейки

20. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Тимон В., Бельгази М., Даше Дж. Л., Гатти Дж. Л. Анализ выделения фурина эктодомена в придатковой жидкости млекопитающих: демонстрация выделения фурина in vivo.Репродукция. 2006. 132 (6): 899–908. DOI: 10.1530 / REP-06-0077. [PubMed] [CrossRef] [Google Scholar] 20. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T., Erichsen S, Schiergens TS, Herrler G, Wu NH, NitscheA MMA, Drosten C, Pöhlmann S. Вход в клетки SARS-CoV-2 зависит от ACE2 и TMPRSS2 и блокируется клинически доказанным ингибитором протеазы. Клетка. 2020; 181: 271–280.e8. DOI: 10.1016 / j.cell.2020.02.052. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Chen YW, Lee MS, Lucht A, Chou FP, Huang W., Havighurst TC, Kim K, Wang JK, Antalis TM, Johnson MD, Lin CY.TMPRSS2, сериновая протеаза, экспрессируемая в предстательной железе на апикальной поверхности эпителиальных клеток просвета и высвобождаемая в сперму в простасомах, неправильно регулируется в клетках рака простаты. Am J Pathol. 2010. 176 (6): 2986–2996. DOI: 10.2353 / ajpath.2010.0

. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Дуглас Г.К., О’Брайан М.К., член парламента от Хеджера, Ли ДКЛ, Ярски М.А., Смит А.И., Лью Р.А. Новый гомолог ангиотензинпревращающего фермента (ACE), ACE2, избирательно экспрессируется взрослыми клетками Лейдига яичка. Эндокринология. 2004. 145: 4703–4711. DOI: 10.1210 / en.2004-0443. [PubMed] [CrossRef] [Google Scholar] 23. La Vignera S, Cannarella R, Condorelli RA, Torre F, Aversa A, Calogero AE. Смертность от SARS-CoV-2, зависящая от пола: среди гормонально-модулированной экспрессии ACE2, риска венозной тромбоэмболии и гиповитаминоза D. Int J Mol Sci. 2020; 21 (8): E2948. DOI: 10.3390 / ijms21082948. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Xu J, Qi L, Chi X, Yang J, Wei X, Gong E, Peh S, Gu J. Орхит: осложнение тяжелого острого респираторного синдрома (SARS) Biol Reprod.2006; 74: 410–416. DOI: 10.1095 / биолрепрод.105.044776. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Corona G, Isidori AM, Aversa A, Bonomi M, Ferlin A, Foresta C, La Vignera S, Maggi M, Pivonello R, Vignozzi L, Lombardo F. Мужская и женская сексуальная дисфункция у пациентов с диабетом: внимание к новым антигипергликемическим препаратам. Rev Endocr Metab Disord. 2020; 21: 57–65. DOI: 10. 1007 / s11154-019-09535-7. [PubMed] [CrossRef] [Google Scholar] 27. Manganaro L, Saldari M, Pozza C, Vinci V, Gianfrilli D, Greco E, Franco G, Sergi ME, Scialpi M, Catalano C, Isidori AM.Динамическая МРТ с контрастным усилением и диффузионно-взвешенная визуализация для характеристики небольших непальпируемых солидных опухолей яичек. Eur Radiol. 2018; 28: 554–564. DOI: 10.1007 / s00330-017-5013-7. [PubMed] [CrossRef] [Google Scholar] 28. Паоли Д., Паллотти Ф., Коланджело С., Базилико Ф., Маццути Л., Туррициани О, Антонелли Дж., Лензи А., Ломбардо Ф. Исследование SARS-CoV-2 в образцах спермы и мочи добровольца с положительным рино-глоточным мазком. J Endocrinol Invest. 2020 DOI: 10.1007 / s40618-020-01261-1. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29.Pan F, Xiao X, Guo J, Song Y, Li H, Patel DP, Spivak AM, Alukal JP, Zhang X, Xiong C, Li PS, Hotaling J. Нет доказательств SARS-CoV-2 в сперме мужчин, выздоравливающих после COVID-19. Fertil Steril. 2020 doi: 10.1016 / j. fertnstert.2020.04.024. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Ли Д., Цзинь М., Бао П, Чжао В., Чжан С. Клинические характеристики и результаты тестов спермы у мужчин с коронавирусной болезнью, 2019 г. JAMA Netw Open. 2020; 3 (5): e208292. DOI: 10.1001 / jamanetworkopen.2020.8292. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31.Паоли Д., Паллотти Ф., Туррициани О, Маццути Л., Антонелли Дж., Лензи А., Ломбардо Ф. Присутствие SARS-CoV-2 в семенной жидкости: миф или реальность. Андрология. 2020 doi: 10.1111 / ANDR.12825. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Де Паоли Паоло. Биобанкинг в микробиологии: от сбора образцов до эпидемиологии, диагностики и исследований. FEMS Microbiology Reviews. 2005. 29 (5): 897–910. DOI: 10.1016 / j.femsre.2005.01.005. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

The Science on PFAS: опровержение претензий 3M

Этот пост был обновлен в среду, 11 сентября 2019 г.


На протяжении десятилетий 3M была ведущим производителем токсичных фторированных химикатов, известных как PFAS. Еще в 1950-х годах собственные исследования 3M показали, что химические вещества, содержащие ПФАС, накапливаются в крови, а к 1960-м годам собственные исследования 3M на животных показали возможность нанесения вреда. Тем не менее 3M продолжала производить химические вещества PFAS, не уведомляя своих сотрудников о рисках.

С тех пор были проведены сотни исследований по выявлению рисков для здоровья, связанных с химическими веществами PFAS. Гораздо больше известно о широком распространении загрязнения ПФАС. По данным федерального правительства и штата, EWG выявила более 700 участков, загрязненных химическими веществами PFAS.

Несмотря на хорошо задокументированные проблемы безопасности, связанные с PFAS, 3M удваивает вводящие в заблуждение заявления о химических веществах и их причастности к нынешнему кризису загрязнения. После принятия закона штата и федерального законодательства, а также судебных исков против действующих и бывших производителей PFAS, таких как 3M, компания создала пропагандистский сайт, преуменьшающий риски PFAS.

Ученые EWG рассмотрели заявления 3M и ответили, используя последние объективные исследования PFAS, чтобы установить рекорд.(Все заявления 3M взяты с https://www.pfasfacts.com/, по состоянию на 4 сентября 2019 г.)

Вредны ли ПФАС?

3M говорит:

Хотя некоторые ПФАС были обнаружены в окружающей среде в низких концентрациях, их присутствие не означает, что они вредны. Каждое соединение PFAS необходимо оценивать на основе его собственных свойств.

Например, 3M и другие компании провели десятилетия исследований возможных последствий воздействия ПФОС и ПФОК на здоровье животных и людей.Это два устаревших соединения PFAS, которые больше не производятся и не используются в США и Европе.

Некоторые исследования показали, что в очень высоких дозах некоторые соединения ПФАС могут оказывать неблагоприятное воздействие на здоровье животных. Однако масса научных данных не показывает, что ПФОС или ПФОК наносят вред окружающей среде или людям на нынешнем или историческом уровне. Исследования показали, что уровни ПФОС и ПФОК среди населения в целом снизились более чем на 70 процентов с 2000 года.

EWG отвечает:

Значительный объем научных данных демонстрирует, что как ПФОК, так и ПФОС, производство которых было прекращено в США, а также химические вещества ПФАС, которые их заменили, наносят вред окружающей среде и здоровью человека даже в небольших количествах. Обнадеживает то, что уровни ПФОК и ПФОС, измеренные в крови, снижаются, но это не означает, что нынешние уровни безопасны. Более того, другие химические вещества ПФАС также были обнаружены в крови и других органах человека.

Было показано, что воздействие ПФАС даже в самых низких концентрациях наносит вред здоровью человека и подвергает риску людей в сообществах с загрязненной питьевой водой. Недавняя наука предполагает, что новые химические вещества PFAS могут быть такими же токсичными и более сложными для лечения, как и те, которые были прекращены.

ПФАС не разрушаются в окружающей среде и могут накапливаться в тканях животных и человека. Они были обнаружены на чрезвычайно высоком уровне в грунтовых водах в районах, где производились промышленные сбросы в источники питьевой воды, или возле военных объектов или аэропортов, где использовалась противопожарная пена, содержащая ПФАС.По федеральным данным и данным штата EWG выявила более 700 участков, где был обнаружен PFAS. Неопубликованные федеральные данные показывают, что до 110 миллионов американцев могут иметь PFAS в питьевой воде.

В то время как веб-сайт 3M посвящен поэтапному отказу от двух видов PFAS, компания не признает, что более 600 других химикатов PFAS были зарегистрированы как активные в торговле за последнее десятилетие.

Загрязненные участки редко содержат только один или два PFAS. Недавние испытания 25 общественных систем водоснабжения Агентством по охране окружающей среды и U.S. Geological Survey обнаружила сложную смесь различных химикатов PFAS во всех системах, что указывает на то, что американцы подвергаются воздействию многих различных PFAS в питьевой воде. ПФАС был обнаружен во всех системах, что указывает на то, что американцы подвергаются воздействию сложной смеси различных химических веществ ПФАС.

Более того, хотя производство ПФОК и ПФОС было прекращено под давлением Агентства по охране окружающей среды, они использовались в больших объемах в течение десятилетий и были обнаружены на сотнях загрязненных участков.Поскольку даже химические вещества, которые были выведены из обращения, никогда не разрушаются в окружающей среде, даже выбросы, произошедшие несколько десятилетий назад, продолжают подвергать людей риску, если их не очистить.

Эти устаревшие химические вещества PFAS также причиняют вред в малых дозах, включая вред иммунной системе и изменению развития молочных желез. Хотя уровни PFOA и PFOS в нашем организме снижаются, химические вещества, подобные Gen X, обладают аналогичным токсическим действием. Пока что оценка химикатов PFAS по отдельности оказалась неэффективной, подчеркивая сходную токсичность и неадекватное тестирование чувствительных конечных точек и во время уязвимых периодов разработки. Для защиты здоровья населения крайне важно, чтобы химические вещества ПФАС рассматривались как класс.

Что наука говорит нам о PFAS?

3M говорит:

Хотя некоторые исследования указывают на возможные связи ПФОК и ПФОС с определенными биомаркерами или последствиями для здоровья людей, результаты всех исследований, посвященных этим конечным точкам, выявили противоречивые или противоречивые наблюдения и не показывают причинно-следственной связи. 3M и другие ведущие эксперты по всему миру продолжают исследования PFAS для выявления потенциальных проблем со здоровьем.

EWG отвечает:

Связь между неблагоприятными последствиями для здоровья и воздействием ПФОК и ПФОС хорошо известна, в том числе в собственных исследованиях химической промышленности, исследованиях государственных регулирующих органов и во многих независимых рецензируемых исследованиях. Растущий объем научных данных предполагает, что химические вещества ПФАС, используемые для замены ПФОК и ПФОС, также могут причинить вред окружающей среде и здоровью человека.

Анализ отраслевых документов, проведенный EWG в ходе судебных исков против 3M и DuPont, показывает, что исследования на животных, проведенные компаниями, показали еще в 1960-х годах, что химические вещества PFAS могут представлять опасность для здоровья.Дополнительные внутренние служебные записки, исследования и другие документы компании демонстрируют, что эти компании давно осознавали риски, связанные с химическими веществами PFAS.

С 2005 по 2013 год научная группа C8 провела масштабный эпидемиологический анализ последствий воздействия ПФОК на здоровье человека. Группа из трех независимых ученых работала с образцами крови почти 70 000 жителей средней части долины реки Огайо, которые подверглись облучению в результате работы или проживания рядом с тефлоновой фабрикой DuPont. Панель финансировалась DuPont как частичное урегулирование иска жителей, и компания согласовала ее состав.Ученые обнаружили связи с вредом для здоровья, включая два типа рака и вред во время беременности, как показано ниже.

Результаты научной комиссии C8

Дата

Вероятная ссылка

Невероятная ссылка

5 декабря 2011 г.

Артериальная гипертензия и преэклампсия, вызванная беременностью

Врожденные дефекты

Преждевременные роды или низкая масса тела

Выкидыши и мертворождения

16 апреля 2012 г.

Рак яичка

Рак почки

Диабет у взрослых

Другие виды рака

30 июля 2012 г.

Болезнь щитовидной железы

Язвенный колит

Ход

Астма или хроническая обструктивная болезнь дыхательных путей

Расстройства нервного развития у детей

Грипп

Аутоиммунные болезни

окт. 29 декабря 2012 г.

Высокий холестерин

Болезнь Паркинсона

Остеоартроз

Болезнь печени

Хроническая болезнь почек

Высокое кровяное давление

Ишемическая болезнь сердца

Источник: Environmental Working Group, из отчетов C8 Science Panel о вероятных связях www.c8sciencepanel.org/prob_link.html

Государственные регулирующие органы также выявили известные или вероятные риски для здоровья от воздействия ПФОК и ПФОС.В рекомендациях EPA по питьевой воде говорится, что воздействие ПФОК и ПФОС может вызвать «влияние на развитие во время беременности и у младенцев, рак, повреждение печени, вред иммунной системе, повреждение щитовидной железы и другие эффекты, включая изменения холестерина».

Федеральное агентство по токсическим веществам и регистрации заболеваний заявляет, что воздействие PFAS может «повысить уровень холестерина, снизить реакцию организма на вакцины, повысить риск заболеваний щитовидной железы, снизить фертильность у женщин, увеличить риск серьезных состояний, таких как высокое кровяное давление. или преэклампсия у беременных женщин и более низкий вес при рождении.”

Государственные агентства по здравоохранению и питьевой воде также провели тщательные научные обзоры для разработки руководящих принципов по питьевой воде и юридических ограничений для химических веществ PFAS. Нью-Джерси разработал предлагаемые стандарты питьевой воды из 14 частей на триллион. или ppt для PFOA, исходя из эффектов развития, 13 ppt для PFOS, исходя из эффектов иммунотоксичности, и установил юридический предел в 13 ppt для PFNA, основанный на влиянии на развитие и иммунитет. Калифорнийское Управление по оценке рисков для здоровья в окружающей среде установило референсные уровни (не подлежащие принудительному исполнению), представляющие риск рака на один миллион в течение всей жизни, равный 0.1 ppt для PFOA и 0,4 ppt для PFOS, исходя из риска рака печени в исследованиях на животных.

Международные регуляторы также подтвердили риски PFAS. В прошлом году оценка рисков ПФОС и ПФОК в пищевых продуктах, проведенная Европейским управлением по безопасности пищевых продуктов, показала, что эпидемиологические исследования на людях убедительно подтверждают причинно-следственные связи между воздействием и повышенным уровнем холестерина в сыворотке крови и поддерживают повышенные уровни фермента аланинтрансферазы печени в сыворотке крови. Обзор исследований на людях позволяет предположить причинно-следственную связь ПФОС и, возможно, ПФОК со снижением реакции на вакцины у детей.Агентство также обнаружило некоторые доказательства причинной связи между пренатальным воздействием ПФОС и ПФОК и массой тела при рождении.

Немецкое агентство по окружающей среде использовало данные о людях, чтобы опубликовать безопасную концентрацию в сыворотке крови 2 нанограмм / миллилитр для ПФОК и 5 нг / мл для ПФОС, что позволит избежать опасений по поводу фертильности и беременности, веса новорожденного, липидного обмена, воздействия на иммунную систему. , развитие гормонов, метаболизм щитовидной железы и начало менопаузы. Последние тесты, проведенные федеральными центрами по контролю и профилактике заболеваний в 2015–2016 годах, показывают, что более четверти американцев имеют уровень ПФОК более 2.5 нг / мл и ПФОС на уровне более 8,1 нг / мл.

Если сравнить пределы риска для здоровья, установленные Агентством по окружающей среде Германии, с исследованиями биомониторинга ПФОК и ПФАС среди населения США, немецкие критерии предполагают, что более четверти американского населения может столкнуться с рисками для здоровья.

Химические вещества

ПФАС, которые используются для замены ПФОК и ПФОС, представляют собой многие из тех же рисков. Предварительные токсикологические оценки EPA для Gen X и PFBS показывают, что эти два химиката могут быть столь же токсичными, как PFOA и PFOS.Недавнее исследование так называемых короткоцепочечных химикатов PFAS - группы химикатов PFAS, обычно используемых для замены PFOA и PFOS - показало, что они широко обнаруживаются в окружающей среде, разлагаются дольше и могут загрязнять большие площади, и такая обработка технологии часто менее эффективны.

Подробнее о PFAS

История загрязнения PFAS и попыток регулирования долгая и сложная. Вот несколько ссылок на ресурсы, которые предоставляют важную справочную информацию.

Фон и избегание воздействия

Документирование осведомленности загрязнителей о загрязнении

  • Документы, подтверждающие график PFAS.
  • Исследование C8 обнаружило связь с раком.
  • Справочная информация о документах, свидетельствующих о десятилетиях обмана.
  • Компания 3M знала о потенциальном риске накопления PFAS для здоровья и обнаружила повышенный риск рака у своих сотрудников.

Вред здоровью, причиненный PFAS

Воздействие на здоровье ПФОС, ПФОК, ПФГxS и ПФНК изучено более широко, чем других пер- и полифторалкильных веществ (ПФАС).Некоторые, но не все исследования на людях с воздействием PFAS показали, что некоторые PFAS могут:

  • влияют на рост, обучение и поведение младенцев и детей старшего возраста.
  • снижает шансы женщины забеременеть.
  • влияют на естественные гормоны организма.
  • повышает уровень холестерина.
  • влияют на иммунную систему.
  • увеличивает риск рака.

По большей части у лабораторных животных, подвергшихся воздействию высоких доз одного или нескольких из этих ПФАС, наблюдались изменения функции печени, щитовидной железы и поджелудочной железы, а также некоторые изменения в уровнях гормонов. Поскольку животные и люди обрабатывают эти химические вещества по-разному, дополнительные исследования помогут ученым полностью понять, как ПФАС влияют на здоровье человека. Ученые все еще изучают воздействие на здоровье смесей ПФАС.

Дополнительные исследования:

  • Исследование C8 обнаружило связь с раком.
  • PFAS вредят иммунной системе и снижают эффективность вакцины: «Недавний обзор эпидемиологических исследований на людях, проведенный Rappazzo et al. показывает, что PFAS может влиять на реакцию антител на вакцинацию и другие проблемы со здоровьем, такие как астма.”
  • Вред для здоровья, связанный с воздействием FPAS, как указано в отчете Агентства по токсическим веществам и реестру заболеваний.

Борьба EWG с PFAS

На протяжении двух десятилетий EWG стремится остановить распространение загрязнения PFAS.

3M говорит:

Группа экспертов PFAS по здоровью, сформированная правительством Австралии, в своем отчете за март 2018 г. определила, что «в основном имеются ограниченные доказательства какой-либо связи с заболеванием человека или их нет» и «в настоящее время нет доказательств, подтверждающих большое влияние на здоровье человека здоровье.Они также сообщают, что «в настоящее время нет данных, свидетельствующих об увеличении общего риска рака». Однако они рекомендуют продолжить исследования, включая усилия по «лучшему пониманию того, как ПФАС влияет на людей и на каком уровне».

В США Агентство по регистрации токсичных веществ и заболеваний, которому Конгресс поручил изучить воздействие опасных веществ, в мае 2018 г. сообщило, что «имеющиеся исследования на людях выявили некоторые потенциальные объекты токсичности; однако причинно-следственная связь не была установлена ​​ни для одного из эффектов, и не во всех исследованиях последовательно обнаруживались последствия.”

EWG отвечает:

На протяжении почти 70 лет 3M, DuPont и другие химические компании знали, что химические вещества PFAS накапливаются в нашей крови. Они почти так долго знали, что эти химические вещества оказывают токсическое действие на наши органы, и старались сохранить эту информацию в секрете. Ряд авторитетных медицинских агентств и исследователей в США, таких как EPA, ATSDR и C8 Science Panel, связали воздействие PFAS с преэклампсией, раком яичек, раком почек, заболеванием щитовидной железы, язвенным колитом, высоким уровнем холестерина, подавлением иммунитета, снижением фертильность и другие последствия для здоровья.Последние исследования и исследования на людях продолжают показывать связь между PFAS и рисками для здоровья человека.

Вопреки претензии 3М Австралийская группа экспертов по здоровью PFAS не оправдывает PFAS. Группа пришла к выводу, что «нельзя исключать важные последствия для здоровья людей, подвергшихся воздействию PFAS. на основании имеющихся данных». В отчете группы также указывается на стойкие и способные к биоаккумуляции свойства ПФАС, предупреждая: «Химические вещества ПФАС не разлагаются быстро в окружающей среде, могут перемещаться на большие расстояния через почву и воду и могут попадать в грунтовые воды. Уровни ПФАС повышаются у животных и людей и в течение многих лет остаются в организме человека ».

Цитата 3M из отчета ATSDR также вводит в заблуждение. На своем веб-сайте ATSDR перечисляет ряд последствий для здоровья, связанных с воздействием PFAS, в том числе повышенный уровень холестерина, повышенный риск рака, гормональное вмешательство и снижение фертильности у женщин. Более того, минимальные уровни риска, включенные в токсикологический профиль ATSDR для PFAS, были в 7-10 раз ниже, чем уровни, которые EPA использовало для расчета своих рекомендаций по питьевой воде для PFOA и PFOS.Хотя ATSDR признает, что в настоящее время ведутся исследования дополнительных потенциальных опасностей токсичности, это не отменяет других выводов агентства.

Этот микроскоп с искусственным интеллектом действительно хорош для подсчета сперматозоидов

К 2018 году Mojo разработала свой первый продукт: интеллектуальный микроскоп, который может автоматически сканировать образец спермы и анализировать его. Он называется Mojo Assess и основан на алгоритме компьютерного зрения, обученном на миллионах изображений спермы, помеченных экспертами-андрологами.Он может вычислять количество сперматозоидов, подвижность сперматозоидов, преобладающую форму сперматозоидов и другие параметры, такие как целостность ДНК сперматозоидов. Он прошел клинические испытания, проведенные в лучших мировых институтах репродуктивной медицины, включая The Doctors Laboratory, King’s Fertility и Каролинский институт в Сольне, Швеция.

Согласно этим тестам, результаты Mojo Assess показывают 97-процентное согласие с анализом золотого стандарта, выполненным в соответствии с рекомендациями ВОЗ. Кроме того, технология Mojo позволяет выполнить тест за четыре минуты, тогда как протоколы ВОЗ в среднем обычно занимают 30 минут и два лаборанта.«Здоровая сперма - это половина успешного процесса ЭКО», - говорит Таха. «При правильной оценке и отборе мы увеличиваем его шансы на успех и уберегаем женщин от ненужного лечения».

Для Тахи Mojo Assess - это только первый шаг. В настоящее время компания разрабатывает робота Mojo Inject, который автоматизирует инъекцию спермы. Этот робот будет использовать ИИ для отбора здоровых сперматозоидов и введения их в яйцеклетку с помощью точных микрометрических роботизированных игл и усовершенствованной микрофлюидики. «Это сложная процедура, которую может выполнить только техник с многолетним опытом, и она требует большой точности, чтобы не уничтожить яйца, которых мало», - говорит Таха.«К сожалению, для этого нет протокола золотого стандарта».

По оценке Таха, при совместном использовании набор продуктов Mojo может увеличить вероятность успеха ЭКО с нынешних 25 процентов до 50. «К сожалению, для некоторых пар биологически невозможно иметь ребенка», - говорит он. «Мы обещаем, что с использованием наших технологий, если пара сможет родить ребенка, у них, вероятно, он будет».

Еще больше интересных историй из WIRED

🇸🇪 Не все страны относились к пандемии одинаково - сработал ли шведский эксперимент с Covid-19?

💬 Этот бот AI Telegram жестоко обращался с тысячами женщин

🧥 Появились новые телефоны Apple: стоит ли покупать iPhone 12 или iPhone 12 Pro?

🔊 Слушайте подкаст WIRED, неделю науки, технологий и культуры, который доставляется каждую пятницу

👉 Следите за WIRED в Twitter, Instagram, Facebook и LinkedIn

Сперма человека быстро реагирует на диету

Abstract

Глобальный рост ожирения и неуклонное снижение качества спермы - две тревожные тенденции, появившиеся в последние десятилетия. Параллельно с этим данные модельных организмов показывают, что отцовская диета может влиять на метаболическое здоровье потомства в процессе, в котором задействована малая РНК, полученная из тРНК сперматозоидов (цРНК). Здесь мы сообщаем, что человеческая сперма очень чувствительна к потоку питательных веществ, как с точки зрения подвижности сперматозоидов, так и с точки зрения изменений цРНК сперматозоидов. В течение двухнедельного диетического вмешательства, в ходе которого мы сначала ввели здоровую диету, а затем диету, богатую сахаром, подвижность сперматозоидов увеличилась и стабилизировалась на высоком уровне. Последовательность малых РНК в сперматозоидах, неоднократно отбираемых у одних и тех же людей, показала, что цРНК активируются при соблюдении диеты с высоким содержанием сахара всего в течение 1 недели.Неконтролируемая кластеризация идентифицировала два независимых пути биогенеза этих цРНК: один с участием нового класса фрагментов со специфическим расщеплением в Т-петле зрелых ядерных тРНК, а другой с участием исключительно митохондриальных цРНК. Участие митохондрий дополнительно поддерживалось аналогичной активацией митохондриальной рРНК-производной малой РНК (рсРНК). Примечательно, что изменения сахарочувствительной цРНК были положительно связаны с одновременными изменениями подвижности сперматозоидов и отрицательно связаны с ожирением в независимой клинической когорте.Этот быстрый ответ на диетическое вмешательство в цРНК в человеческих сперматозоидах согласуется с отцовскими межпоколенческими метаболическими реакциями, обнаруженными у модельных организмов. Что еще более важно, наши результаты предполагают общие чувствительные к диете механизмы между подвижностью сперматозоидов и биогенезом цРНК, что дает новое понимание взаимосвязи между питанием и репродуктивным здоровьем мужчин.

Образец цитирования: Nätt D, Kugelberg U, Casas E, Nedstrand E, Zalavary S, Henriksson P, et al.(2019) Сперма человека быстро реагирует на диету. ПЛоС Биол 17 (12): e3000559. https://doi. org/10.1371/journal.pbio.3000559

Академический редактор: Джейсон У. Локасейл, Университет Дьюка, США

Поступила: 16 мая 2019 г .; Принята к печати: 18 ноября 2019 г .; Опубликован: 26 декабря 2019 г.

Авторские права: © 2019 Nätt et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные, полученные в ходе текущего исследования, содержатся в документе и его файлах вспомогательной информации, за одним исключением. S1 Fig был сгенерирован из файлов последовательности fastq, которые содержат личную генетическую информацию. Таким образом, неограниченное распространение этих файлов ставит под угрозу личную неприкосновенность участников исследования, что нарушает наши действующие этические разрешения, согласия участников и шведские законы. Тем не менее, эти файлы могут быть доступны по запросу, при условии, что исследователь придерживается существующих этических разрешений и согласий, или продлить этические разрешения и согласия, подав заявку на это в Шведский орган этического надзора (дополнительная информация о том, как подать заявку на контакт, регистратор @etikprovning.se или посетите https://etikprovningsmyndigheten.se/). Для получения конкретной информации о данных, пожалуйста, свяжитесь с соответствующими авторами по [email protected], [email protected] Данные, используемые в текущем исследовании, но сгенерированные другими, ранее были депонированы в Архиве считывания последовательностей (SRA), и к ним можно получить доступ по этим номерам доступа: SRP065418, SRP132262 (ссылка на Gene Expression Omnibus также предоставляется этими образцами GSE74426 , GSE110190).

Финансирование: Исследование было любезно поддержано грантами Шведского исследовательского совета (2015-03141; https: // www. vr.se/english.html; получено AÖ), Фонд Кнута и Алисы Валленберг (сотрудник Валленбергской академии, 2015.0165; https://kaw.wallenberg.org/wallenberg-academy-fellows; получен AÖ), Рагнар Содерберг (научный сотрудник по медицине 2015; https: // ragnarsoderbergsstiftelse.se/; получено AÖ), Область стратегических исследований Здравоохранение в Каролинском институте / Университете Умео (https://ki.se/en/research/strategic-research-area-health-care-science-sfo-v ; получено ML). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Сокращения: ИМТ, индекс массы тела; BMR, базальная скорость метаболизма; FDR, Коэффициент ложного обнаружения; ГЕО, Омнибус экспрессии генов; hESC, эмбриональные стволовые клетки человека; линкРНК, длинная некодирующая РНК; миРНК, микроРНК; нитРНК, ядерная внутренняя Т-петля цРНК; PAL, уровень физической активности; пиРНК, piwi взаимодействующая РНК; PUS7, Псевдоуридинсинтаза 7; КПЦР, количественная ПЦР; RDI, рекомендуемая суточная доза; Об / мин, читает на миллион; рсРНК, малая РНК, происходящая из рРНК; RT, ретротранскрипция; sncRNA, малая некодирующая РНК; SRA, Последовательность чтения архива; Тройник, общий расход энергии; цРНК, малая РНК, происходящая от тРНК

Введение

Эпидемиологические исследования на протяжении десятилетий сообщали о снижении качества спермы у здоровых мужчин во всем мире [1–3]. Хотя интерпретации этих исследований, которые иногда достигают апокалиптических масштабов, справедливо критикуются за то, что они часто недостаточно эффективны, зависят от региона и предвзяты ковариатами (например, см. [4]), последовательность является достаточной причиной для беспокойства. Согласно недавнему метаанализу 137 отчетов, концентрация сперматозоидов снизилась на 57% за последние 35 лет, причем наилучшая поддержка такого снижения была найдена в Северной Америке, Европе и Азии [5]. Текущие крупномасштабные исследования, охватывающие от десятков до сотен тысяч человек, также предполагают, что это снижение не показывает признаков восстановления [6–8].Таким образом, становится все более актуальной необходимость лучшего понимания факторов, влияющих на качество спермы у людей.

Факторы риска низкого качества спермы у здоровых мужчин включают, например, мужской репродуктивный возраст, воздействие на окружающую среду эндокринных разрушителей (например, пестицидов и тяжелых металлов) и факторы образа жизни (например, табак / алкоголь и физические упражнения) [5]. Ожирение с сопутствующими патологиями, такими как диабет, также является сильным фактором риска [9–12]. Интересно, что многие из наиболее часто исследуемых популяций со снижением качества спермы также недавно испытали рост ожирения.Хорошо известно, что факторы питания и метаболизма могут влиять на мужскую фертильность [9,13,14], но мало что известно о молекулярных механизмах. Ключи к разгадке можно найти в недавних открытиях так называемых отцовских метаболических реакций между поколениями у животных.

В отцовских метаболических реакциях между поколениями мужчины подвергаются диетическим вмешательствам, которые создают устойчивую метаболическую рябь, которая распространяется через одно или два поколения, прежде чем утихнет [15,16]. Подобные явления наблюдались у многих организмов, включая человека, мышей и плодовых мух [17–19].Наилучший механизм-кандидат здесь включает изменения нагрузки сперматозоидов малой некодирующей РНК (sncRNA). В целом известно, что РНК играют важную роль в установлении эпигенетических состояний, включая центромерный гетерохроматин [20] и подавление транспозонов в зародышевых клетках [21]. Подтип sncRNA, производные тРНК малые РНК (tsRNAs), как известно, в изобилии присутствуют в сперматозоидах млекопитающих, включая человека, и играют роль в межпоколенческих метаболических ответах отцов у мышей [22–28]. Функциональное значение фрагментов тРНК только выясняется, но до сих пор они участвовали в ингибировании трансляции, формировании стрессовых гранул и контроле ретротранспозонов [24,29–31].Подвержена ли цРНК человеческой спермы диетическим вмешательствам и связана ли она с изменениями качества спермы, не исследовалось.

Здесь мы представляем острое воздействие на человеческую сперму после двухэтапного диетического вмешательства. Это вмешательство включало, в первую очередь, 1 неделю здоровой диеты для установления исходного уровня, а затем еще 1 неделю дополнительного потребления сахара. Изучая 3 эякулята от одних и тех же людей, мы обнаружили, что подвижность сперматозоидов резко стабилизировалась на высоком уровне во время вмешательства.Изменения подвижности сперматозоидов происходили параллельно с одновременным увеличением цРНК, в первую очередь митохондриального происхождения, но также и определенного типа ядерной цРНК. Эти ядерные цРНК, которые мы называем ядерной внутренней Т-петлевой цРНК (нитРНК), имели специфический участок разреза в консервативной области TψC в Т-петле зрелой тРНК, что указывает на чувствительный к сахару фермент, способствующий биогенезу этой цРНК. подтип. Таким образом, репертуар sncRNA в человеческих сперматозоидах, а также подвижность сперматозоидов показывают быструю и высокоспецифичную реакцию на диетические изменения.

Результаты

Изменения в диете вызывают быстрые системные реакции

Чтобы изучить реакцию сперматозоидов человека на изменения в диете, мы набрали 15 здоровых мужчин - некурящих в возрасте 20–27 лет с нормальным индексом массы тела (ИМТ) - и назначили им индивидуальный режим питания (рис. 1А). Все участники согласились употреблять пищу, предоставленную исследовательской группой только в течение 2-недельного вмешательства. В течение первой недели мы обеспечили каждого участника здоровой диетой в соответствии с рекомендациями Nordic Nutrition [32], с общим содержанием энергии, соответствующим их расчетному общему расходу энергии (TEE) (таблица S1). На второй неделе их диета была дополнена сахаром, что соответствовало дополнительным 50% их расчетного ЧВЭ (в среднем 375 г сахара в день, что эквивалентно примерно 3,5 л сахаросодержащих напитков или примерно 450 г конфет). Эта двухэтапная стратегия позволила сформировать парные образцы временных шкал, которые позволили каждому человеку самостоятельно контролировать процесс. Калорийность диеты первой недели была рассчитана для поддержания исходного веса, тогда как потребление калорий на второй неделе, по оценкам, увеличило вес человека на 1.5 кг. Как показатель соблюдения диеты, изменение веса соответствовало этим ожиданиям (таблица S2). Отношение жира к безжировой массе показало, что основную долю увеличившегося веса составила безжировая масса (рис. 1В), что указывает на то, что диета, богатая сахаром, у здоровых молодых мужчин оказывает анаболический эффект в краткосрочной перспективе. Образцы крови собирали в каждый момент времени, и хотя были небольшие, но значимые сдвиги в нескольких параметрах, включая гемоглобин, концентрацию тромбоцитов и глутамилтрансферазу (таблица S2), наблюдались заметные изменения в триглицеридах сыворотки (рис. 1C), а также явные изменения. сдвиг в метаболизме холестерина (таблица S2).Стоит отметить, что на глюкозу крови натощак не повлияла 1 неделя диеты с высоким содержанием сахара, что подтверждает непатологический метаболизм сахара у участников (таблица S2).

Рис. 1. Двухэтапное диетическое вмешательство приводит к системным метаболическим реакциям и повышению подвижности сперматозоидов.

(A) Участникам ( n = 15) давали строго контролируемую стандартную диету в течение 1 недели (100% RDI на основе их TEE), а затем неделю с дополнительным сахаром (+ 50% RDI). (B) Изменения в массе жира и без жира оценивались с помощью измерений BodPod.(C) Триглицериды сыворотки во время периода тестирования. (D) Семя собирали у каждого участника в начале исследования и в конце каждой недели. (E) Подвижность сперматозоидов в течение периода тестирования. Данные доступны в таблице S2. RDI, рекомендуемая суточная доза; TEE, общий расход энергии.

https://doi.org/10. 1371/journal.pbio.3000559.g001

Образцы спермы собирали 3 раза: первый раз в начале вмешательства, второй после недели здорового питания и третий после недели с высоким сахарная диета (рис. 1D).Общее количество сперматозоидов варьировалось между участниками и не зависело от диеты (таблица S2). Однако мы заметили, что подвижность сперматозоидов стабильно стабилизировалась на высоком уровне у всех людей в течение 2 недель вмешательства (черная линия на рис. 1E). Глядя на отдельные временные рамки, было заметно, что 5 из 15 участников имели очень низкую отправную точку, близкую к контрольному значению 34% или ниже нее (таблица S2). Построив эту группу с низкой подвижностью сперматозоидов отдельно, стало ясно, что эта группа заметно улучшала подвижность сперматозоидов в течение периода тестирования, причем наиболее выраженный эффект проявлялся уже после первой недели (серые линии на рис. 1E).

Таким образом, одновременное увеличение подвижности сперматозоидов и безжировой массы указывает на то, что 1 неделя диеты с высоким содержанием сахара в дополнение к здоровому исходному уровню имела анаболический эффект у наших молодых, здоровых и худых участников.

Диетический сахар резко модулирует цРНК в сперматозоидах

Затем мы извлекли РНК из образцов спермы и выполнили секвенирование малых РНК. Наш аналитический рабочий процесс позволил проанализировать 16–45 нуклеотидов малой РНК. Распределение размеров и смещение первых нуклеотидов были строго сохранены во всех 3 эякулятах от одного и того же человека (S1 рис.), Что подтверждает целостность нашего эксперимента.В соответствии с более ранними сообщениями [22,25], большинство малых РНК в человеческих сперматозоидах были идентифицированы как цРНК, малая РНК, происходящая из рРНК (рсРНК), и микроРНК (миРНК) (рис. 2A / 2B) (данные S1).

Рис. 2. Фрагменты тРНК сперматозоидов человека очень чувствительны к диете с высоким содержанием сахара.

(A) Профили малых РНК-seq из подвижных сперматозоидов каждого участника (S1-S16; n = 15) были проанализированы в начальной точке эксперимента («Начало»), после первой недели здорового питания («Здоровое питание»). »), А также после второй недели диеты с высоким содержанием сахара (« Сахарная »).(B) Средняя доля малых РНК в эксперименте. (C) Вмешательство было в первую очередь разработано для исследования эффекта сахара по сравнению со здоровьем (исходный уровень). (D) Свернуть изменения биотипов после 1 недели диеты с высоким содержанием сахара (сахар / здоровый). (E) Типы анализируемых цРНК. (F) Среднее количество прочтений для различных типов цРНК. (G) Кратковременные изменения типов цРНК после 1 недели диеты с высоким содержанием сахара. (H) Высоко экспрессируемые изодекодеры ядерной и митохондриальной тРНК, их средняя экспрессия, кратное изменение после 1 недели диеты с высоким содержанием сахара и их состав типов цРНК.Представлены только изодекодеры тРНК со скоростью не менее 100 об / мин. Планки погрешностей указывают ± SEM. «*» Означает не менее p <0,05. Графики могут быть воспроизведены с помощью скрипта в S1 Text с вводом из S1 и S2 Data. FC, изменение кратности; линкРНК, длинная некодирующая РНК; миРНК, микроРНК; Mt, митохондриальный; piRNA, piwi взаимодействующая РНК; RPM, чтения на миллион; рсРНК, малая РНК, полученная из рРНК; цРНК, малая РНК, полученная из тРНК.

https://doi.org/10.1371/journal.pbio.3000559.g002

Двухэтапное диетическое вмешательство было в первую очередь разработано для изучения диеты с высоким содержанием сахара в сравнении со здоровой базовой диетой (рис. 2C).Поэтому мы сначала сосредоточились на этом сравнении. Одна неделя диеты с высоким содержанием сахара вызвала заметный сдвиг в относительном распределении малых РНК, так что миРНК и цРНК (в основном митохондриального происхождения) увеличивались, тогда как малая РНК, полученная из рибосом (рсРНК), уменьшалась (рис. 2D). Однако отдельные miRNA не претерпели значительных изменений после диеты с высоким содержанием сахара (таблица S3; коэффициент ложного обнаружения [FDR] исправлен). Более тщательное изучение rsRNA выявило, что подавление регуляции было связано с массивными небольшими эффектами изменений в высоко экспрессируемых субъединицах 18S и 28S (S2 фиг.).Эти рсРНК скомпрометировали 92,6% всех рсРНК по нашим данным и имеют ядерное происхождение. Что еще более интригующе, гораздо менее экспрессируемая рсРНК, происходящая от 12S и 16S, транскрибируемая из митохондриального генома, подвергалась значительному усилению (S2 фиг.).

Сосредоточившись на цРНК, мы затем аннотировали сложную смесь цРНК на 5 подтипов: 5'-половина, 5'-цРНК, i-цРНК, 3'-цРНК и 3'-половина (Рис. 2E) [33]. Используя этот подход, было ясно, что 5'-фрагменты были наиболее многочисленны, как ранее было показано у мышей [26], и что 3′-фрагменты были наименее распространены, тогда как менее изученные i-цРНК присутствовали на промежуточных уровнях (рис. 2F) .Однако только i-цРНК и 3'-цРНК показали значительные изменения в ответ на диету с высоким содержанием сахара (рис. 2G). Сосредоточившись на изодекодерах тРНК, мы обнаружили, что цРНК из 8 изодекодеров изменилась после вмешательства с высоким содержанием сахара (рис. 2H, средняя панель). Эти 8 изодекодеров были умеренно экспрессированы (рис. 2H, левая панель) и имели высокое содержание i-цРНК или 3'-цРНК (рис. 2H, правая панель). Напротив, очень распространенные изодекодеры тРНК, такие как GlyGCC, GlyCCC и GluCTC (рис. 2H, левая панель), не пострадали от диеты с высоким содержанием сахара (рис. 2H, средняя панель) и имели высокое содержание 5'-цРНК ( Рис 2H, правая панель).

Чтобы подтвердить эти результаты, мы провели количественную ПЦР (кПЦР) на 2 идентифицированных цРНК, ядерной i-цРНК LysCTT и митохондриальной 5'цРНК SerTGA (S3 фиг.). И сперматозоиды, и эмбриональные стволовые клетки человека (hESC) генерировали уникальные фрагменты ожидаемых размеров после кПЦР. Что наиболее важно, результаты секвенирования и количественной ПЦР хорошо коррелировали для всех участников, и эффект сахара был подтвержден.

Таким образом, специфические подтипы цРНК сперматозоидов, в первую очередь i-цРНК и 3'-цРНК, резко повышаются в ответ на диету.Примечательно, что это касается цРНК как ядерной, так и митохондриальной тРНК.

Митохондриальная и ядерная цРНК образуют отдельные кластеры

Для каждого изодекодера тРНК, чувствительной к сахару (рис. 2H), было идентифицировано несколько цРНК, многие из которых отличаются только одним или несколькими нуклеотидами (таблица S4, данные S2), что, скорее всего, указывает на общие пути процессинга. Чтобы проверить это, мы использовали неконтролируемую кластеризацию, чтобы выявить лежащую в основе корреляционную структуру этих цРНК. Как и предполагалось, профили экспрессии подтипа изодекодера тРНК были сильно связаны у разных людей (рис. 3).Что еще более важно, ядерная и митохондриальная цРНК образуют 2 полностью отдельных кластера. В то время как ядерный кластер содержал исключительно i-цРНК, митохондриальный кластер в основном содержал смесь i-цРНК и 3'-цРНК. Это указывает на то, что расхождение между i-цРНК и 3'-цРНК, о котором сообщалось выше, генерируется по меньшей мере двумя путями процессинга, разделенными клеточной компартментацией.

Рис. 3. Митохондриальная и ядерная цРНК образуют отдельные кластеры.

Дендрограмма показывает взаимосвязь регуляторных ответов отдельных цРНК от значительно измененных изодекодеров тРНК (рис. 2H).Каждый лист представляет различия между Sugar и Healthy в одной цРНК у 15 участников. Митохондриальная (красный) и ядерная i-цРНК (синий) четко разделены на 2 кластера. Иерархический кластерный анализ был основан на евклидовых расстояниях между шкалами разностей оборотов в минуту между сахарной и здоровой выборками каждого участника. Дополнительные сведения об этих цРНК см. В таблице S5. График можно воспроизвести с помощью скрипта в S1 Text с вводом из S2 Data. RPM, чтения на миллион; цРНК, малая РНК, полученная из тРНК.

https://doi.org/10.1371/journal.pbio.3000559.g003

У мужчин с ожирением изменилась цРНК сперматозоидов

Чтобы проверить достоверность наших результатов, мы затем повторно проанализировали данные датского исследования Донкина и его коллег [25], в котором секвенировали малую РНК сперматозоидов у худых и клинически страдающих ожирением людей (рис. 4A). Интересно, что реплицируя наш аналитический рабочий процесс на этом наборе данных, мы обнаружили, что i-цРНК являются единственным подтипом цРНК, который значительно различается между этими двумя группами (рис. 4B).Сравнение чувствительных к сахару цРНК, определенных в нашем исследовании (рис. 2H и 3), с той же цРНК в исследовании Донкина и его коллег, выявило сходные уровни экспрессии в разных исследованиях (рис. 4С). Изучение профилей тРНК из обоих исследований бок о бок выявило дальнейшее сходство, как в относительном количестве различных цРНК, так и в областях, чувствительных к питательным веществам (S4 и S5, рис.). Интересно, что в соответствии с анаболическим эффектом диеты с высоким содержанием сахара у молодых и здоровых мужчин, сперма от мужчин с клиническим ожирением показала противоположные ответы в изменениях цРНК (рис. 4D).Если высокое содержание сахара было связано с увеличением чувствительной к сахару цРНК, ожирение было связано с уменьшением. Примечательно, что эта обратная зависимость наблюдалась также в чувствительных к сахару 12S и 16S рсРНК (S2D / S2E фиг.).

Рис. 4. В сперме мужчин с ожирением обнаружены изменения цРНК.

(A) Ранее опубликованные Донкин и его коллеги данные о малых РНК сперматозоидов тучных и худых мужчин (проект SRA: SRP065418) [25] были повторно проанализированы с использованием нашего аналитического рабочего процесса. (B) Коробчатая диаграмма показывает среднее значение и индивидуальную экспрессию различных типов цРНК (серые точки, худые люди, черные точки, страдающие ожирением).Планки погрешностей указывают ± SEM. (C) Показывает значительную взаимосвязь между средней экспрессией цРНК в текущих (сахар / здоровый) и ожирением (ожирение / худой) исследования. Каждая цветная большая точка представляет собой отдельные цРНК из значительно измененных, чувствительных к сахару изодекодеров тРНК на рис. 2H. Серые маленькие точки представляют другую цРНК. (D) Те же цРНК, что и на панели C, но построенные как различия в каждом из двух исследований, сравнивающих сахар и здоровую диету, а также полных и худых мужчин, соответственно.Проценты представляют собой долю цРНК, обнаруженную в каждом квадранте графика; без скобок = чувствительна к диете; в скобках = все проанализированные цРНК. RPM, чтения на миллион; SRA, архив чтения последовательности; цРНК, малая РНК, полученная из тРНК.

https://doi. org/10.1371/journal.pbio.3000559.g004

Чтобы подробнее прояснить этот вопрос, мы сравнили наши результаты с данными недавнего исследования Хуа и его коллег, которые исследовали sncRNA из сперматозоидов китайских мужчин, которые позже генерировали эмбрионы высокого или низкого качества после экстракорпорального оплодотворения [34].Хотя мы успешно идентифицировали многие из чувствительных к сахару цРНК и рсРНК, мы наблюдали только слабые тенденции с повышенной экспрессией митохондриальной рсРНК и цРНК, связанные с более высоким качеством эмбриона (S2 и S5 рис.). Набор данных Hua et al., Однако, в целом был обеднен rsRNA и сильно обогащен 5'-tsRNA по сравнению с другими наборами данных (S6 Fig). Следовательно, влияние на сахар-чувствительную i-tsRNA и rsRNA могло пострадать из-за низкого покрытия или перекрывания продуктов деградации более распространенных фрагментов (например,g., LysCTT на S4 фиг.).

В совокупности перекрестный анализ набора данных в сочетании с нашей проверкой количественной ПЦР (S3 Рис. ) Обеспечивает твердое независимое свидетельство существования новой сахарочувствительной цРНК, идентифицированной в этом исследовании. Более того, обратная корреляция с цРНК в сперматозоидах мужчин с ожирением предполагает, что они могут быть вовлечены в клиническое состояние.

Сахарочувствительные ядерные i-цРНК расщепляются в Т-петле

Затем мы сосредоточились на значительно измененных ядерных изодекодерах с рис. 2H.Сопоставление считываний с наилучшим соответствием LysCTT, ArgCCG, ArgCCT и LeuCAA показало, что они имеют очень похожие профили покрытия (рис. 5A – 5D, верхние строки), несмотря на уникальные последовательности и происходящие из разных хромосом. Это резко контрастировало со сложностью фрагментов тРНК, происходящих из значительно измененных митохондриальных изодекодеров (S7 фиг.). Более конкретно, все ядерные изодекодеры, чувствительные к сахару, имели 3'-концевые положения, близкие к Т-петле или внутри нее. Чтобы исследовать их точные сайты расщепления, мы картировали первый и последний нуклеотид для каждого фрагмента (рис. 5A – 5D, средний и нижний ряды).Это картирование показало, что чувствительные к сахару фрагменты для LysCTT имели высокоспецифичный 3'-участок разреза внутри Т-петли и 5'-сайт разреза между D-петлей и петлей антикодона в плече антикодона, создавая 30- фрагмент длиной nt (фиг. 5E). Фрагменты ArgCCG, ArgCCT и LeuCAA были меньше, 16-22 нуклеотида в длину, все начинались в различных положениях после антикодона, но заканчивались в Т-петле или очень близко к ней (Рис. 5F-5H).

Рис. 5. Расщепление Т-петли генерирует чувствительные к сахару нитРНК.

(A – D) Анализ нуклеотидного покрытия и сайта расщепления.(E – H) Графическое представление цРНК, образующихся в ответ на диету с высоким содержанием сахара. (I) Общая последовательность Т-петли (TΨCGA) в сахарочувствительных ядерных цРНК. (J) Позиционный анализ сайтов 3'-расщепления, включая все цРНК в исследовании. Верхняя панель: сахар (темно-серый) против здоровой (светло-серый) диеты. Средняя и нижняя панели: значимые цРНК (закрашенные цветные точки; p <0,05), ядерные цРНК (синие) и митохондриальные цРНК (красные). Данные доступны в таблицах S2 и S4. нитРНК, цРНК внутренней Т-петли ядра; RPM, чтения на миллион; цРНК, малая РНК, полученная из тРНК.

https://doi.org/10.1371/journal.pbio.3000559.g005

Все 4 значимых сахарочувствительных ядерных изодекодера имели последовательность TTCGA в своей Т-петле (рис. 5I). Это обычная последовательность, обнаруженная в 48% всех Т-петель из последовательностей, связанных с тРНК, из которых менее 1% имеют митохондриальное происхождение (по сравнению с 6% в тРНК, не содержащих TTCGA). Чтобы исследовать, были ли чувствительные к сахару фрагменты обогащены TTCGA-T-петлями, мы картировали расстояние между нуклеотидом на 3'-конце каждой цРНК и 5'-положением T-петли (рис. 5J, верхняя панель) ( Таблица S4).Как и ожидалось, это привело к появлению двух основных пиков, соответствующих высокоэкспрессированным 5'-цРНК и 5'-половинкам GlyCCC, GlyGCC, GluCTC и GluTTC, тогда как умеренно экспрессируемая сахарочувствительная цРНК Т-петли показала меньший пик ( Рис 5J, верхняя панель, вставка). График значения значимости изменений, вызванных сахарной диетой, выявил две вещи. Во-первых, Т-петля действительно была горячей точкой для значительно измененных ядерных цРНК в тРНК с мотивом TTCGA (рис. 5J, средняя панель, заштрихованные синие кружки p ≤ 0.05, белые кружки p > 0,05). Несколько ядерных цРНК без мотива TTCGA не демонстрировали этого накопления значимых цРНК (рис. 5J, нижняя панель, заштрихованные синие кружки p ≤ 0,05, белые синие кружки p > 0,05). Во-вторых, цРНК из митохондриальной тРНК демонстрировали более сложный паттерн участков среза, чувствительных к сахару (рис. 5J, средняя и нижняя панели, заштрихованные красные кружки p <0,05, белые красные кружки p > 0,05). Вместе это указывает на то, что механизм, лежащий в основе дискриминации сахарочувствительной ядерной i-tsRNA, который был идентифицирован с помощью нашего кластерного анализа, вероятно, включает избирательное расщепление T-петли в предопределенном подтипе tsRNA. Мы называем этот подтип ядерной цРНК - определяемый их расщеплением TTCGA-T-петлей - ядерной внутренней цРНК Т-петли (нитРНК). Примечательно, что наше картирование Т-петли также выявило чувствительную к сахару нитРНК в GluCTC, которая ранее была скрыта в обильных нечувствительных к диете 5'-цРНК (S8 рис, S4 таблица).

Чувствительная к диете цРНК коррелирует с подвижностью сперматозоидов

Поскольку подвижность сперматозоидов является одним из лучших показателей мужской субфертильности [35], снижается у мужчин с ожирением [9,36] и стабилизировалась на высоком уровне в течение двухнедельного диетического вмешательства (рис. 1E), мы проверили, связаны ли изменения подвижности сперматозоидов с сахарочувствительной цРНК.Поскольку наибольшее восстановление подвижности сперматозоидов наблюдалось между начальной точкой и после диеты с высоким содержанием сахара, мы сосредоточили внимание на различиях между этими двумя временными точками (начало по сравнению с сахаром). Таким образом, мы также разделили исходный анализ между Healthy и Sugar, что позволило выявить возможные зависимости от начальных условий.

Сначала сосредоточив внимание на ядерной цРНК, мы обнаружили, что чувствительная к сахару нитРНК активируется не в ответ на здоровую диету, а, в частности, на диету с высоким содержанием сахара (рис. 6А, темно-зеленые кружки).Это не было общим ответом ядерной цРНК, потому что среднее значение всех других ядерных цРНК не было затронуто вмешательством (рис. 6А, светло-зеленые кружки). Более того, на индивидуальном уровне изменения в сахарочувствительной нитРНК были положительно связаны с изменениями подвижности сперматозоидов, в то время как другие ядерные цРНК - нет (рис. 6В). Также не было ассоциации между нитРНК и другими ядерными цРНК (рис. 6С).

Рис. 6. Подвижность сперматозоидов положительно связана с параллельными изменениями цРНК.

Ядерная и MT цРНК - либо чувствительная к сахару (= ​​значительно повышенная в Sugar по сравнению с здоровой), либо другая (= незначительно повышенная цРНК) - были повторно оценены по отношению к значениям начальной точки. (A) Показывает изменения ядерной сахарочувствительной нитРНК (темные точки) и других ядерных цРНК (светлые точки) в течение всего диетического вмешательства. Обратите внимание, что чувствительная к сахару нитРНК специфически реагировала на сахар. (B) Изменения подвижности сперматозоидов между сахарной и стартовой диетами были связаны с сахарочувствительной нитРНК (темные точки), но не с другими ядерными цРНК (светлые точки).(C) Нет связи между изменениями в нитРНК и других ядерных цРНК. (D) Изменения в сахарочувствительной цРНК MT (темные точки) и других MT цРНК (светлые точки) по отношению к значениям начальной точки. Обратите внимание, что все MT tsRNA прогрессивно увеличивались во время диетического вмешательства, но повышение было замечено у чувствительных к сахару после сахара. (E) Изменения как сахарочувствительной цРНК MT (темные точки), так и других MT цРНК (светлые точки) были связаны с изменениями подвижности сперматозоидов. (F) Изменения в сахарочувствительной цРНК MT и других MT цРНК сильно коррелировали.**** p < 0,0001, ** p < 0,01, * p < 0,05, # p < 0,1. Данные доступны в таблице S2 (подвижность сперматозоидов) и данных S2 (цРНК). Здоровые, образцы взяты после здорового питания; МТ, митохондриальный; нитРНК, цРНК внутренней Т-петли ядра; n.s., не имеет значения; Старт, образцы начальной точки; Сахар, образцы, взятые после диеты с высоким содержанием сахара; цРНК, малая РНК, полученная из тРНК.

https://doi.org/10.1371/journal.pbio.3000559.g006

В отличие от ядерной цРНК, митохондриальная сахарочувствительная и все другие митохондриальные цРНК показали увеличение при двухэтапной диете (рис. 6D).В то время как другая цРНК показывала устойчивое увеличение, цРНК, чувствительная к сахару, испытывала ускорение после введения сахара (темно-красные кружки на рис. 6D). Соответственно, митохондриальная цРНК, первоначально идентифицированная как сахарочувствительная, а также другая митохондриальная цРНК, обе положительно коррелировали с подвижностью сперматозоидов (рис. 6E). Средние изменения сахарочувствительной и другой цРНК также сильно коррелировали друг с другом (рис. 6F). Это указывает на то, что подвижность сперматозоидов зависит от общего механизма, включающего все митохондриальные цРНК. Поскольку подвижность сперматозоидов и митохондриальная цРНК увеличивались уже в первую неделю (рис. 1E; здоровый), здоровая / исходная диета была, по крайней мере, частично ответственна за положительное влияние на качество спермы.

Обсуждение

Здесь мы показываем, что человеческая сперма чувствительна к потоку питания, как в отношении подвижности сперматозоидов, так и пула sncRNA. Такая острая реакция согласуется с нашим более ранним исследованием на Drosophila , в котором мы показали, что всего 2 дня диетического вмешательства у самцов мух перед спариванием было достаточно для передачи сигнала через сперматозоиды, чтобы вызвать метаболическое перепрограммирование в следующем поколении [19]. .В текущем исследовании мы показываем, что специфические митохондриальные и ядерные цРНК в человеческих сперматозоидах независимо активируются после аналогичного краткосрочного диетического вмешательства. Увеличение этих цРНК было положительно связано с подвижностью сперматозоидов. Более того, в ядерных цРНК мы идентифицировали чувствительное к сахару расщепление в Т-петле полноразмерной ядерной тРНК, генерируя короткую внутреннюю цРНК, которую мы назвали нитРНК.

Биогенез ядерной цРНК сперматозоидов

Пути, которые генерируют цРНК из тРНК, изучены лишь частично.Наиболее понятным является вызванное стрессом расщепление тРНК ангиогенином, которое разрезает кодон-петлю, давая 2 половины [37,38]. Мы обнаружили, как сообщалось ранее у мышей [26], что наиболее распространенными цРНК в сперматозоидах являются 5'-половинки. Однако мы не находим доказательств того, что цРНК с интактными 5'-концами быстро реагирует на диету.

Используя новые подходы к картированию внутренних фрагментов тРНК, мы вместо этого обнаружили другой класс цРНК, i-цРНК, который не так высоко экспрессируется, как многие 5'-цРНК, но по сравнению с 3'-цРНК все еще экспрессируется на промежуточных уровнях (рис. 2F).У мышей было показано, что 5'-цРНК активируется в сперматозоидах в ответ на хроническую диету с низким содержанием белка [26], хроническую диету с высоким содержанием жиров [24] или диету с высоким содержанием жиров у матери [ 28]. Принимая во внимание роль 5'-цРНК в ингибировании трансляции [29,37], повышающая регуляция 5'-цРНК может быть естественным ответом на снижение синтеза белка при лишении аминокислот. Наше острое вмешательство с высоким содержанием сахара приводит к другой метаболической ситуации. Участники сначала хорошо питаются, а затем дополнительно получают дозу с высоким содержанием сахара.Это может объяснить, почему идентифицированные нами цРНК отличаются от исследований с низким содержанием белка и высоким содержанием жира. Учитывая такую ​​зависимость от метаболического фона, это подразумевает возможность того, что разные диеты могут иметь разные последствия для самой спермы и, возможно, даже для развивающейся зиготы. Следует, однако, отметить, что в большинстве более ранних исследований не учитывались внутренние - i-tsRNA - фрагменты. Таким образом, повторный анализ данных может выявить больше общих черт в путях чувствительной к сахару цРНК.

Все чувствительные к сахару нитРНК, идентифицированные в этом исследовании, имели мотивы GTTCGA в Т-петле. Это точный мотив псевдоуридинсинтазы 7 (PUS7), фермента, который катализирует псевдоуридилирование уридинов. Интересно, что несколько изодекодеров тРНК, которые мы определили как сахарочувствительные в настоящем исследовании, являются мишенями для PUS7 [39]. Несмотря на то, что есть замечательное сходство между сахарочувствительной цРНК, обнаруженной в этом исследовании, и тРНК-мишенями для PUS7, необходимы дополнительные исследования, чтобы определить, играет ли PUS7 роль в индуцированном диетой генерации нитРНК в сперматозоидах.

Расщепление Т-петли должно в дополнение к идентифицированной нитРНК генерировать короткие 3'-цРНК (S9 фиг.). Такие короткие 3'-цРНК были редкостью в наших данных, но были описаны [40]. В Tetrahymena имеется индуцированная голоданием более длинная 3'-цРНК, которая процессируется с помощью пути piwi с образованием CCA-3'-цРНК [41]. «Остаток» более длинной 3'-цРНК очень похож на нитРНК, которая, как мы обнаружили, увеличивается в сперматозоидах в ответ на диету с высоким содержанием сахара. Одним из объяснений отсутствия короткой 3'-цРНК в нашем исследовании является то, что эти фрагменты могут содержать посттрансляционные модификации, несовместимые с нашими протоколами подготовки библиотек.Это должно быть рассмотрено в будущих исследованиях.

Параллельный сдвиг подвижности сперматозоидов и цРНК

Подвижность сперматозоидов увеличилась в ходе исследования и стала заметной уже после первой недели здорового питания. Хотя мы не можем отделить эффект основной здоровой диеты от высокого потребления сахара, возможно, что увеличение подвижности сперматозоидов было прямым следствием здорового питания, которое могло сохраняться до второй недели.

Глюкоза, однако, играет множество ролей в зрелых сперматозоидах [42] и, как известно, быстро влияет на подвижность сперматозоидов in vitro [43,44].Вероятно, это связано с тем, что зрелые сперматозоиды человека используют глюкозу и фруктозу в качестве основного источника АТФ. Как показано в сперме хряка, митохондриальная транскрипция, в отличие от ядерной, оказывается полностью активной и зависит от АТФ [45]. Следовательно, возможно, что то, что мы видим как увеличение митохондриальной цРНК, является результатом более полноразмерной митохондриальной тРНК, вызванной сахарозависимой транскрипцией генов. Такие утверждения, конечно, требуют дальнейшего расследования. Тем не менее, хотя мы не измеряли уровень глюкозы в семенной жидкости напрямую, мы не наблюдали изменений уровня глюкозы в крови во время эксперимента (таблица S2), что делает прямое определение уровня глюкозы в сперматозоиде маловероятным объяснением наших результатов.Отсутствие изменений в уровне глюкозы в крови, а также повышение уровня триглицеридов (таблица S2) вместо этого предполагают, что участники продемонстрировали здоровый метаболизм сахара и, под влиянием гормональных реакций, быстро преобразовали сахар в крови в жирные кислоты. Известно, что зрелые сперматозоиды несут рецепторы лептина [46] и обладают способностью воспринимать инсулин [47], что in vitro положительно влияет на подвижность сперматозоидов [48]. Если бы такие гормональные пути были бы связаны с внутриклеточным каскадом, который активирует PUS7-подобное псевдоуридинилирование (см. Обсуждение в разделе «Биогенез ядерной цРНК сперматозоидов») и последующее расщепление Т-петлей существующего пула тРНК сперматозоидов, это было бы сильным кандидатом для объясняя по крайней мере некоторые из наших результатов.

Учитывая, что сперматогенез у человека занимает около 70 дней [49] - по крайней мере, транскрипция ядерного гена сильно подавляется на более поздних стадиях (см. Обсуждение этого вопроса в [50]) - может показаться маловероятным, что быстрые изменения в пуле sncRNA опосредуются транскрипцией эндогенных генов сперматозоидов. Таким образом, быстрые изменения более вероятно объясняются либо процессингом цРНК из уже существующего пула тРНК, либо переносом цРНК из соматических клеток с интактной транскрипцией гена (рис. 7).Таким образом, восприятие питательных веществ может работать либо через прямые, либо через косвенные механизмы восприятия, так что сама сперма или соматические клетки ощущают поток пищи и выполняют ответ.

Рис. 7. Альтернативные гипотезы быстрого ответа на диету в сперме человека.

Поскольку эндогенная транскрипция ядерных генов в сперматозоидах на поздних стадиях сильно подавлена, быстрые ответы, вероятно, зависят от активации латентных факторов, уже имеющихся в сперматозоиде, или от переноса критических факторов из окружающих соматических клеток.Возможные механизмы активации латентного фактора включают прямое восприятие сперматозоидов питательных веществ, содержащихся в семенной жидкости, или межклеточную передачу сигналов посредством связывания рецептор-лиганд. Экзосомы, которые представляют собой небольшие внеклеточные везикулы, которые, как известно, переносят sncRNA между клетками, являются кандидатами для передачи sncRNA от сомы к сперматозоиду, такой как tsRNA, а также других факторов, влияющих на подвижность сперматозоидов. Известно, что у человека основные эпидидимальные клетки и ацинарные клетки предстательной железы мужского репродуктивного тракта выделяют такие экзосомы в семенную жидкость.Таким образом, перенос экзосом является единственным известным механизмом, который может увеличивать ядерную sncRNA в сперматозоидах на поздних стадиях путем транскрипции de novo. Транскрипция митохондриальной sncRNA в зрелых сперматозоидах менее изучена. sncRNA, малая некодирующая РНК; цРНК, малая РНК, полученная из тРНК.

https://doi.org/10.1371/journal.pbio.3000559.g007

Недавние исследования на мышах предполагают, что соматические клетки мужского репродуктивного тракта способны переносить sncRNA через семенной просвет в созревающие сперматозоиды [26,27, 51–53].Этот перенос РНК от сомы к зародышевой линии является потенциальным путем передачи информации от одного поколения к следующему и предполагает, что мобильная РНК является молекулярным механизмом для межпоколенческого эпигенетического наследования [54,55]. Считается, что перенос РНК опосредуется экзосомами, которые представляют собой небольшие внеклеточные везикулы, которые, как известно, несут ряд биологически активных молекул, включая sncRNA, и их много в семенной жидкости человека [56,57]. У людей в мужском репродуктивном тракте описаны два типа экзосом: эпидидимосомы, происходящие из основных эпидидимальных клеток, и простатасомы из ацинарных клеток простаты.Было показано, что небольшие последовательности РНК простатасомы из семенной жидкости человека содержат sncRNAs, включая tsRNA [57], но еще не известно, могут ли они доставлять свой груз к зрелым сперматозоидам. Тем не менее простатасомы могут увеличивать подвижность сперматозоидов [58]. Таким образом, наши данные об одновременном увеличении подвижности сперматозоидов и цРНК в ответ на короткое диетическое вмешательство соответствуют экзосомальному пути передачи сомы к зародышевой линии.

Есть ли роль цРНК в метаболических эффектах между поколениями у людей?

На мышах было показано, что 5'-GlyGCC, который присутствует в большом количестве в сперматозоидах и на который влияет низкобелковая диета, репрессирует гены, необходимые для пролиферации эндогенных ретровирусов мышей в эмбрионах и в эмбриональных стволовых клетках [26].Более того, было показано, что короткие CCA-3'-цРНК ингибируют этот тип ретротранспозонов в доимплантационных стволовых клетках мышей [59]. Поэтому было высказано предположение, что цРНК защищает от реактивации мобильных элементов во время репрограммирования до плюрипотентной стадии [59]. Существует множество доказательств, связывающих регуляцию мобильных элементов с метаболическими фенотипами. Первый (и до сих пор один из лучших примеров эпигенетического наследования ожирения) - это трансгенерационный контроль ретротранспозона перед геном агути у мышей [60].Более того, SETDB1 и TRIM28 (также известный как KAP1), которые оба репрессируют ретротранспозоны, также модулируют ожирение у мышей [61,62]. Таким образом, возможно, что цРНК сперматозоидов - посредством прямого контроля ретротранспозонов или генов, несущих регуляторные элементы, заимствованные из ретротранспозонов, - устанавливают долгосрочные метаболические программы в эмбрионе, которые позже определяют риски ожирения у потомства.

Принимая во внимание накапливающиеся доказательства того, что sncRNA является мобильным источником межклеточной коммуникации, возникает интригующая идея, что эта коммуникация эффективна также от сперматозоида к яйцеклетке.Это убедительно подтверждается исследованиями на мышах [24,26,28], но из-за этических ограничений такие исследования трудно проводить на людях. Несмотря на то, что недавнее исследование качества эмбрионов, проведенное Хуа и его коллегами [34], поддерживает эту идею, убедительные доказательства того, что яйцеклетка человека реагирует на изменения в пуле sncRNA сперматозоидов, или на то, что было названо кодом sncRNA [63], являются отсутствующий. Мы, однако, показали, что человеческая сперма обладает пластичностью, чтобы переконфигурировать код sncRNA сперматозоидов в ответ на быстрые изменения окружающей среды, что у других видов послужило сигналом для следующего поколения.Наиболее важно то, что параллельная реакция подвижности сперматозоидов и сдвиги в коде sncRNA указывает на то, что может быть общая этиология между мужской фертильностью и метаболическими реакциями между поколениями.

Мы пришли к выводу, что человеческая сперма очень чувствительна к диетическим изменениям, и предполагаем, что эта чувствительность включает взаимодействие между кодом sncRNA и функцией сперматозоидов. Вероятно, это обусловлено двумя независимыми путями, разделенными клеточной компартментацией (ядерной / митохондриальной). Дальнейшее изучение этих путей может иметь решающее значение не только для понимания глобального снижения функции сперматозоидов человека, но и может предоставить возможный механизм быстрых межпоколенческих метаболических реакций, которые до сих пор описаны только у животных.

Материалы и методы

Заявление об этике

Исследование было одобрено в соответствии с Хельсинкской декларацией региональным советом по этике Университета Линчёпинга, Швеция (номер разрешения: 2016 / 183-31). Мы получили письменное информированное согласие всех участников.

Дизайн исследования и участники

Диетическое вмешательство проводилось в течение 2-недельного периода. В него вошли 15 добровольцев, нанятых рекламодателями в Университете Линчёпинга, Швеция.Критерии включения: возраст от 20 до 30 лет, отсутствие ожирения (т. Е. ИМТ <30,0 кг / м 2 ), некурящий и всеядный. В течение 2 недель диетического вмешательства набранные участники обязались воздерживаться от алкоголя, и их попросили поддерживать постоянный уровень активности.

Расчет TEE

Перед началом вмешательства уровень физической активности участников (PAL) оценивался с помощью анкеты, включающей вопросы, касающиеся их PAL на работе и дома / в свободное время [64].BodPod (COSMED USA, Конкорд, Калифорния) использовался для измерения жировой и мышечной массы. Мы также измерили вес и рост участников, по которым была предсказана базальная скорость метаболизма (BMR) участников в соответствии с возрастом [65]. Затем TEE участников был рассчитан как TEE = BMR × PAL [32]. Предполагалось, что расчетное TEE для каждого участника соответствует их индивидуальной суточной потребности в энергии (то есть потребляемой энергии, необходимой для поддержания их текущей массы тела) (таблица S1).

Диетическое вмешательство

В течение первой недели диеты участники ( n = 15) получали стандартизированную здоровую диету с потреблением энергии, соответствующей их расчетному TEE.Диета была разработана с учетом рекомендаций по питанию северных стран [32] и предполагала следующее распределение энергии по приемам пищи: завтрак 25%, обед 30%, ужин 30% и закуски 15%. Все блюда были предоставлены исследовательской группой, и участники были проинструктированы пить только воду в течение первой недели исследования. На завтрак им давали натуральный йогурт (3% жирности), сухие завтраки (цельнозерновые), натуральный фундук, банан, хрустящий хлеб, масло (60% жирности), твердый сыр (28% жирности), яйцо и перец.На закуски участники получили банан, яблоко, помидоры черри, молодую морковь и натуральный миндаль. Обед и ужин были предоставлены университетским рестораном в тесном сотрудничестве с диетологами исследовательской группы и прошли такую ​​же тщательную стандартизацию, как и все другие блюда.

В течение второй недели участники получали ту же стандартизированную здоровую диету, как описано выше. В дополнение к этой диете участники также потребляли конфеты (за исключением шоколада и солодки) и подслащенные напитки, что соответствовало 50% их расчетного ЧВВ.Баланс между конфетами и сладкими напитками был скорректирован в соответствии с их собственными предпочтениями, чтобы оптимизировать соблюдение требований. Употребление конфет и подслащенных напитков вместе со стандартизированной здоровой диетой привело к потреблению энергии, которое соответствовало 150% от их расчетного ЧВЭ.

Сбор спермы

В период с ноября 2016 года по октябрь 2017 года в Центре репродуктивной медицины Университетской больницы Линчёпинга было взято

образцов спермы от каждого человека в исследовательской группе ( n = 15) в трех временных точках.Образцы получали мастурбацией после 2-3 дней полового воздержания, собирали в стерильные 50 мл неспермиотоксичные полипропиленовые пробирки и позволяли разжижаться при комнатной температуре. После разжижения спермы были получены стандартные параметры спермы (объем, плотность, подвижность, лейкоциты) в соответствии с критериями Всемирной организации здравоохранения [66].

Получение подвижных сперматозоидов и дальнейшая обработка

Подвижных сперматозоидов получали с использованием прерывистой (1.5 мл 80% / 1,5 мл 40%) градиент PureSperm (Nidacon Int, Гетеборг, Швеция). Чистую сперму (0,5–2,0 мл) наслаивали на верхнюю часть градиента и центрифугировали при 300 g в течение 20 минут с последующим ресуспендированием осадка в уравновешенной среде для подготовки спермы (PureSperm Wash; Nidacon). После этого суспензию сперматозоидов центрифугировали при 500, g, в течение 10 минут, ресуспендировали и разбавляли до подходящей концентрации / объема подвижных сперматозоидов (с использованием счетной камеры Маклера; Cellvision, Heerhugowaard, Нидерланды) в уравновешенной среде PureSperm Wash.Доля подвижных сперматозоидов после приготовления всегда была> 97%. Затем аликвоты подготовленных подвижных сперматозоидов (0,03–0,10 мл; общее количество подвижных сперматозоидов в эякуляте от 0,35 до 21 миллиона) затем переносили в 1,5 мл ПЦР-чистые микропробирки с последующим немедленным замораживанием в жидком азоте (-196 ° C). Суспензии замороженных сперматозоидов хранили при -80 ° C до последующей экстракции РНК сперматозоидов.

Экстракция РНК

Экстракцию РНК

проводили с использованием набора miRNeasy Micro (Qiagen, Венло, Нидерланды) и выполняли в соответствии с инструкциями производителя с небольшими корректировками.Особое внимание было уделено тому, чтобы образцы спермы никогда не оттаивали перед гомогенизацией. К замороженным образцам добавляли 0,15 г замороженных стальных шариков 0,2 мм (SSB02-RNA NextAdvance, Troy, NY) с последующим добавлением предварительно охлажденного Qiazol (Qiagen). Образцы быстро перемещали в Tissue Lyser LT (Qiagen) и гомогенизировали со скоростью 30 колебаний в секунду в течение 5 минут с последующим нагреванием до 37 ° C и затем гомогенизацией в течение еще 3 минут [67]. Добавляли хлороформ и проводили разделение фаз центрифугированием при 12000 g .Верхние фазы собирали и наносили на спин-колонки с РНКазой MinElute, входящие в комплект. Затем колонки повторно промывали перед тем, как РНК элюировали 14 мкл воды и хранили при -70 ° C до приготовления библиотеки.

Подготовка библиотеки

Подготовка библиотеки

была выполнена с помощью набора для подготовки библиотеки малых РНК NEBNext для Illumina (New England Biolabs, Ipswich, MA) в соответствии с инструкциями производителя со следующими незначительными изменениями. Образцы стандартизировали по количеству вводимых сперматозоидов, и праймеры в наборе разводили соответственно 1: 7.Амплифицированные библиотеки очищали с использованием Agencourt AMPure XP (Beckman Coulter, Brea, CA) и выбирали размер для фрагментов от 130 до 165 нуклеотидов на предварительно залитом 6% полиакриламидном геле Novex TBE (Invitrogen, Waltham, MA). Экстракцию геля проводили с использованием пробирок для разрушения геля (IST Engineering, Milpitas, CA) в буфере, входящем в комплект NEBNext. Дезинтегрированные гели инкубировали при 37 ° C в течение 1 часа на шейкере, быстро замораживали в течение 15 минут при -80 ° C, после чего следовала еще одна инкубация в течение 1 часа. Все оставшиеся остатки геля удаляли с помощью Spin-X 0.Центрифужные пробирки 45 мкм (Corning Inc., Corning, NY) в соответствии с рекомендациями протокола NEBnext. Библиотеки осаждали в течение ночи при -80 ° C, добавляя 1 мкл GlycoBlue (Invitrogen) в качестве соосаждения, 0,1-кратного объема ацетата 3M (pH 5,5) и 3-кратного объема 100% этанола. Концентрации библиотеки оценивали с использованием ДНК-системы QuantiFluor ONE ds на флуорометре Quantus (Promega, Madison, WI). Объединенные библиотеки секвенировали на NextSeq 500 с помощью NextSeq 500/550 High Output Kit, версия 2, 75 циклов (Illumina, San Diego, CA).Все объединенные библиотеки прошли стандартный контроль качества Illumina.

Предварительная обработка последовательных чтений

S1 Text содержит сценарий R с инструкциями и функциями о том, как автоматически импортировать данные из таблиц S1 – S4 и данных S1 и S2 и восстановить некоторые результаты, представленные в основной статье. Обновления скрипта будут размещены на https://github.com/Danis102.

Cutadapt версии 1.9.1 [68] использовался для обрезки любых остатков последовательности адаптера (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA) из секвенированных считываний.Были сохранены только обрезанные считывания между 15–45 нуклеотидами, содержащие последовательность адаптера, и 80% нуклеотидов с показателями качества Illumina (Q-score)> 20. Средняя глубина составила 30,05 ± 1,14 млн считываний на образец (мин. = 17,23 млн), из которых не менее 81,54% прошли наши начальные фильтры. Для первоначального анализа обрезанные чтения были сопоставлены с малыми РНК с помощью Sports 1.0, аналитического рабочего процесса на основе perl, хорошо подходящего для многих типов малых РНК, включая рсРНК [69]. Мы использовали настройки по умолчанию и файлы базы данных для генома человека, которые доступны на спортивном гитхабе (https: // github.com / junchaoshi / sports1.0; по состоянию на июнь 2019 г.). Это включало файлы генома hg38 UCSC, miRNA из miRbase 21, рРНК из NCBI / Nucleutide, тРНК из GtRNAdb, piRNA из pirBase и piRNAbank, другие нкРНК из ensembl (release-89) и rfam 12.3. Средние значения, суммированные по биотипам (рсРНК, цРНК, миРНК и т. Д.), Были основаны на аннотациях по умолчанию в выходных файлах спортивных результатов. Чтобы избежать слишком большого шума, был применен фильтр неконсервативного охвата, который отбрасывал фрагменты с <0,01 считывания на миллион (об / мин) в 33% выборок (3 образца на участника).Данные о спортивных результатах доступны в S1 Data.

Специфическое картирование и анализ тРНК

с использованием MINTmap

Поскольку Sports в настоящее время не поддерживает расширенный анализ митохондриальной тРНК, для более специфического анализа тРНК вместо этого использовалась MINTmap версии 1.0 [33]. Обрезанные адаптером и качественно отфильтрованные чтения были сопоставлены с базой данных тРНК MINTbase, содержащей 640 полноразмерных последовательностей тРНК. Мы использовали настройки по умолчанию для генома человека GRCh47 / hg19. Анализ включал цРНК, которые картировались исключительно с последовательностями тРНК, цРНК, которые неоднозначно картировали последовательности тРНК с возможным дополнительным выравниванием геномных последовательностей за пределами пространства тРНК, и аналогичные последовательности тРНК.Классификации вместе с выходными данными MINTmap, нормализованными к RPM по отношению к общему количеству чтений в исходном файле fastq, представлены в S2 Data.

Аннотации для изоакцепторов / декодеров (например, LysCTT, ArgCGG), подтипа цРНК (5'-половина, 5'-цРНК, i-цРНК, 3'-цРНК, 3'-половина) и полных последовательностей тРНК были получены из Файлы программного обеспечения MINTmap, а аннотация петли тРНК была получена с веб-страницы MINTbase (https://cm.jefferson.edu/MINTbase/; по состоянию на 29 ноября 2018 г.). MINTbase определяет подтипы цРНК следующим образом: 5'-цРНК и 5'-половинки выравниваются со своим первым положением в первом положении зрелой тРНК, тогда как 3'-цРНК и 3'-половинки имеют полноразмерную последовательность терминации тРНК - CCA - на их 3'-концах.5'- и 3’-половины являются точными фрагментами, оставляя 5′- и 3′-цРНК на все остальное, либо короче, либо длиннее, чем половинки. Пятый подтип, i-цРНК, представляет собой любой фрагмент, который не начинается и не заканчивается в начальной или концевой части полноразмерной тРНК.

Значения

об / мин были проанализированы с использованием различных пакетов в R версии 3.5.1 и Bioconductor версии 3.7. Если не указано иное, мы применили фильтр покрытия, отбрасывающий фрагменты с <1 об / мин в 33% образцов, и фильтр размера, сохраняющий фрагменты между 16 и 45 нуклеотидами.Всего было сохранено 1725 уникальных фрагментов, что составляет 3,75% от всех последовательностей, обнаруженных MINTmap. Эти числа были ожидаемыми, потому что большинство фрагментов были обнаружены только при низком покрытии в одном или нескольких образцах, и потому что обнаружение более 45 нуклеотидов было смещено процедурами выбора размера геля.

Поскольку полноразмерные тРНК часто встречаются в нескольких связанных копиях, содержащих последовательности, которые полуконсервированы в этих копиях, некоторые фрагменты будут отображаться в несколько полноразмерных тРНК. Поэтому о проблемах множественного сопоставления сообщается в таблице S4 и данных S1 / S2.Чтобы иметь возможность визуализировать наши результаты, мы постоянно сообщаем о наиболее выровненной полноразмерной тРНК, показывающей самый высокий охват RPM. Однако следует подчеркнуть, что некоторые из фрагментов могли происходить из других полноразмерных тРНК, которые имеют общую последовательность с наиболее выровненной / покрытой полноразмерной тРНК.

Чтобы сопоставить каждый фрагмент с разрешением одного нуклеотида в наилучшим образом выровненных / покрытых полноразмерных тРНК, мы использовали функцию vmatchPattern в Biostrings версии 2.48 [70], в то время как покрытие тРНК рассчитывалось на дискретных значениях RPM с использованием функции покрытия в GenomicRanges 1.32,6 [71]. Поскольку MINTmap добавляет неопределенные нуклеотиды (NNN) к 3 'и 5' концам, это также было добавлено в наш анализ выравнивания последовательностей и анализа покрытия. Для анализа и построения T-петли была использована версия stringr 1.3.1 [72] для стандартизации начальной позиции T-петли до первого появления консервативных последовательностей TTC или ATC (что составляет 80,1% и 6,1% всех 640 тРНК, соответственно). Аналогичный подход был использован для локализации мотива TTCGA в Т-петле. Исходное положение для T-петель без TTC или ATC было установлено на первый 5'-нуклеотид в T-петле.Затем рассчитывали расстояние между концом фрагмента 3 'и началом 5' Т-образной петли. Чтобы справиться с проблемами множественного сопоставления, фрагментам было назначено наиболее распространенное расстояние между множественными сопоставлениями полноразмерных тРНК. Графики были созданы с использованием ggplot2 версии 3.0 [73].

Анализ цРНК на внешних наборах данных

Для сравнения с соответствующими ранее опубликованными данными о малых РНК сперматозоидов человека мы загрузили необработанные файлы fastq из когорты худых ( n = 13) и страдающих ожирением ( n = 10) взрослых мужчин, опубликованные Донкиным и коллегами и доступные в проекте NCBI Sequence Read Archive (SRA) (SRP065418; Gene Expression Omnibus [GEO] access: GSE74426) [25] с использованием инструментария SRA версии 2.9.2 [74]. Аналогичным образом, данные исследования, опубликованного Хуа и его коллегами, посвященного изучению РНК сперматозоидов в отношении высокого ( n = 23) и низкого ( n = 64) качества эмбрионов после экстракорпорального оплодотворения (проект SRA: SRP132262; доступ GEO: GSE110190). ) [34] был загружен. Необработанные чтения были обрезаны, отфильтрованы по качеству и импортированы в MINTmap, как описано ранее. Наша проверка качества выявила серьезный выброс среди выборок худых из набора данных Донкина и его коллег, который был исключен из дальнейшего анализа (окончательный набор данных: худой n = 12; ожирение n = 10).Поскольку обрезанные адаптером считывания из набора данных Донкина и его коллег имели максимальную длину считывания 32 нуклеотида, шведский набор данных включал только цРНК с ≤32 нуклеотидами при анализе в разных исследованиях.

проверка цРНК с помощью qPCR

Количественное определение цРНК с использованием ретротранскрипции «стебель-петля» (RT) описано в другом месте [39]. Вкратце, 20 нг тотальной РНК сперматозоидов инкубировали при 65 ° C в течение 5 минут с 0,5 мкл 10 мМ dNTP и 1 мкл tsRNA-специфического праймера RT типа «стебель-петля» (LysCTT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATTACGAC AACCCGGATCAGTACGACCGTAC AACCCGGATCAGTAGCAGCACGTAC AACCCGGATCAGGATЗатем образцы немедленно помещали на лед на 2 минуты с последующим добавлением 6,45 мкл смеси RT, 4 мкл 5-кратного буфера для первой цепи, 2 мкл 0,1 M DTT, 0,2 мкл RNase OUT и 0,25 мкл Superscript III (Thermo Scientific, Waltham , Массачусетс). RT выполняли при 16 ° C в течение 30 минут, 60 циклов при 30 ° C в течение 30 секунд, 42 ° C в течение 30 секунд и 50 ° C в течение 1 секунды и заканчивали инактивацией фермента при 85 ° C в течение 5 минут. Полученную кДНК разводили 1: 5 перед проведением кПЦР с использованием SsoAdvanced Universal SYBR Green Supermix (BioRad, Hercules, CA) со специфичным для цРНК прямым праймером (LysCTT: TGGGACTCTTAATCCCAGGG; MT_SerTGA: AAAGTCATGGAGGCCATGGG праймером универсальной петли) и универсальным праймером обратной петли. (GTGCAGGGTCCGAGGT).Специфичность продукта подтверждали электрофорезом в агарозном геле и отсутствием сигнала в контролях без матрицы и без RT.

Статистика

Весь анализ секвенирования tsRNA / rsRNA был выполнен на дискретных значениях RPM, импортированных в смешанную линейную модель повторных измерений с отрицательным биномиальным распределением с использованием пакета lme4 версии 1.1.18.1 [75]. Эта модель была мотивирована парным дизайном выборки, а также тем, что значения RPM основаны на подсчете считываний, которые ранее показали лучшую согласованность с отрицательным биномиальным распределением, а не с распределением Гаусса или Пуассона [76].Поскольку в настоящее время не существует метода для моделирования статистической зависимости между тесно связанными цРНК, которые могут происходить или не происходить из одной и той же тРНК (см. Подзаголовок «Специфичное картирование и анализ тРНК с использованием MINTmap»), мы не корректировали наши значения p для множественное тестирование. Не зная зависимости между цРНК, существует серьезный риск совершения ошибок типа II (ложноотрицательные) при использовании любого существующего подхода для исправления множественных тестов в анализе tsRNA-seq. Кластерный анализ и визуализация были выполнены с использованием иерархической кластеризации на евклидовых расстояниях от масштабированных данных по центру с использованием ape 5.2 [77]. Для проверки количественной ПЦР использовались парные и двусторонние (большее выражение в сахаре, чем в здоровом) тесты Вилкоксона с ранговыми знаками.

Дополнительная информация

S1 Рис. Распределение размеров и смещение первых нуклеотидов малой РНК сперматозоидов.

Гистограммы для всех эякулятов от всех участников ( n = 15 участников × 3 повторных эякулята). Цвета для первого N ; Красный = A, Зеленый = C, Синий = G, Пурпурный = T).

https://doi.org/10.1371/journal.pbio.3000559.s001

(EPS)

S2 Фиг. Анализ рсРНК с использованием Sports 1.0.

(A) Среднее значение экспрессии рсРНК участниками, суммированное по полноразмерным ядерным (5S, 5,8S, 18S, 28S) и митохондриальным (12S, 16S) субъединицам рРНК. 45S является единицей транскрипции пре-рРНК, с исключением картирования рсРНК на субъединицы 5,8S, 18S и 28S, оставляя только 2 спейсера. (B) Различия в изменении кратности на rsRNA сахара по сравнению со здоровой диетой. Круговые диаграммы показывают процентное соотношение фрагментов с повышенной / пониженной регуляцией.(C) Сложите изменения каждого участника. Активируются только субъединицы митохондриальной рРНК. (D) Охват различных субъединиц рРНК с использованием данных текущего исследования (левый столбец) и данных двух контрастных исследований, нацеленных на различия малых РНК сперматозоидов у мужчин с ожирением и худых (средний столбец [25]) и мужчин, генерирующих высокие или низкие показатели. -качественные эмбрионы, оплодотворенные in vitro (правая колонка [34]). Стрелки показывают самый высокий пик каждой субъединицы в текущем исследовании. (E) Различия в экспрессии субъединицы рсРНК сперматозоидов между худыми (светлые) и тучными (темные) мужчинами.Митохондриальные субъединицы подавлены. (F) То же, что и (E), но между эмбрионами высокого (светлого) и низкого (темного) качества. Прокладки 45S и, возможно, 12S (см. D) имеют повышенное качество. * p < 0,05 и ** p < 0,01 отрицательные биномиальные обобщенные линейные (контрастные исследования) или смешанные линейные (текущее исследование) модели. Данные доступны в S1 Data, проекте SRA: SRP065418 и проекте SRA: SRP132262.

https://doi.org/10.1371/journal.pbio.3000559.s002

(EPS)

S3 Фиг.Проверка фрагментов цРНК с помощью кПЦР.

Две чувствительные к диете цРНК - ядерная и-цРНК LysCTT (нитРНК) и митохондриальная 5'-цРНК SerTGA - были выбраны для проверки кПЦР. (A) Картирование цРНК (жирный шрифт) по полноразмерной тРНК. (B) Оба анализа успешно амплифицированы в чЭСК с почти экспоненциальной эффективностью. (C) Результаты секвенирования и КПЦР хорошо коррелировали для всех участников ( n = 30; 15 здоровых, 15 сахара). Обратите внимание, что высокое значение Ct означает более низкую экспрессию. (D) И сперматозоиды, и чЭСК генерировали уникальные фрагменты ожидаемого размера после кПЦР.(E) Односторонний знаковый ранговый тест Вилкоксона также подтвердил, что экспрессия была выше в сахаре, чем в здоровом. Вместе эксперимент кПЦР подтвердил присутствие цРНК в сперматозоидах, а также в чЭСК и подтвердил эффект диетического вмешательства. Данные доступны в S3 Data. hESC, эмбриональные стволовые клетки человека; МТ, митохондриальный.

https://doi.org/10.1371/journal.pbio.3000559.s003

(EPS)

S4 Рис. Воспроизводимое покрытие цРНК на чувствительных к диете ядерных цРНК в независимых исследованиях.

На графиках показаны параллельные сравнения между настоящим исследованием (левый столбец) и исследованием ожирения Донкина и его коллег [25] (средний столбец) и исследованием качества эмбрионов Хуа и его коллегами [34] (правый столбец) по нуклеотиду. охват полноразмерных последовательностей тРНК. Левый столбец; Красные линии = сахарная диета, синие линии = здоровое питание. Средний столбец; Красные линии = полные мужчины, синие линии = худощавые мужчины, правый столбец; Красные линии = эмбрионы высокого качества, Синие линии = эмбрионы низкого качества. Данные доступны в S2 Data, проекте SRA: SRP065418 и проекте SRA: SRP132262.

https://doi.org/10.1371/journal.pbio.3000559.s004

(EPS)

S5 Рис. Воспроизводимое покрытие цРНК, но обратное влияние на чувствительные к диете митохондриальные тРНК в независимых исследованиях.

На графиках показаны параллельные сравнения между настоящим исследованием (левый столбец) и исследованием ожирения Донкина и его коллег [25] (средний столбец) и исследованием качества эмбрионов Хуа и его коллегами [34] (правый столбец) по нуклеотиду. охват полноразмерных последовательностей тРНК.Левый столбец; Красные линии = сахарная диета, синие линии = здоровое питание. Средний столбец; Красные линии = ожирение, синие линии = худой, правый столбец; Красные линии = эмбрионы высокого качества, Синие линии = эмбрионы низкого качества. Данные доступны в S2 Data, проекте SRA: SRP065418 и проекте SRA: SRP132262.

https://doi.org/10.1371/journal.pbio.3000559.s005

(EPS)

S6 Рис. Средний состав различных подтипов малых РНК в исследованиях.

Текущее исследование сравнивали с двумя другими исследованиями, Donkin et al. [25] и Hua et al. [34].Диаграммы были построены с использованием идентичного рабочего процесса по умолчанию в Sports 1.0, при сохранении только фрагментов от 16 до 45 нуклеотидов с минимум 0,01 об / мин в 100% образцов. Данные доступны в S1 Data, проекте SRA: SRP065418 и проекте SRA: SRP132262.

https://doi.org/10.1371/journal.pbio.3000559.s006

(EPS)

S7 Рис. Митохондриальные цРНК демонстрируют разнообразный репертуар сайтов расщепления.

Графики демонстрируют тот же анализ покрытия и сайта расщепления, который был представлен на рис. 5A – 5D для ядерной цРНК, но со значительными изодекодерами митохондриальной тРНК, представленными на рис. 2H.Каждая панель изодекодера разделена на 3 субпанели: общий охват нуклеотидов (верхняя панель), экспрессия начального сайта (средняя панель) и экспрессия конечного сайта (нижняя панель). Каждая панель суммирована в виде среднего числа оборотов в минуту для сахара (темно-серый) и здорового (светло-серый), соответственно. В отличие от ядерных тРНК, митохондриальные тРНК не обнаруживают очевидной когерентности в локализации сайта расщепления. Обратите внимание, однако, что они все еще сильно сорегулируются, как показано кластерным анализом на рис. 3 и диаграммой рассеяния на рис. 6F.Данные находятся в S2 Data.

https://doi.org/10.1371/journal.pbio.3000559.s007

(EPS)

S8 Рис. Доказательства расщепления нитРНК в TTCGA T-петле изодекодера тРНК с высоким содержанием 5'-цРНК.

Графики, показывающие разницу между сахаром (красный) и здоровым (синий) в отношении нуклеотидного покрытия между типами цРНК, нанесенными на последовательность GluCTC. Верхняя панель показывает 5'-цРНК и 5'-половины, средняя панель i-цРНК и нижняя панель 3'-цРНК и 3'-половины. На изодекодер GluCTC не влияла диета с высоким содержанием сахара при включении всех типов отображаемых на нее фрагментов (рис. 2H).Однако при анализе расщепления Т-петли было выявлено наличие значительных нитРНК (таблица S4) (рис. 5J). Обратите внимание, что диета не повлияла на 5'-цРНК и 5'-половинки (верхняя панель), что объясняет, почему она не показала никаких различий в анализе изодекодера. Однако в соответствии с анализом Т-петли, многие i-цРНК увеличивались при высоком содержании сахара (средняя панель). Также обратите внимание, что на 3'-цРНК (нижняя панель), которые, вероятно, являются побочными продуктами расщепления при образовании 5'-цРНК, диета не влияла. Данные доступны в S2 Data.

https://doi.org/10.1371/journal.pbio.3000559.s008

(EPS)

S9 Рис. Производство нитРНК в зависимости от диеты.

Большинство значительно измененных ядерных цРНК имели 3'-конец внутри Т-петли. Положение 5'-стартового нуклеотида было менее точным, скорее оно варьировалось в зависимости от типа изодекодера тРНК. Чувствительное к диете расщепление теоретически должно приводить к соответствующей 3'-цРНК. Хотя были некоторые свидетельства таких совпадающих 3'-цРНК (см. Фиг. 5D, фиг. S4, таблицу S4), в целом они демонстрировали низкую экспрессию.Возможные объяснения отсутствия 3'-цРНК включают избирательную деградацию 3'-побочных продуктов или то, что только нитРНК (но не 3'-цРНК) доставляются в сперматозоиды путем перемещения экзосом. Несовместимость между модификациями РНК, присутствующими в 3'-побочных продуктах, и ферментами, используемыми при получении библиотек для секвенирования, также является возможным объяснением.

https://doi.org/10.1371/journal.pbio.3000559.s009

(EPS)

S4 Таблица. Аннотация и статистическая сводка для анализа MINTmap после фильтрации.

Содержит подробные аннотации и статистические результаты сравнения сахарной и здоровой диеты по всем анализируемым цРНК. Обратите внимание, что столбец «tsRNA type» представлен с исходными названиями MINTmap, где tRF = tsRNA (например, 3′-tRF = 3′-tsRNA).

https://doi.org/10.1371/journal.pbio.3000559.s013

(XLSX)

S5 Таблица. Дополнительная информация о цРНК представлена ​​на рис. 3.

Содержит последовательности, идентификаторы MINTmap и координаты генома для цРНК, представленные на рис. 3.Также содержит масштабированные по центру различия RPM между сахарной и здоровой диетами для каждого участника, которые были использованы для построения кладограммы на рис. 3. Цифры в первом столбце относятся к числу цРНК (1–54) на рис. 3. Обратите внимание, что Сценарий R в тексте S1 восстановит полную аналитическую процедуру для рис. 3.

https://doi.org/10.1371/journal.pbio.3000559.s014

(XLSX)

S2 Данные. Выходные данные MINTmap.

об / мин отдельной цРНК, извлеченной из MINTmap и нормализованной по отношению к общему количеству чтений исходных файлов необработанной последовательности (fastq).Обратите внимание, что столбец «tsRNA type» представлен с исходными названиями MINTmap, где tRF = tsRNA (например, 3′-tRF = 3′-tsRNA).

https://doi.org/10.1371/journal.pbio.3000559.s017

(XLSX)

Благодарности

Мы хотели бы выразить нашу благодарность персоналу ресторана Cellskapet, который позаботился о том, чтобы каждый участник получил персонализированные ланч-боксы, Э. Осту за иллюстрации участников и А. Бельмонту за ценные отзывы во время подготовки рукописи. .

Ссылки

  1. 1. Нельсон CMK, Bunge RG. Анализ спермы: данные об изменении параметров потенциала мужской фертильности. Фертильность и бесплодие. 1974. 25 (6): 503–7. https://doi.org/10.1016/S0015-0282(16)40454-1 pmid: 4835605
  2. 2. Карлсен Э., Гиверкман А., Кейдинг Н., Скаккебек NE. Доказательства снижения качества спермы за последние 50 лет. Британский медицинский журнал. 1992. 305 (6854): 609–13. pmid: 1393072
  3. 3. Роллан М., Ле Моаль Дж., Вагнер В., Ройер Д., Де Музон Дж.Снижение концентрации и морфологии спермы в выборке из 26 609 мужчин, близких к общей популяции, в период с 1989 по 2005 годы во Франции. Репродукция человека. 2012; 28 (2): 462–70. pmid: 23213178
  4. 4. Фиш Х. Уменьшение количества сперматозоидов во всем мире: опровержение мифа. Урологические клиники Северной Америки. 2008. 35 (2): 137–46. pmid: 18423235
  5. 5. Сенгупта П., Датта С., Краевска-Кулак Э. Исчезающие сперматозоиды: анализ отчетов, опубликованных с 1980 по 2015 гг. Американский журнал мужского здоровья.2017; 11 (4): 1279–304. Epub 19.04. pmid: 27099345.
  6. 6. Хуанг Ц., Ли Б., Сюй К., Лю Д., Ху Дж., Ян И и др. Снижение качества спермы у 30 636 молодых китайских мужчин с 2001 по 2015 гг. Фертильность и бесплодие. 2017; 107 (1): 83–8.e2. https://doi.org/10.1016/j.fertnstert.2016.09.035 pmid: 27793371
  7. 7. Тигс А.В., Лэндис Дж., Гарридо Н., Скотт Р., Хоталинг Дж. Тенденция общего количества подвижных сперматозоидов с течением времени на двух континентах: оценка анализов спермы от 119 972 бесплодных мужчин.Фертильность и бесплодие. 2018; 110 (4): e27.
  8. 8. Чанг С., Назем Т.Г., Гунко Д., Ли Дж., Бар-Чама Н., Шамонки Дж. М. и др. Одиннадцатилетнее лонгитюдное исследование доноров спермы в США демонстрирует снижение количества и подвижности сперматозоидов. Фертильность и бесплодие. 2018; 110 (4): e54 – e5.
  9. 9. Лю И, Дин З. Ожирение, серьезный этиологический фактор мужской субфертильности в современном обществе. 2017; 154 (4): R123. pmid: 28747541
  10. 10. Пергиалиотис В., Продромиду А., Фрунцас М., Короу Л.М., Влахос Г.Д., Перреа Д.Сахарный диабет и функциональные характеристики сперматозоидов: метаанализ обсервационных исследований. Журнал диабета и его осложнений. 2016; 30 (6): 1167–76. https://doi.org/10.1016/j.jdiacomp.2016.04.002 pmid: 27107613
  11. 11. Катиб А. Механизмы, связывающие ожирение с мужским бесплодием. Центральноевропейский урологический журнал. 2015. 68 (1): 79–85. Epub 13.03. pmid: 25914843.
  12. 12. Du Plessis SS, Cabler S, McAlister DA, Sabanegh E, Agarwal A. Влияние ожирения на нарушения спермы и мужское бесплодие.Обзоры природы Урология. 2010; 7: 153. pmid: 20157305
  13. 13. Ибаньес-Перес Дж., Сантос-Соррозуа Б., Лопес-Лопес Э., Маторрас Р., Гарсия-Орад А. Обновленная информация о влиянии физической активности на качество спермы: систематический обзор и метаанализ. Архив гинекологии и акушерства. 2019; 299 (4): 901–21. pmid: 30671700
  14. 14. Салас-Уэтос А., Булло М., Салас-Сальвадо Дж. Диетические модели, продукты питания и питательные вещества в параметрах мужской фертильности и фертильности: систематический обзор наблюдательных исследований.Обновление репродукции человека. 2017; 23 (4): 371–89. pmid: 28333357
  15. 15. Слышал E, Martienssen RA. Эпигенетическая наследственность между поколениями: мифы и механизмы. Клетка. 2014. 157 (1): 95–109. pmid: 24679529
  16. 16. Перес М.Ф., Ленер Б. Эпигенетическая наследственность между поколениями и между поколениями у животных. Природа клеточной биологии. 2019: 1.
  17. 17. Рандо О.Дж., Симмонс Р.А. Я ем для двоих: диета родителей влияет на метаболизм потомства. Клетка.2015. 161 (1): 93–105. pmid: 25815988.
  18. 18. Менеджер по продажам, Фергюсон-Смит АС, Патти М. - Э. Эпигенетические механизмы передачи метаболических заболеваний из поколения в поколение. Клеточный метаболизм. 2017; 25 (3): 559–71. pmid: 28273478
  19. 19. Ост А., Лемпрадл А., Касас Э., Вейгерт М., Тико Т., Дениз М. и др. Отцовская диета определяет состояние хроматина у потомства и межпоколенческое ожирение. Клетка. 2014. 159 (6): 1352–64. pmid: 25480298
  20. 20. Allshire RC, Эквалл К.Эпигенетическая регуляция состояний хроматина у Schizosaccharomyces pombe. Перспективы Колд-Спринг-Харбор в биологии. 2015; 7 (7): a018770. pmid: 26134317
  21. 21. Чех B, Hannon GJ. Одна петля, чтобы управлять ими всеми: цикл пинг-понга и подавление звука, управляемое piRNA. Направления биохимических наук. 2016; 41 (4): 324–37. pmid: 26810602
  22. 22. Пантано Л., Джодар М., Бак М., Баллеска Дж. Л., Томмеруп Н., Олива Р. и др. Содержание малых РНК в человеческих сперматозоидах выявляет производные от псевдогена piРНК, комплементарные генам, кодирующим белок.РНК. 2015; 21 (6): 1085–95. Epub 2015/04/24. pmid: 256.
  23. 23. Чжан И, Чжан Х, Ши Дж, Туорто Ф, Ли Х, Лю И и др. Dnmt2 опосредует передачу от поколения к поколению отцовских метаболических нарушений через небольшие некодирующие РНК сперматозоидов. Природа клеточной биологии. 2018; 20 (5): 535–40. Epub 25.04. pmid: 29695786.
  24. 24. Chen Q, Yan M, Cao Z, Li X, Zhang Y, Shi J и др. ЦРНК сперматозоидов вносят вклад в наследование приобретенных метаболических нарушений из поколения в поколение.Наука. 2016; 351 (6271): 397–400. pmid: 26721680
  25. 25. Донкин И., Верстейхе С., Ингерслев Ларс Р., Цянь К., Мечта М., Нордкап Л. и др. Ожирение и бариатрическая хирургия приводят к эпигенетическим изменениям сперматозоидов у людей. Клеточный метаболизм. 2016; 23 (2): 369–78. https://doi.org/10.1016/j.cmet.2015.11.004 pmid: 26669700
  26. 26. Шарма У., Конин С.С., Ши Дж.М., Боскович А., Дерр А.Г., Бинг XY и др. Биогенез и функция фрагментов тРНК во время созревания и оплодотворения сперматозоидов у млекопитающих.Наука. 2016; 351 (6271): 391–6. Epub 2016/01/02. pmid: 26721685.
  27. 27. Шарма У., Сан Ф., Конин С.К., Райхгольф Б., Кукрея С., Херцог В.А. и др. Малые РНК попадают из придатка яичка в развивающуюся сперму млекопитающих. Dev Cell. 2018; 46 (4): 481–94 e6. Epub 2018/07/31. pmid: 30057273.
  28. 28. Sarker G, Sun W, Rosenkranz D, Pelczar P, Opitz L, Efthymiou V, et al. Материнское избыточное питание программирует гедонические и метаболические фенотипы из поколения в поколение с помощью цРНК сперматозоидов.Proc Natl Acad Sci U S. A. 2019; 116 (21): 10547–56. Epub 2019/05/08. pmid: 31061112.
  29. 29. Шигемацу М., Хонда С., Кирино Ю. Трансферная РНК как источник малых функциональных РНК. J Mol Biol Mol Imaging. 2014; 1 (2). Epub 2014/01/01. pmid: 26389128.
  30. 30. Shi X-X, Chen H, Xie P. Динамика диссоциации тРНК в ранних и поздних циклах удлинения трансляции рибосомой. Биосистемы. 2018; 172: 43–51. pmid: 30184468
  31. 31. Шорн А.Дж., Мартиенсен Р.Тай-брейк: хозяин и ретротранспозоны играют тРНК. Тенденции клеточной биологии. 2018.
  32. 32. Министры. NCo. Рекомендации по питанию стран Северной Европы 2012–2014 гг.
  33. 33. Лохер П., Телонис А.Г., Ригутсос И. MINTmap: быстрое и исчерпывающее профилирование ядерных и митохондриальных фрагментов тРНК из данных коротких последовательностей РНК. Научные отчеты. 2017; 7: 41184-. pmid: 28220888.
  34. 34. Хуа М., Лю В., Чен И, Чжан Ф., Сюй Б., Лю С. и др. Идентификация малых некодирующих РНК в качестве биомаркеров качества спермы для экстракорпорального оплодотворения.Открытие клетки. 2019; 5 (1): 20.
  35. 35. Hamilton CJCM, de Bruin JP, Cissen M, Hamilton JAM, Smeenk JMJ, Kremer JAM и др. Общее количество подвижных сперматозоидов: лучший показатель степени тяжести мужского бесплодия, чем система классификации сперматозоидов ВОЗ. Репродукция человека. 2015; 30 (5): 1110–21. pmid: 25788568
  36. 36. Рамараджу Г.А., Теппала С., Пратигудупу К., Калагара М., Тхота С., Кота М. и др. Связь между ожирением и качеством спермы. Андрология. 2018; 50 (3): e12888.pmid: 28929508
  37. 37. Иванов П., Эмара М.М., Виллен Дж., Гайги С.П., Андерсон П. Фрагменты тРНК, индуцированные ангиогенином, ингибируют инициацию трансляции. Mol Cell. 2011; 43 (4): 613–23. Epub 23.08.2011. pmid: 21855800.
  38. 38. Fu H, Feng J, Liu Q, Sun F, Tie Y, Zhu J и др. Стресс вызывает расщепление тРНК ангиогенином в клетках млекопитающих. Письма FEBS. 2009. 583 (2): 437–42. pmid: 140
  39. 39. Guzzi N, Cieśla M, Ngoc PCT, Lang S, Arora S, Dimitriou M и др.Псевдоуридилирование фрагментов, происходящих от тРНК, управляет трансляционным контролем в стволовых клетках. Клетка. 2018; 173 (5): 1204–16. e26. pmid: 29628141
  40. 40. Кумар П., Анайя Дж., Мудунури С.Б., Датта А. Мета-анализ фрагментов РНК, полученных из тРНК, показывает, что они эволюционно консервативны и связываются с белками AGO для распознавания конкретных мишеней РНК. BMC Biol. 2014; 12: 78. Epub 2014/10/02. pmid: 25270025.
  41. 41. Couvillion MT, Sachidanandam R, Collins K. Важный для роста белок Tetrahymena Piwi несет груз фрагментов тРНК.Genes Dev. 2010. 24 (24): 2742–7. Epub 2010/11/26. pmid: 21106669.
  42. 42. Диас Т.Р., Алвес М.Г., Сильва Б.М., Оливейра П.Ф. Транспорт и метаболизм глюкозы в сперме у диабетиков. Молекулярная и клеточная эндокринология. 2014. 396 (1): 37–45. https://doi.org/10.1016/j.mce.2014.08.005.
  43. 43. Чен И-Ц, Пан Л-Ц, Лай Ц., Цзянь И-С, Ву Т-Х. Силимарин и ингибитор протеинкиназы А модулируют опосредованную глюкозой подвижность сперматозоидов мышей: исследование in vitro. Репродуктивная биология.2015; 15 (3): 172–7. https://doi.org/10.1016/j.repbio.2015.06.003 pmid: 26370460
  44. 44. Уильямс AC, FORD WCL. Роль глюкозы в поддержании подвижности и емкости сперматозоидов человека. Журнал андрологии. 2001. 22 (4): 680–95. pmid: 11451366
  45. 45. Zhu Z, Umehara T, Okazaki T., Goto M, Fujita Y, Hoque SAM и др. Экспрессия генов и синтез белка в митохондриях увеличивают продолжительность высокоскоростной линейной подвижности сперматозоидов кабана. Границы физиологии.2019; 10 (252). pmid: 30914972
  46. 46. Йопе Т., Ламмерт А., Кратч Дж, Пааш Ю., Гландер Х. Дж. Лептин и рецепторы лептина в семенной плазме человека и в сперматозоидах человека. Международный журнал андрологии. 2003. 26 (6): 335–41. pmid: 14636218
  47. 47. Сильвестрони Л., Модести А., Сартори С. Взаимодействие инсулина и сперматозоидов: влияние на плазматическую мембрану и связывание с акросомой. Архивы андрологии. 1992. 28 (3): 201–11. pmid: 1530369
  48. 48. Лампиао Ф, Дю Плесси СС.Инсулин и лептин усиливают подвижность сперматозоидов, акросомную реакцию и выработку оксида азота. Азиатский журнал андрологии. 2008. 10 (5): 799–807. pmid: 18645684
  49. 49. Аманн РП. Цикл семенного эпителия у людей: необходимость пересмотреть? Журнал андрологии. 2008. 29 (5): 469–87. pmid: 18497337
  50. 50. Ren X, Chen X, Wang Z, Wang D. Является ли транскрипция сперматозоидов стационарной или динамической? Журнал воспроизводства и развития. 2017; 63 (5): 439–43. pmid: 28845020
  51. 51.Рейли Дж. Н., Маклафлин Е. А., Стангер С. Дж., Андерсон А. Л., Хатчон К., Черч К. и др. Характеристика эпидидимосом мышей выявляет сложный профиль микроРНК и потенциальный механизм модификации эпигенома сперматозоидов. Научный доклад 2016; 6: 31794. Epub 2016/08/24. pmid: 27549865.
  52. 52. Conine CC, Sun F, Song L, Rivera-Perez JA, Rando OJ. Малые РНК, полученные во время эпидидимального транзита сперматозоидов, необходимы для эмбрионального развития у мышей. Dev Cell. 2018; 46 (4): 470–80 e3.Epub 2018/07/31. pmid: 30057276.
  53. 53. Шарма У., Рандо О.Дж. Метаболические входы в эпигеном. Cell Metab. 2017; 25 (3): 544–58. Epub 2017/03/09. pmid: 28273477.
  54. 54. Чен Q, Ян В., Дуан Э. Эпигенетическое наследование приобретенных признаков через РНК сперматозоидов и модификации РНК сперматозоидов. Nat Rev Genet. 2016; 17 (12): 733–43. Epub 2016/11/01. pmid: 27694809.
  55. 55. Rando OJ. Передача эпигенетической информации в сперме от поколения к поколению. Cold Spring Harb Perspect Med.2016; 6 (5). Epub 2016/01/24. pmid: 26801897.
  56. 56. Рейли Дж. Н., Маклафлин Е. А., Стангер С. Дж., Андерсон А. Л., Хатчон К., Черч К. и др. Характеристика эпидидимосом мышей выявляет сложный профиль микроРНК и потенциальный механизм модификации эпигенома сперматозоидов. Научные отчеты. 2016; 6: 31794. https://www.nature.com/articles/srep31794#supplementary-information. pmid: 27549865
  57. 57. Войтех Л., Ву С., Хьюз С., Леви С., Боллвебер Л., Заутерауд Р.П. и др.Экзосомы в сперме человека несут особый набор небольших некодирующих РНК с потенциальными регуляторными функциями. Исследования нуклеиновых кислот. 2014. 42 (11): 7290–304. pmid: 24838567
  58. 58. Arienti G, Carlini E, Nicolucci A, Cosmi EV, Santi F, Palmerini CA. Подвижность сперматозоидов человека под влиянием простасом при различных уровнях pH. Biol Cell. 1999. 91 (1): 51–4. Epub 1999/05/13. pmid: 10321022.
  59. 59. Schorn AJ, Gutbrod MJ, LeBlanc C, Martienssen R. Контроль LTR-ретротранспозона с помощью малых РНК, полученных из тРНК.Клетка. 2017; 170 (1): 61–71 e11. Epub 2017/07/01. pmid: 28666125.
  60. 60. Морган HD, Сазерленд Х. Г., Мартин Д. И., Уайтлоу Э. Эпигенетическое наследование в локусе агути у мышей. Нат Жене. 1999. 23 (3): 314–8. Epub 1999/11/05. pmid: 10545949.
  61. 61. Даксинджер Л., Оэй Х., Исбел Л., Уайтлоу Н.С., Янгсон Н.А., Сперлинг А. и др. Гипометилирование ERV в сперме мышей, гаплонедостаточное для гистон-метилтрансферазы Setdb1, коррелирует с отцовским влиянием на фенотип.Научный отчет 2016; 6: 25004. Epub 2016/04/27. pmid: 27112447.
  62. 62. Dalgaard K, Landgraf K, Heyne S, Lempradl A, Longinotto J, Gossens K и др. Trim28 гаплонедостаточность вызывает бистабильное эпигенетическое ожирение. Клетка. 2016. 164 (3): 353–64. Epub 2016/01/30. pmid: 26824653.
  63. 63. Чжан Ю., Ши Дж., Расулзадеган М., Туорто Ф., Чен К. Код РНК сперматозоидов программирует метаболическое здоровье потомства. Обзоры природы Эндокринология. 2019; 15 (8): 489–98. pmid: 31235802
  64. 64.Bexelius C, Lof M, Sandin S, Trolle Lagerros Y, Forsum E, Litton JE. Измерения физической активности с помощью сотовых телефонов: проверка с использованием критериальных методов. J Med Internet Res. 2010; 12 (1): e2. Epub 2010/02/02. pmid: 20118036.
  65. 65. Генри CJ. Исследования основной скорости метаболизма у людей: измерение и разработка новых уравнений. Public Health Nutr. 2005; 8 (7A): 1133–52. Epub 2005/11/10. pmid: 16277825.
  66. 66. Организация WH. Лабораторное руководство ВОЗ по исследованию и обработке спермы человека.2010.
  67. 67. Георгиадис А.П., Кишор А., Зоррилла М., Джаффе TM, Санфилиппо Дж. С., Фольк Е. и др. Высококачественная РНК в сперме и сперме: выделение, анализ и возможное применение в клинических испытаниях. J Urol. 2015; 193 (1): 352–9. Epub 2014/08/05. pmid: 25088949.
  68. 68. Мартин М. Кутадапт удаляет последовательности адаптеров из операций чтения с высокой пропускной способностью. 2011; 17 (1): 3. Epub 2 августа 2011 г.
  69. 69. Ши Дж., Ко Е-А, Сандерс К.М., Чен Кью, Чжоу Т. СПОРТ1.0: инструмент для аннотирования и профилирования некодирующих РНК, оптимизированных для малых РНК, полученных из рРНК и тРНК. Геномика, протеомика и биоинформатика. 2018; 16 (2): 144–51.
  70. 70. Pages H, Aboyoun P, Gentleman R, DebRoy S. Биостринги: строковые объекты, представляющие биологические последовательности, и алгоритмы сопоставления v2.48.0. Пакет R. 2018. citeulike-article-id: 11644278.
  71. 71. Лоуренс М., Хубер В., Страницы Н., Абойун П., Карлсон М., Джентльмен Р. и др. Программное обеспечение для вычисления и аннотирования диапазонов генома.PLoS Comput Biol. 2013; 9 (8): e1003118. pmid: 23950696
  72. 72. Уикхэм Х. Стрингер: Простые согласованные оболочки для стандартных строковых операций 1.3.1. 2018.
  73. 73. Wickham H. ggplot2: элегантная графика для анализа данных: Springer; 2016.
  74. 74. Leinonen R, Sugawara H, Shumway M, Международная база данных нуклеотидных последовательностей C. Архив считывания последовательностей. Исследование нуклеиновых кислот. 2011; 39 (выпуск базы данных): D19 – D21. Epub 11/08. pmid: 21062823.
  75. 75.Бейтс Д., Мехлер М., Болкер Б., Уолкер С. Подбор линейных моделей со смешанными эффектами с использованием lme4. Журнал статистического программного обеспечения. 2015; 67 (1): 1–48.
  76. 76. Андерс С.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *