Универсальный внешний накопитель для всех iOS-устройств, совместим с PC/Mac, Android
Header Banner
8 800 100 5771 | +7 495 540 4266
c 9:00 до 24:00 пн-пт | c 10:00 до 18:00 сб
0 Comments

Содержание

Тиристор Т132-50, цена 130 грн.

Тиристор Т132-50 относится к силовым низкочастоным тиристорам штыревой конструкции. Средний ток в открытом состоянии 50А, повторяющееся импульсное напряжение в закрытом состоянии от 100В (1кл) Т132-50-1 до 1200В (12кл) Т132-50-12.

Тиристор Т132-50 применяется в цепях переменного и постоянного тока. Тиристор состоит из трех выводов: анод, катод и управляющий электрод. Как правило полупроводниковые приборы устанавливаются на охладитель для обеспечения оптимальных характеристик. Для тиристоров Т132 применяется охладитель типа О231, О331.

Основные особенности:

  • Герметичные металлостеклянные корпуса
  • Соответствуют зарубежным аналогам и международным стандартам
  • Низкие потери в открытом состоянии

Области применения:

  • Управление двигателями постоянного тока
  • Полностью управляемые и полууправляемые выпрямительные мосты
  • Регуляторы переменного тока 

Структура маркировки тиристора (пример):

Т132 – 50 – 12 – УХЛ2

Т – Тиристор низкочастотный

132 – Конструктивное исполнение

50 – Средний ток в открытом состоянии, А

12 – Класс по напряжению (Номинальное напряжение 1200В)

УХЛ2 – Климатическое исполнение 

 

Примеры маркировки тиристора и основные характеристики
Тип тиристора UDRM, В/ URRM, В * Класс ITAV, А ** Тип охладителя
Т132-50-1 100 1 50 О231, О331
Т132-50-2
200 2 50 О231, О331
Т132-50-3 300 3 50 О231, О331
Т132-50-4 400 4 50 О231, О331
Т132-50-5 500 5 50 О231, О331
Т132-50-6 600 6 50 О231, О331
Т132-50-7 700 7 50 О231, О331
Т132-50-8 800 8 50 О231, О331
Т132-50-9 900 9 50 О231, О331
Т132-50-10 1000 10 50 О231, О331
Т132-50-11 1100 11 50 О231, О331
Т132-50-12
1200 12 50 О231, О331
 
*UDRM, В/ URRM, В ― Повторяющееся импульсное напряжение в закрытом состоянии и повторяющееся импульсное обратное напряжение
**I TAV, А ― Максимально допустимый средний ток в открытом состоянии

Тиристор Т132-80-10

 

 

 

                              

                                          Т132


Тиристор низкочастотный штыревого исполнения.
Предназначен для работы в преобразовательных устройствах, в цепях постоянного и переменного тока различных силовых установок.
Выпускаются в металлостеклянном корпусе с жестким выводом.
Максимально допустимый средний прямой ток в открытом состоянии – 50 А

Повторяющееся импульсное напряжение в закрытом состоянии и повторяющееся импульсное обратное напряжение – 500 В
Охлаждение воздушное естественное или принудительное.
Обозначение типономинала и полярность выводов приводятся на корпусе.
Габаритные размеры:
– общая длина – 47 мм
– длина шпильки – 14 мм
– резьба – М8
Масса тиристора не более 27 г.
Рекомендуемые охладители: О131, О231, О331.

Структура условного обозначения:
Т132-50-5
Т – тиристор;
1 – порядковый номер модификации конструкции;
3 – обозначение диаметра корпуса по ГОСТ 20859.1-89;
2 – обозначение конструктивного исполнения корпуса по ГОСТ 20859. 1-89;
50 – максимально допустимый средний ток в открытом состоянии, А;
5 – класс по повторяющемуся напряжению.

Технические характеристики тиристоров низкочастотных штыревого исполнения Т132-50:

Наименование
тиристора
Максимально допустимые значения параметров при Тп=25°С Значения параметров при Тп=25°С Tj
IT(AV) UDRM/URRM ITSM rT (duD/dt)crit (diT/dt)crit UTM UT(TO) IL IH IGT UGT td tq IDRM/IRRM Rthjc
А В А МОм В/мкс А/мкс
В
В мА мА мА В мкс мкс мА °С/Вт °С
Т132-50-1 50 100 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-2 50 200 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5
-60…+125
Т132-50-3 50 300 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-4 50 400 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-5 50 500 900 4,8 50…1000 125
1,75
1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-6 50 600 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-7 50 700 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-8 50 800 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-9 50 900 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-10 50 1000 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-11 50 1100 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-12 50 1200 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2
0,5
-60…+125
Т132-50-13 50 1300 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-14 50 1400 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-15 50 1500 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125
Т132-50-16 50 1600 900 4,8 50…1000 125 1,75 1 150 90 100 3 2 63…250 2 0,5 -60…+125


Условные обозначения электрических параметров низкочастотных тиристоров:
 IT(AV) – Максимально допустимый средний ток в открытом состоянии.
• UDRM – Повторяющееся импульсное напряжение в закрытом состоянии.
• URRM – Повторяющееся импульсное обратное напряжение.
• ITSM – Ударный ток в открытом состоянии.
• rT – Динамическое сопротивление тиристора.
• (dVD/dt)crit – Критическая скорость нарастания напряжения в закрытом состоянии.
• (diT/dt)crit – Критическая скорость нарастания тока в открытом состоянии.
• UTM – Импульсное напряжение в открытом состоянии.
• UT(TO) – Пороговое напряжение тиристора.
• IL – Ток включения тиристора.
• IH – Ток удержания тиристора.
• IGT – Отпирающий постоянный ток управления.
• UGT – Отпирающее постоянное напряжение управления.
• td – Время задержки включения.
 tq – Время выключения.
• IDRM – Повторяющийся импульсный ток в закрытом состоянии.
• IRRM – Повторяющийся импульсный обратный ток.
• Rthjc – Тепловое сопротивление переход-корпус тиристора.
• Tj – Температура перехода тиристора.

ООО «Ростехкомплект» поставки радиоэлектронных компонентов.

Тиристоры | ООО «Ростехкомплект» поставки радиоэлектронных компонентов. /?php if (!$is_front): ?> /?php endif; ?>
2У101А КУ203Е Т123-250-15 Т143-630-9 Т161-200-10 Т353-800-32
2У101Б КУ203Ж Т123-250-16 Т143-800-10 Т161-200-11 Т50-10
2У101Г КУ203И Т123-250-4 Т143-800-12 Т161-200-12 Т50-11
2У101Д КУ208А Т123-250-8 Т143-800-14 Т161-200-13 Т50-12
2У101Е КУ208Б Т123-320-10 Т143-800-18 Т161-200-14 Т50-13
2У103В КУ208В Т123-320-12 Т143-800-4 Т161-200-16 Т50-14
2У111А КУ208Г Т123-320-13 Т15-100-10 Т161-200-3 Т50-15
2У201А КУ208Г1 Т123-320-4 Т15-100-11 Т161-200-4 Т50-3
2У201Б КУ208Д Т123-320-7 Т15-100-12 Т161-200-6 Т50-4
2У201В КУ208Д1 Т123-320-8 Т15-125-10 Т161-200-7 Т50-6
2У201Г КУ208Н Т123-320-9 Т15-125-14 Т161-200-8 Т50-7
2У201Д КУ221А Т132-25-11 Т15-160-10 Т171-200-10 Т50-8
2У201Е КУ221Б Т132-25-12 Т15-160-11 Т171-200-9 Т50-9
2У201Ж КУ221В Т132-25-7 Т15-160-12 Т171-250-10 Т500-10
2У201И КУ221Г Т132-40-10 Т15-160-14 Т171-250-10-40 Т500-11
2У201К КУ221Д Т132-40-11 Т15-160-16 Т171-250-10-42 Т500-12
2У201Л КУ222В Т132-40-12 Т15-200-10 Т171-250-11 Т500-13
2У202Д КУ228А Т132-40-5 Т15-200-12 Т171-250-12 Т500-14
2У202Е КУ228И Т132-40-7 Т15-200-14 Т171-250-13 Т500-16
2У202Ж КУ228И1 Т132-40-8 Т15-200-8 Т171-250-14 Т500-5
2У202И КУ503А Т132-50-10 Т15-250-10 Т171-250-15 Т500-6
2У202К КУ503Б Т132-50-11 Т15-250-12 Т171-250-16 Т500-8
2У202Л КУ503В Т132-50-12 Т15-250-4 Т171-250-18 Т500-9
2У202М КУ602А Т132-50-2 Т15-250-8 Т171-250-5 Т630-24
2У202Н КУ602Б Т132-50-5 Т15-250-9 Т171-250-6 Т9-250-10
2У203А КУ701А Т132-50-6 Т15-32-10 Т171-250-7 Т9-250-11
2У203Б КУ709А Т132-50-7 Т15-32-11 Т171-250-8 Т9-250-12
2У203В КУ709Б Т132-50-8 Т15-32-12 Т171-250-9 Т9-250-14
2У203Г КУ709В Т132-50-9 Т15-32-14 Т171-320-10 Т9-250-16
2У203Д КУ710А Т132-63-10 Т15-32-16 Т171-320-11 Т9-250-7
2У203Е КУ712А Т132-63-11 Т15-40-10 Т171-320-12 Т9-250-8
2У203Ж КУ712А1 Т132-63-12 Т15-40-11 Т171-320-13  
2У203И КУ712А2 Т132-63-2 Т15-40-12 Т171-320-14  
2У203Н КУ712Б Т132-63-6 Т15-40-13 Т171-320-15  
2У208А КУ712Б1 Т133-320-10 Т15-40-14 Т171-320-16  
2У208Б КУ712В Т133-320-11 Т151-100-10 Т171-320-18  
2У208В КУ712В1 Т133-320-12 Т151-100-12 Т171-320-6  
2У208Г КУ712В2 Т133-320-13 Т151-100-15 Т171-320-7  
2У208Д КУ713А Т133-320-14 Т151-100-6 Т171-320-8  
КУ101А КУ713Б Т133-320-16 Т151-100-9 Т171-320-9  
КУ101Б КУ713В Т133-320-18 Т152-80-13 Т173-1250-28  
КУ101Г КУ714В Т133-320-20 Т152-80-15 Т173-2000-16  
КУ101Е Т10-25-10 Т133-320-22 Т152-80-2 Т173-2000-20  
КУ102А Т10-25-12 Т133-320-7 Т153-2000-10 Т2-160-10  
КУ102В Т10-25-4 Т133-320-9 Т153-2000-4 Т2-160-12  
КУ102Г Т10-25-6 Т133-400-10 Т153-2000-5 Т2-160-5  
КУ103А Т10-25-8 Т133-400-11 Т153-2000-6 Т2-160-6  
КУ103В Т10-50-3 Т133-400-12 Т153-2000-7 Т2-320-10  
КУ103В1 Т10-50-4 Т133-400-14 Т153-2000-8 Т2-320-12  
КУ104Г Т106-10-2 Т133-400-15 Т153-630-12 Т2-320-13  
КУ106А Т106-10-4 Т133-400-16 Т153-630-18 Т2-320-14  
КУ108А Т106-10-5 Т133-400-4 Т153-630-20 Т2-320-8  
КУ108В Т106-10-6 Т133-500-12 Т153-630-22 Т2-320-9  
КУ108Ж Т106-10-8 Т142-50-7 Т153-630-24 Т232-50-12  
КУ108И Т112-10-10 Т142-63-10 Т153-800-10 Т242-80-12  
КУ108Ц Т112-10-11 Т142-63-9 Т153-800-11 Т242-80-13  
КУ110А Т112-10-12 Т142-80-10 Т153-800-12 Т242-80-8  
КУ110В Т112-10-4 Т142-80-11 Т153-800-14 Т242-80-9  
КУ111А Т112-10-7 Т142-80-12 Т153-800-15 Т243-500-18  
КУ112А Т112-10-8 Т142-80-2 Т153-800-16 Т243-500-20  
КУ118Г Т112-10-9 Т142-80-4 Т153-800-18 Т243-500-22  
КУ120А Т112-16-10 Т142-80-5 Т153-800-20 Т243-500-24  
КУ121А Т112-16-12 Т142-80-6 Т153-800-9 Т243-500-26  
КУ201А Т112-16-14 Т142-80-7 Т16-320-10 Т25-10  
КУ201Б Т112-16-4 Т142-80-8 Т16-320-12 Т25-11  
КУ201В Т112-16-6 Т142-80-9 Т160-10 Т25-12  
КУ201Г Т112-16-8 Т143-1250-5 Т160-11 Т25-3  
КУ201Д Т122-20-10 Т143-400-10 Т160-12 Т25-4  
КУ201Е Т122-20-12 Т143-400-12 Т160-13 Т25-6  
КУ201Ж Т122-20-4 Т143-400-13 Т160-14 Т25-7  
КУ201И Т122-20-6 Т143-400-18 Т160-3 Т253-1000-10  
КУ201К Т122-20-7 Т143-400-22 Т160-4 Т253-1000-11  
КУ201Л Т122-20-8 Т143-400-24 Т160-6 Т253-1000-12  
КУ202А Т122-20-9 Т143-400-8 Т160-7 Т253-1000-13  
КУ202Б Т122-25-10 Т143-500-10 Т160-8 Т253-1000-14  
КУ202В Т122-25-11 Т143-500-11 Т160-9 Т253-1000-15  
КУ202Г Т122-25-12 Т143-500-12 Т161-125-10 Т253-1000-16  
КУ202Г1 Т122-25-2 Т143-500-13 Т161-125-11 Т253-1000-18  
КУ202Д Т122-25-20 Т143-500-14 Т161-125-12 Т253-1000-8  
КУ202Д1 Т122-25-3 Т143-500-15 Т161-125-13 Т253-1250-10  
КУ202Е Т122-25-4 Т143-500-16 Т161-125-14 Т253-1250-11  
КУ202Е1 Т122-25-5 Т143-500-18 Т161-125-15 Т253-1250-12  
КУ202Ж Т122-25-6 Т143-500-20 Т161-125-16 Т253-1250-13  
КУ202Ж1 Т122-25-7 Т143-500-6 Т161-125-4 Т253-1250-14  
КУ202И Т122-25-8 Т143-500-7 Т161-125-6 Т253-1250-15  
КУ202И1 Т122-32-10 Т143-500-8 Т161-125-7 Т253-1250-18  
КУ202К Т122-32-11 Т143-500-9 Т161-125-8 Т253-1250-4  
КУ202К1 Т122-32-4 Т143-630-10 Т161-160-10 Т253-800-10  
КУ202Л Т122-32-6 Т143-630-11 Т161-160-11 Т253-800-16  
КУ202Л1 Т122-32-7 Т143-630-12 Т161-160-12 Т253-800-18  
КУ202М Т123-200-10 Т143-630-13 Т161-160-13 Т253-800-20  
КУ202М1 Т123-200-12 Т143-630-14 Т161-160-14 Т253-800-22  
КУ202Н Т123-200-13 Т143-630-15 Т161-160-15 Т253-800-24  
КУ202Н1 Т123-200-16 Т143-630-16 Т161-160-16 Т271-250-11  
КУ202Р1 Т123-200-9 Т143-630-18 Т161-160-18 Т271-250-5  
КУ203А Т123-250-10 Т143-630-20 Т161-160-5 Т273-1250-40  
КУ203Б Т123-250-11 Т143-630-24 Т161-160-6 Т3-320-22  
КУ203В Т123-250-12 Т143-630-4 Т161-160-7 Т3-320-24  
КУ203Г Т123-250-13 Т143-630-6 Т161-160-8 Т353-800-10  
КУ203Д Т123-250-14 Т143-630-8 Т161-160-9 Т353-800-18  

 

Тиристоры штыревой конструкции Т131-40, Т131-50, Т132-40, Т132-50, Т132-63

Параметр Наименование, Т ип тиристора Условия установления  
единица измерения Т131-40
T13240
Т132“т123 норм на параметры  
   
UDRM, Повторяющееся импульсное напряже­ние в закрытом состоянии и повто-     T. = 125 oC , t. = 10 мс,
jm i
f = 50 Гц
 
  ряющееся импульсное обратное напря­жение, В, для класса:
1
  100    
  2   200    
  4   400    
  5   500    
  6   600    
  8   800    
  9   900    
  10   1000    
  11   1100    
  12   1200    
UDSM, Неповторяющееся импульсное напря-     T = 125 oC, t =10 мс,
jm l
 
U жение в закрытом состоянии и     импульс одиночный  
  неповторяющееся импульсное обрат­ное напряжение, В, для класса:
1
  110    
  2   220    
  4   450    
  5   560    
  6   670    
  8   890    
  9   1000    
  10   1100    
  11   1200    
  12   1300    
  Постоянное напряжение в закрытом     T = 85 oC
c
 
UD,UR состоянии и постоянное обратное 0,6 Udrm(Urrm)  
  напряжение, В        
U Рабочее импульсное напряжение в        
DWM,
URWM
закрытом состоянии и рабочее им­пульсное обратное напряжение, В 0,8 Udrm(Urrm) T = 85 oC
c
 
(dUD/dt)crit Критическая скорость нарастания напряжения в закрытом состоянии,     T. = 125 oC,t = 200 мс ,
jm 7 u 7
U = 0,67U„„>,
 
  В/мкс, не менее,для группы:        
  2   50    
  4   200    
  6   500    
  7   1000    
  Повторяющийся импульсный обрат­ный ток и повторяющийся импульс- 2 T= 25 oC U = U U = U
I. 25 C, UDUDRM ’ UR URRM
 
  ный ток в закрытом состоянии, мА, 6 T = 125 oC U = U U = U
Tjm 125 C UD UDRM,UR URRM
 
  не более  

Окислительный стресс дестабилизирует протеин-аргининметилтрансферазу 4 с помощью киназы гликогенсинтазы 3β, препятствуя миграции эпителиальных клеток легких

Am J Physiol Cell Physiol. 2017 сен 1; 313 (3): C285 – C294.

Центр передового опыта по лечению острых травм легких, Медицинский факультет, Медицинская школа Университета Питтсбурга, Питтсбург, Пенсильвания

Автор, ответственный за перепечатку. и реанимации, Univ.из Питтсбурга, UPMC Montefiore, NW 628, Pittsburgh, PA 15213 (электронная почта: [email protected]).

Поступила в редакцию 29 марта 2017 г .; Пересмотрено 15 июня 2017 г .; Принято 15 июня 2017 г.

Авторские права © Американское физиологическое общество, 2017 г.Эта статья цитируется в других статьях в PMC.

Abstract

Окислительный стресс влияет на нормальную функцию клеток, что приводит к патогенезу различных заболеваний, включая легочные. Белок аргининметилтрансфераза 4 (PRMT4) имеет решающее значение для нормального развития альвеолярных эпителиальных клеток легких; однако регуляция PRMT4 при таких легочных заболеваниях еще не выяснена.Используя биохимические подходы, мы обнаружили, что обработка перекисью (H 2 O 2 ) снижает стабильность белка PRMT4 в эпителиальных клетках легких (MLE12) мышей, препятствуя миграции клеток. Протеинкиназа киназа гликогенсинтазы 3β (GSK-3β) взаимодействует с PRMT4 и катализирует фосфорилирование PRMT4 T132, которое защищает PRMT4 от протеасомной деградации убиквитина. H 2 O 2 подавляет GSK-3β, чтобы уменьшить PRMT4 на уровне белка. PRMT4 способствует миграции клеток, а H 2 O 2 разрушает PRMT4, подавляя миграцию эпителиальных клеток легких.Эти наблюдения демонстрируют, что окислительный стресс дестабилизирует PRMT4 посредством передачи сигналов GSK-3β, препятствуя миграции эпителиальных клеток легких, что может препятствовать процессу восстановления и регенерации легких.

Ключевые слова: протеин-аргининметилтрансфераза 4, PRMT4, киназа гликогенсинтазы 3β, GSK-3β, фосфорилирование, убиквитин и деградация протеасом, окислительный стресс, миграция

окислительный стресс возникает, когда организм не может должным образом регулировать продукцию свободных радикалов или вредных промежуточных продуктов через антиоксидантную защиту. Воздействие чрезмерного количества эндогенных и экзогенных активных форм кислорода (АФК) изменяет важные пути передачи сигналов, которые исключительно участвуют в патогенезе множества заболеваний, включая болезни легких (8, 32, 40). Эпигенетика управляет транскрипционной активностью генов во всех жизненных процессах, но окислительный стресс может нарушить эпигенетические ферменты, которые изменяют архитектуру хроматина, посттрансляционную модификацию гистонов или метилирование ДНК (9, 22, 38). Например, курение сигарет способствует обмену белков гистондеацетилазы 2 (HDAC2) за счет фосфорилирования и последующего убиквитинирования (18, 24, 37).Другая гистоновая деацетилаза, сиртуин 1 (SIRT1), также снижается у пациентов с хронической обструктивной болезнью легких (ХОБЛ) (17). Инактивация HDAC2 усугубляет воспаление эпителия легких за счет активации транскрипции провоспалительных генов у пациентов с ХОБЛ (30). Новые данные указывают на повышенное ацетилирование гистонов у пациентов, страдающих астмой (5). Исследования показали, что несколько видов miRNA ответственны за патогенез идиопатического легочного фиброза (29). Кроме того, эпигенетические ферменты принимают участие в патогенезе острого повреждения легких (ОПЛ).Бактериальная инфекция изменяет эпигенетические ферменты, чтобы перепрограммировать защиту хозяина, влиять на выживаемость клеток и влиять на пролиферацию (13, 46, 47).

Белок аргинин N -метилтрансфераза 4 / ассоциированная с коактиватором аргининметилтрансфераза 1 (PRMT4 / CARM1), фермент метилтрансферазы типа I в семействе протеин-аргининметилтрансфераз, участвует в важнейших жизненных процессах, включая транскрипцию генов, пролиферацию, клеточный цикл, ДНК. сращивание и проявка (4, 7, 10, 12, 16, 27). PRMT4 катализирует присоединение моно- или асимметричных остатков аргинина к гуанидиновым атомам азота аргинильных остатков в гистоновых и негистоновых белковых субстратах.Согласованное с действием гистонацетилтрансферазы p300 и p160, PRMT4-зависимое асимметричное диметилирование гистона h4 по Arg-17 (h4R17me2a) активирует транскрипцию гена (4). PRMT4 катализирует метилирование ряда негистоновых белков, включая p300, для реализации своих разнообразных биологических функций при NF-κB-опосредованном воспалении, связанной с p53 сигнальной трансдукцией, созреванием мРНК, пролиферацией и клеточным циклом (7, 10, 12, 16, 27) . PRMT4 также участвует в миграции клеток. PRMT4 катализирует метилирование BAF155, регулируя миграцию клеток рака молочной железы и функционирует в правильной медленной локализации тяжелой цепи миозина в развитии мышц (3, 41).Еще предстоит изучить, влияет ли PRMT4 на миграцию эпителиальных клеток легких, которая участвует в репарации эпителиальных клеток легких и регенерации после повреждения.

PRMT4 был определен как критический для нормального развития легких на моделях грызунов. Мыши с нокаутом PRMT4 могут вызывать неонатальную смерть и дефекты развития дыхательной системы, такие как увеличение незрелых альвеолярных клеток типа II и отсутствие клеток типа I, а также уменьшение альвеолярного воздушного пространства (27). Более того, асимметричный диметиларгинин увеличивается при астме (35).Тем не менее, метаболит деградации для метилирования, катализируемого PRMT4, асимметричный диметиларгинин, действует как эндогенный ингибитор синтазы оксида нитрида, которая в настоящее время является маркером риска при различных опасных для жизни заболеваниях (44). К ним относятся терминальные почечные заболевания, печеночная недостаточность, сердечная недостаточность, диабет, преэклампсия, атеросклеротические осложнения, астма и хронические заболевания легких (34, 36, 44). Тем не менее, механизм (ы) того, как PRMT4 регулируется при легочных заболеваниях, связанных с окислительным стрессом, в значительной степени неизвестен.

В этом исследовании мы сообщаем, что окислительный стресс снижает стабильность белка PRMT4 через протеинкиназу GSK-3β. В нормальных условиях GSK-3β фосфорилирует PRMT4 в точке T132, и это фосфорилирование стабилизирует PRMT4, устраняя его убиквитинирование и более позднюю деградацию белка. Окислительный стресс снижает уровень белка GSK-3β, что приводит к убиквитинированию PRMT4 и деградации протеасом. Сниженная стабильность белка PRMT4 препятствует миграции клеток, которая необходима для восстановления и регенерации поврежденных эпителиальных клеток легких.

МАТЕРИАЛЫ И МЕТОДЫ

Клеточные линии и реагенты.

Клетки линии эпителиальных клеток легких мышей MLE12 культивировали в среде HITES (500 мл DMEM / F12, 2,5 мг инсулина, трансферрин, селенит натрия, 2,5 мг трансферрина, 10 мкМ гидрокортизона, 10 мкМ β-эстрадиола, 10 мМ HEPES. и 2 мМ l-глутамина) с добавлением 10% FBS, как описано ранее (49). Плазмида экспрессии PRMT4 была приобретена у GeneCopoeia (Rockville, MD). PRMT4 (каталожный номер 12495s), GSK-3β (каталожный номер.9832s) и фосфо-треонин (номер в каталоге 9381s) были получены от Cell Signaling (Данверс, Массачусетс). Фосфосериновое (каталожный номер ab9332) антитело было от Abcam. H 2 O 2 и антитела к β-актину были получены от Sigma-Aldrich (Сент-Луис, Миссури). Концентрация H 2 O 2 , используемая в экспериментах, находится в диапазоне 50–300 мкМ, что соответствует перспективам окислительного стресса in vivo в патофизиологических условиях (15, 26). Антитело к убиквитину (каталожный номер sc-166553) и антитело к γ-тубулину были от Santa Cruz Biotechnology (Санта-Крус, Калифорния).Направленная плазмида TOPO pcDAN3.1 / V5 и антитело V5 (каталожный номер P / N46-1157) были приобретены у Invitrogen (Waltham, MA). Лентивирусные конструкции коротких шпилечных РНК PRMT4 и GSK-3β были получены от Origene (Rockville, MD). Ингибитор синтеза белка циклогексимид (CHX; 10 мкМ) и обратимый ингибитор протеасом MG132 (20 мкМ) были от Calbiochem (Billerica, MA). Все материалы, использованные в экспериментах, коммерчески доступны в самом высоком качестве.

Коиммунопреципитация и иммуноблоттинг.

Коиммунопреципитация (co-IP) и иммуноблоттинг выполняли, как описано ранее (47). Вкратце, белок PRMT4 и его партнер (ы) по взаимодействию были иммунопреципитированы из лизатов клеток MLE12. Клетки промывали холодным буфером PBS и лизировали буфером co-IP [150 мМ NaCl, 50 мМ Трис · HCl, 1 мМ EDTA, 2 мМ дитиотреитол (DTT), 0,5% Triton X-100 (об. / Об.) И 1 : 1000 коктейлей ингибиторов протеазы (об. / Об.)]. Лизаты клеток, содержащие 1 мг общего белка, инкубировали с 2 мкг антитела PRMT4 в течение 2 часов.Иммунопреципитаты белков, распознаваемых PRMT4, инкубировали с гранулами белка A / G в течение дополнительного часа. Осадки трижды промывали буфером co-IP и применяли для иммуноблоттинга. Для иммуноблоттинга клеточные лизаты получали путем кратковременной обработки ультразвуком в буфере A [150 мМ NaCl, 50 мМ Трис, 1,0 мМ ЭДТА, 0,5% Тритон X-100 (об. / Об.), 2 мМ DTT, смесь ингибиторов протеазы 1: 1000. , 0,025% азида натрия и 1 мМ фенилметилсульфонилфторид, pH 7,4] при 4 ° C. Лизаты клеток разделяли с помощью SDS-PAGE.Изображения иммуноблоттинга были получены с помощью системы Kodak image 2000.

Молекулярное клонирование и сайт-направленный мутагенез.

Полноразмерную кДНК кодирующей области PRMT4 (GeneCopoeia, Rockville, MD) амплифицировали с помощью ПЦР с использованием следующих прямых и обратных праймеров: прямой: 5′-CACCATGGCAGCGGCGGCAGCG-3 ‘; и обратный: 5’-ACTCCCATAGTGCATGGTGTTG-3 ‘. ДНК клонировали в плазмиду направленной экспрессии TOPO pcDNA3.1 / His-V5, и точность клонированного гена проверяли секвенированием.Сайт-направленный мутагенез PRMT4 получали, как описано ранее (47). Праймеры, используемые в сайт-направленном мутагенезе, следующие: T132A: прямой: 5′-CCTGTCGGGGCCACGCACTGGAGCGCTCTGTG-3 ‘и обратный: 5′-CACAGAGCGCTCCAGTGCGTGGCCCCGACAGG-3′; T132C: прямой: 5’-CCTGTCGGGCCACTGCCTGGAGCGCTCTGTG-3 ‘и обратный: 5′-CACAGAGCGCTCCAGGCAGTGGCCCCGACAGG-3′; T132D: прямой: 5’-CCTGTCGGGGCCACGACCTGGAGCGCTCTGTG-3 ‘и обратный: 5′-CACAGAGCGCTCCAGGTCGTGGCCCCGACAGG-3′; и S136A: вперед: 5’- CCACACACTGGAGCGCGCTGTGTTCAGTGAGCGG и в обратном направлении: CCGCTCACTGAACACAGCGCGCTCCAGTGTGTGG.Мутации проверяли на точность секвенирования.

Анализ киназы in vitro.

Клетки MLE промывали холодным буфером PBS, обрабатывали ультразвуком в IP-буфере и затем центрифугировали (12000 г , 10 мин). Супернатант инкубировали с 2 мкг антитела GSK-3β в течение ночи. Затем смеси инкубировали с шариками протеина A / G в течение 2 часов. Гранулы дважды промывали киназным буфером [1 × PBS, 10 мМ DTT, 10 мМ MgCl 2, 10% глицерин (об. / Об.) И ингибитор фосфатазы 1: 1000 (об. / Об.)].PRMT4, T132A и S136A дикого типа (WT) мутантного PRMT4 были синтезированы с помощью системы быстрой транскрипции / трансляции TnT по отдельности. Затем иммунопреципитаты инкубировали с рекомбинантными белками в киназном буфере (содержит 10 мМ АТФ) в течение 1 ч при 25 ° C. Эти образцы были использованы для иммуноблоттинга.

Трансфекция плазмид.

Плазмиды вводили в клетки MLE12 с помощью электропорации. Вкратце, 1000000 клеток на стадии экспоненты роста суспендировали с 3 мкг плазмидной ДНК в 100 мкл буфера для трансфекции (20 мМ HEPES в PBS, pH 7.4). Электропорацию выполняли с помощью аппарата для ядерной трансфекции (Amaxa Biosystems, Gaithersburg, MD) с предварительно установленной программой T-013 в кювете для электропорации. Затем клетки переносили в шестилуночные планшеты для культивирования с 2 мл среды HITES в течение 48 часов. Конструкции РНК короткой шпильки вводили в клетки тем же подходом и инкубировали в течение 72 ч.

Количественная полимеразная цепная реакция с обратной транскрипцией.

Количественную (q) ОТ-ПЦР проводили, как описано ранее (13).Вкратце, тотальную клеточную РНК выделяли из клеток MLE12 с использованием реагента TRI (Invitrogen, Carlsbad, CA) в соответствии с протоколом производителя. МРНК расщепляли ДНКазой I в течение 30 мин, чтобы исключить загрязнение геномной ДНК. кДНК синтезировали из выделенной тотальной РНК с помощью SYBR Select Master Mix (Thermo Fisher Scientific, Сан-Хосе, Калифорния). Prmt4 -специфические праймеры были сконструированы на основе NCBI мышиных мРНК и базы данных последовательностей геномной ДНК следующим образом: прямой: 5′-CAACAGCGTCCTCATCCAG-3 ‘и обратный: 5′-CTCTGTCCGCTCACTGAAC-3’.Реакции qPCR проводили с использованием термоциклера Bio-Rad C1000 по двухступенчатой ​​программе (95 ° C в течение 10 с и 55 ° C в течение 15 с для 40 циклов). Уровень мРНК Gapdh использовали в качестве контроля для стандартизации экспрессии мРНК Prmt4 .

Анализы заживления ран.
Клетки

MLE12 трансфицировали плазмидой, кодирующей белок PRMT4, конструкциями кшРНК PRMT или пустым векторным контролем, соответственно. Клетки выращивали до 90% конфлюэнтности в 6-луночных планшетах для культивирования в течение 24 часов и царапали кончиком пипетки, чтобы образовалась рана.Еще через 24 часа культивирования заживление ран визуализировали под световой микроскопией, а изображения получали с помощью микроскопа EVOS FL Auto (Life Technologies, Waltham, MA). Площадь заживления раны была рассчитана с помощью программного обеспечения ImageJ. Скорость заживления нормализовалась по восстановленной области в группе с избыточной экспрессией PRMT4 в течение 24 часов.

Анализ Transwell. Миграцию клеток MLE12

анализировали с использованием набора для миграции Transwell от Trevigen (Gaithersburg, MD), как описано ранее (6). Вкратце, 50 мкл клеток MLE12 (содержащих 5 × 10 4 клеток), которые были сверхэкспрессированы или сбиты с помощью PRMT4, добавляли в верхнюю камеру, а 150 мкл среды HITES без FBS добавляли в нижнюю камеру. В среду каждой лунки добавляли низкие и высокие концентрации H 2 O 2 (50 и 100 мкМ соответственно). После 18 часов культивирования клетки, которые мигрировали в нижнюю камеру, диссоциировали с помощью диссоциации клеток / кальцеин-ацетоксиметилового (кальцеин-AM) эфира и переносили в аналитический планшет.Относительную флуоресценцию определяли с использованием флуоресцентного 96-луночного ридера для микропланшетов с длинами волн возбуждения 485 нм и эмиссии 520 нм. Процент миграции клеток рассчитывали с использованием перенесенных клеток по сравнению с общим количеством клеток, инокулированных в верхнюю камеру.

Статистический анализ.

Все результаты были проанализированы с помощью однофакторного дисперсионного анализа для нескольких групп или для экспериментальных групп использовался тест Стьюдента t . P <0,05 считалось статистически значимым, а P ≤ 0.01 считался очень значимым. Данные представлены в виде средних значений ± стандартное отклонение от трех независимых экспериментов.

РЕЗУЛЬТАТЫ

Окислительный стресс снижает стабильность белка PRMT4 в клетках MLE12.

Сообщается, что окислительный стресс по-разному нарушает регуляцию членов семейства PRMT в клетках фибробластов WI-38 (23). Мы исследовали стабильность белка PRMT4 при окислительном стрессе в эпителиальных клетках легких. Анализ иммуноблоттинга PRMT4 показывает, что H 2 O 2 снижает белок PRMT4 в зависимости от времени ().H 2 O 2 обработка (200 мкМ) заметно уменьшила белок PRMT4 в клетках MLE12 через 4 часа. Примечательно, что H 2 O 2 подавляет протеинкиназу GSK-3β также на уровне белка. Чтобы подтвердить это наблюдение, мы провели исследование курса концентрации H 2 O 2 . Результаты иммуноблоттинга PRMT4 и GSK-3β показывают, что 200 мкМ H 2 O 2 эффективно снижают уровни белка PRMT4 и GSK-3β в клетках MLE12 (). Эти результаты демонстрируют, что H 2 O 2 снижает PRMT4, а также белки GSK-3β в клетках MLE12.

Окислительный стресс подавляет стабильность белка аргининметилтрансферазы 4 (PRMT4). A : исследование динамики H 2 O 2 в эпителиальных клетках легкого мыши (MLE12). Клетки MLE12 обрабатывали 200 мкМ H 2 O 2 в течение разного времени. Лизаты клеток анализировали с помощью иммуноблоттинга PRMT4 и киназы гликогенсинтазы 3β (GSK-3β), и β-актин использовали в качестве контроля загрузки. B : нанесены на график результаты денситометрии A . C : исследование курса концентрации H 2 O 2 в клетках MLE12. Клетки MLE12 обрабатывали H 2 O 2 различной концентрации в течение 4 часов. Был проведен иммуноблоттинг PRMT4, GSK-3β и β-актина. D : нанесены результаты денситометрии C . E : Клетки MLE12 обрабатывали 200 мкМ H 2 O 2 в течение 4 часов, и общую РНК выделяли и анализировали с помощью количественной ОТ-ПЦР. Результаты представляют 3 независимых эксперимента.* P <0,05 или ** P ≤ 0,01 по сравнению с соответствующим контролем.

Как измененная транскрипция гена, так и стабильность белка связаны с доступностью белка в живых клетках. Чтобы проверить, является ли снижение уровня белка PRMT4 следствием транскрипции гена, мы измерили уровень мРНК Prmt4 в вышеупомянутых обработанных клетках. Результаты qRT-PCR показывают, что уровни мРНК Prmt4 были сопоставимы в H 2 O 2 необработанных и обработанных клетках MLE12 (). Это наблюдение предполагает, что H 2 O 2 -опосредованное восстановление белка PRMT4 может быть результатом изменения стабильности белка.

H
2 O 2 запускает протеасомную деградацию PRMT4.

Скорость оборота, с одной стороны, определяет стабильность белка. Протеасома – это главный механизм, который перерабатывает большинство клеточных белков. Мы заинтересованы в том, чтобы проверить, участвует ли протеасома в нестабильности PRMT4. Результаты иммуноблоттинга показывают, что обработка ингибитором синтеза белка CHX, по сравнению с обработкой только H 2 O 2 (), усиливала H 2 O 2 -индуцированную нестабильность PRMT4 ().CHX усиливает H 2 O 2 -опосредованное восстановление GSK-3β также на уровне белка (). В присутствии 200 мкМ H 2 O 2 период полураспада PRMT4 составляет ~ 1,5 ч (). Затем мы попытались спасти H 2 O 2 -индуцированную нестабильность PRMT4 с помощью обратимого ингибитора протеасомы MG132. Как и ожидалось, MG132 успешно восстановил H 2 O 2 -сниженный PRMT4 на уровне белка (). Интересно, что MG132 также ингибировал H 2 O 2 -опосредованную нестабильность белка GSK-3β, что позволяет предположить, что GSK-3β может быть важным фактором, имеющим отношение к нестабильности белка PRMT4.В целом, эти наблюдения показывают, что окислительный стресс снижает стабильность белка PRMT4 через протеасомную деградацию. Кроме того, протеинкиназа GSK-3β может иметь важное значение для модуляции стабильности белка PRMT4 при окислительном стрессе.

H 2 O 2 -индуцированная нестабильность PRMT4 происходит через протеасомную деградацию. A – F : исследования времени и концентрации разложения PRMT4 под действием H 2 O 2 . Клетки MLE12 обрабатывали H 2 O 2 с диапазоном концентраций в отсутствие ( A и B ) или в присутствии циклогексимида (CHX) в течение 4 часов ( C и D ). или клетки обрабатывали CHX в течение различных периодов времени в присутствии 200 мкМ H 2 O 2 ( E и F ).Лизаты клеток подвергали иммуноблоттингу на PRMT4, GSK-3β и γ-тубулин. Были нанесены результаты денситометрии A , C и E , и рассчитан период полужизни белков ( B , D и F ). G : клетки MLE12 обрабатывали различными концентрациями H 2 O 2 (0, 100, 200 и 300 мкМ) в присутствии MG132 (20 мкМ) в течение 4 часов. Лизаты клеток подвергали иммуноблоттингу на PRMT4, GSK-3β и γ-тубулин. H : нанесены на график результаты денситометрии G . Результаты представляют 3 независимых эксперимента * P <0,05 или ** P ≤ 0,01 по сравнению с соответствующим контролем.

GSK-3β взаимодействует с PRMT4 и катализирует фосфорилирование PRMT4 в точке T132.

Сообщается, что протеинкиназа GSK-3β играет важную роль в передаче сигнала при окислительном стрессе (31, 42). Мы проанализировали первичную последовательность PRMT4 и обнаружили, что PRMT4 содержит потенциальный сайт (ы) фосфорилирования GSK-3β, 132-TXXXS.Сначала мы проверили, взаимодействует ли PRMT4 с GSK-3β. Исследования Co-IP показывают, что GSK-3β был обнаружен в иммунопреципитатах PRMT4 (, вверху ), что указывает на то, что GSK-3β ассоциируется с PRMT4.

GSK-3β взаимодействует с PRMT4 и катализирует фосфорилирование PRMT4 в точке T132. A : лизаты клеток наносили с помощью исследования иммунопреципитации (IP) PRMT4. Осадки PRMT4 впоследствии анализировали с помощью антител к GSK-3β и PRMT4. B и C : GSK-3β фосфорилирование PRMT4 in vitro в точке T132.Мутантные рекомбинанты PRMT4 дикого типа (WT), T132A и S136A были синтезированы с системой экспрессии TnT, а анализ фосфорилирования in vitro был проведен с ферментативно активным GSK-3β. Образцы анализировали с использованием фосфо-треонинового антитела ( B ) или фосфо-серинового антитела ( C ). Сигнал GSK-3β в дорожках IgG в B и C может происходить из белковой синтетической системы TnT in vitro. D : PRMT4 экспрессировался в клетках с молчанием GSK-3β. Иммунопреципитаты V5 анализировали с помощью фосфор-треонина и иммуноблоттинга V5.Входящие данные анализировали с помощью иммуноблоттинга GSK-3β и β-актина. E : мутантный PRMT4 WT и T132A экспрессировался в клетках MLE12 соответственно. Иммунопреципитаты V5 анализировали с помощью фосфо-треонина. Входящие данные анализировали с помощью иммуноблоттинга V5. F : мутантный T132A PRMT4 коэкспрессировался с GSK-3β в клетках MLE12 в течение 48 часов. Иммунопреципитаты V5 анализировали с помощью фосфо-треонина и иммуноблоттинга V5 соответственно. Входящие данные анализировали с помощью иммуноблоттинга GSK-3β и β-актина.Результаты представляют 3 независимых эксперимента.

GSK-3β представляет собой протеинкиназу, катализирующую фосфорилирование серина / треонина в различных белках. Чтобы выяснить, катализирует ли GSK-3β фосфорилирование PRMT4 в 132-TXXXS, мы заменили T132 или S136 на аланин, и синтезированные рекомбинанты WT и мутантного PRMT4 были использованы для анализа GSK-3β-зависимого фосфорилирования. Результаты иммуноблоттинга фосфо-треонина показывают, что GSK-3β катализирует WT, но не фосфорилирование PRMT4 мутанта T132A по остатку (ам) треонина ().Результаты иммуноблоттинга по фосфосерину показывают, что GSK-3β катализирует фосфорилирование PRMT4 как дикого типа, так и мутанта S136A (). Эти результаты предполагают, что T132, но не S136, является сайтом катализируемого GSK-3β фосфорилирования в мотиве 132-TXXXS. Результаты Co-IP показывают, что фосфорилирование PRMT4 легко обнаруживается с помощью иммуноблоттинга фосфо-треонина в клетках MLE12 (, вверху слева, ). Нокдаун GSK-3β (, внизу, ) заметно снижает фосфорилирование PRMT4 (, , вверху справа, ). Дальнейшие результаты иммунопреципитации показывают, что уровень фосфорилирования мутанта T132A снижен, чем уровень фосфорилирования PRMT4 дикого типа ( вверху ).Эктопическая экспрессия GSK-3β в клетках MLE12 (, внизу, ) не изменяла уровень фосфорилирования мутанта T132A PRMT4 (, вверху, ). В целом, эти результаты показывают, что GSK-3β катализирует фосфорилирование PRMT4 в точке T132.

Статус фосфорилирования T132 определяет убиквитинирование PRMT4.

Поскольку GSK-3β катализирует фосфорилирование PRMT4 в точке T132, мы попытались определить, имеет ли статус фосфорилирования T132 значение для полиубиквитинирования PRMT4, сигнала для деградации протеасомы PRMT4.Иммуноблоттинг-анализ иммунопреципитатов V5 показывает, что сверхэкспрессия GSK-3β снижает уровень убиквитинирования PRMT4 WT, но не T132A (), предполагая, что фосфорилирование T132, катализируемое GSK-3β, защищает PRMT4 от убиквитинирования и протеасомной деградации. Затем мы сконструировали мутанты PRMT4 путем замены T132 цистеином (имитатор дефосфорилирования) или аспарагиновой кислотой (имитатор фосфорилирования). Результаты иммуноблоттинга убиквитина иммунопреципитатов показывают, что мутант T132C был более убиквитинирован по сравнению с мутантом PRMT4 WT и T132D ().Эти результаты показывают, что фосфорилирование T132, катализируемое GSK-3β, защищает PRMT от убиквитинирования. Дефосфорилирование T132 способствует убиквитинированию PRMT4, таким образом, запускает протеасомную деградацию PRMT4.

Статус фосфорилирования T132 определяет убиквитинирование PRMT4. A и B : мутантный PRMT4 WT и T132A коэкспрессировался с GSK-3β в течение 48 часов. Иммунопреципитаты V5 анализировали с помощью иммуноблоттинга убиквитина. C и D : WT, T132C и мутантный T132D PRMT4 вводили в клетки MLE12 на 48 часов соответственно.Иммунопреципитаты V5 анализировали с помощью убиквитина и иммуноблоттинга V5. Результаты представляют 3 независимых эксперимента. * P <0,05 или ** P ≤ 0,01 по сравнению с соответствующим контролем.

GSK-3β регулирует стабильность белка PRMT4.

Для дальнейшего изучения роли GSK-3β в стабильности белка PRMT4 мы наблюдали стабильность белка PRMT4 в присутствии или в отсутствие GSK3β. Результаты иммуноблоттинга показывают, что PRMT4 был ответственным белком с периодом полужизни ~ 3.5 ч (). Сверхэкспрессия GSK-3β стабилизировала PRMT4 в результате деградации в клетках MLE12 (). Напротив, нокдаун GSK-3β с помощью shRNA ускоряет деградацию PRMT4 (). Эти результаты показывают, что фосфорилирование, опосредованное GSK-3β, стабилизирует PRMT4 от деградации.

GSK-3β регулирует стабильность белка PRMT4. Пустые векторы ( A ), конструкции экспрессии GSK-3β ( C ), scramble ( E ) и shRNA ( G ) вводили в клетки MLE12 соответственно. Затем клетки обрабатывали ингибитором синтеза белка CHX (20 мкМ) в течение различных временных интервалов, как указано. Был проведен иммуноблоттинг PRMT4, GSK-3β и β-актина. B , D , F и H : были нанесены результаты денситометрии A , C , E и G соответственно. Результаты представляют 3 независимых эксперимента. ** P ≤ 0,01 по сравнению с соответствующим контролем.

Поскольку окислительный стресс подавляет уровни белков PRMT4 и GSK-3β, а фосфорилирование, катализируемое GSK-3β, определяет стабильность белка PRMT4, разумно предположить, что H 2 O 2 -опосредованная деградация белка PRMT4 происходит через GSK -3β.Результаты иммуноблоттинга показывают, что H 2 O 2 индуцировал деградацию PRMT4 в группах пустых векторов (). Сверхэкспрессия GSK-3β успешно спасла H 2 O 2 -опосредованное снижение PRMT4 (). Эти результаты показывают, что GSK-3β играет решающую роль в опосредованной окислительным стрессом деградации PRMT4.

GSK-3β спасает PRMT4 со сниженным окислительным стрессом на уровне белка. Пустой вектор ( A ) или конструкции GSK-3β ( C ) вводили в клетки MLE12 на 48 часов.H 2 O 2 добавляли в ячейки в различных количествах, как указано. Клеточные лизаты анализировали иммуноблоттингом с использованием антител против PRMT4, GSK-3β и γ-тубулина соответственно. B и D : были нанесены результаты денситометрии A, и C . C : Белок GSK-3β эктопически экспрессировался в клетках MLE12 в течение 48 часов. Результаты представляют 3 независимых эксперимента. * P <0,05 или ** P ≤ 0.01 по сравнению с соответствующим контролем.

H
2 O 2 -опосредованная деградация PRMT4 нарушает миграцию эпителиальных клеток легких.

Окислительный стресс – одна из основных этиологических причин болезней легких. Поэтому мы проверили, вносит ли PRMT4 вклад в миграцию эпителиальных клеток легких в условиях окислительного стресса. Клетки-предшественники эпителия легких, включая клетки типа II, находящиеся в дистальной части бронхиолы, перемещаются в альвеолы ​​для регенерации и восстановления поврежденных альвеолярных клеток I типа (1, 25). Клетки MLE12, которые сохраняют некоторые свойства клеток типа II, использовали в анализах миграции. Результаты исследования заживления ран показывают, что избыточная экспрессия PRMT4 действительно ускоряет процесс заживления ран (). Нокдаун PRMT4 shRNA уменьшал процесс заживления ран по сравнению с контрольными клетками (). Эффекты сверхэкспрессии и нокдауна PRMT4 анализировали с помощью иммуноблоттинга (). Это наблюдение предполагает, что клеточный уровень PRMT4 имеет отношение к миграции клеток MLE12. Чтобы подтвердить это наблюдение, мы провели тесты Transwell, чтобы определить роль PRMT4 в миграции эпителиальных клеток легких в условиях окислительного стресса.Результаты показывают, что обработка H 2 O 2 ингибировала миграцию эпителиальных клеток легких (). Как и предполагалось, сверхэкспрессия PRMT4 успешно спасла H 2 O 2 -ингибированную миграцию клеток по сравнению с миграцией необработанных клеток. Нокдаун PRMT4 с помощью shRNA показал тенденцию к усиленному ингибированию миграции, возможно, потому, что обработка H 2 O 2 уже истощила PRMT4 в клетках (). Мы сравнили эффекты ингибирования миграции между более низкой концентрацией (50 мкМ) и более высокой концентрацией (100 мкМ) H 2 O 2 и определили, что низкая концентрация (50 мкМ) H 2 O 2 достаточно, чтобы подавить миграцию клеток.Более низкой концентрации (50 мкМ) H 2 O 2 было достаточно для снижения PRMT4 и GSK-3β на уровне белка в течение более длительного периода лечения (18 ч) (). Мы также отключили или эктопически экспрессировали GSK-3β, чтобы наблюдать миграцию клеток. Нокдаун GSK-3β нарушает миграцию клеток, а эктопическая экспрессия GSK-3β увеличивает миграцию клеток (). Эктопическая экспрессия PRMT4 спасала нарушенную миграцию клеток за счет нокдауна GSK-3β, указывая на то, что GSK-3β-опосредованная миграция клеток частично осуществляется посредством передачи сигналов PRMT4.Эти результаты показывают, что PRMT4 играет важную роль в нарушенной окислительным стрессом миграции эпителиальных клеток легких, что может препятствовать восстановлению и регенерации эпителиальных клеток легких.

Окислительный стресс подавляет PRMT4-опосредованную миграцию эпителиальных клеток легких. A : PRMT4 эктопически экспрессировался или подавлялся с помощью PRMT4-специфичных конструкций shRNA в клетках MLE12 в течение 24 часов. Анализ заживления ран проводили, как описано в материалах и методах. Изображения были получены с помощью световой микроскопии.Полоса рубца = 400 мкм. B : результаты A были нанесены на гистограмму. C : клетки, использованные в A , анализировали с помощью иммуноблоттинга PRMT4. D : сверхэкспрессированные PRMT4 и нокдаун клетки обрабатывали 50 или 100 мкМ H 2 O 2 в Transwells в течение 18 часов. Мигрировавшие клетки анализировали, и процент миграции отображали на гистограмме. E и F : указанные выше клетки анализировали с помощью иммуноблоттинга PRMT4. G и H : клетки MLE12 трансфицировали конструкциями GSK-3β, кшРНК против GSK-3β или PRMT4, как указано. G и H : иммуноблоттинг-анализ ( G ) и анализ Transwell ( H ) проводили в присутствии 100 мкМ H 2 O 2 . Результаты представляют 3 независимых эксперимента. * P <0,05 или ** P ≤ 0,01 по сравнению с соответствующим контролем.

ОБСУЖДЕНИЕ

Наш главный вывод в этом исследовании заключается в том, что окислительный стресс подавляет фермент метилирования гистонового и негистонового белка аргинина PRMT4 на уровне белка за счет нарушения GSK-3β-опосредованного фосфорилирования, препятствуя миграции эпителиальных клеток легких ().Окислительный стресс в легких, включая как эндогенные, так и экзогенные ресурсы, участвует в патогенезе различных заболеваний легких, таких как астма, ХОБЛ, фиброз и рак легких (2). Один из молекулярных механизмов заключается в том, что оксидативный стресс в легких нарушает регуляцию ферментов модификации гистонов. Все больше данных демонстрирует, что оксидативный стресс в легких нарушает регуляцию клеточных функций на эпигенетическом уровне (38). Здесь мы определили, что окислительный стресс препятствует миграции клеток из-за деградации фермента метилирования аргинина белка PRMT4.H 2 O 2 (200 мкМ) ускоряет разложение PRMT4, а период полураспада PRMT4 сокращается с 3,5 до 1,5 ч более чем в 2,3 раза (и). H 2 O 2 обработка разрушает GSK3β на уровне белка, что снижает фосфорилирование PRMT4 и впоследствии ускоряет деградацию белка PRMT4. Снижение PRMT4 при окислительном стрессе препятствует миграции клеток. Эктопическая экспрессия PRMT4 спасает подавленную окислительным стрессом миграцию клеток в эпителиальных клетках легких.Клетки типа II, клетки-предшественники альвеолярных клеток типа I, перемещаются из дистального отдела бронхиолы в альвеолы ​​для восстановления и регенерации альвеолярного эпителия после повреждения (1, 25). Эти наблюдения подчеркивают, что PRMT4 играет важную роль в патогенезе легочных заболеваний, опосредованных окислительным стрессом.

Схематическое изображение модуляции миграции клеток окислительным стрессом посредством передачи сигналов GSK-3β / PRMT4. GSK-3β фосфорилирует T132 в PRMT4 для стабилизации белка PRMT4 от протеасомной деградации убиквитина.Окислительный стресс подавляет GSK-3β, что приводит к деградации PRMT4. Снижение количества белка PRMT4 препятствует миграции клеток, что может повлиять на процесс восстановления и регенерации после повреждения легких.

Как фермент метилирования аргинина гистоновых и негистоновых белков, PRMT4 участвует в различных жизненных процессах, которые включают, помимо прочего, активацию транскрипции генов, пролиферацию и воспаление (10, 28, 33). Сообщалось, что окислительный стресс по-разному нарушает регуляцию членов семейства PRMT в различных типах клеток.Например, H 2 O 2 подавляет белки PRMT1, 4 и 6, чтобы модулировать асимметричное диметилирование в клетках фибробластов WI-38 (23). H 2 O 2 подавляет PRMT1 и 4 также в клетках пигментного эпителия сетчатки (20). Напротив, высокая концентрация глюкозы увеличивает PRMT4, вызывая гибель клеток пигментного эпителия сетчатки человека (21). Молекулярный механизм (ы) того, как окислительный стресс по-разному регулирует PRMT в различных клеточных линиях, еще предстоит выяснить или раскрыть.Здесь мы определили, что протеинкиназа GSK-3β имеет решающее значение в регуляции стабильности белка PRMT4. GSK-3β связывается с PRMT4, чтобы катализировать фосфорилирование PRMT4 T132 (). GSK-3β-зависимое фосфорилирование необходимо для поддержания стабильности белка PRMT4. GSK-3β-опосредованное фосфорилирование в T132 предотвращает убиквитинирование PRMT4 и последующую деградацию.

Сообщается, что окислительный стресс подавляет активность GSK-3β, одним из способов является фосфорилирование GSK-3β в неактивную форму (31, 42).Наши наблюдения показывают, что H 2 O 2 снижает уровень GSK-3β на уровне белка в эпителиальных клетках легких. GSK-3β, киназа ключевой посттрансляционной модификации, участвует исключительно в регуляции многих путей передачи клеточного сигнала при остром и хроническом заболевании легких. Одна из таких ролей – регулирование деградации белка. Предназначенный для деградации белок сначала помечается посттрансляционной модификацией, чтобы облегчить последующее убиквитинирование.Такие сигналы мечения включают фосфорилирование, ацетилирование, метилирование или другие посттрансляционные модификации. GSK-3β фосфорилирует субстраты через консенсусный мотив S / TXXXS / T, который также идентифицируется как сайт стыковки многими убиквитинлигазами E3 (14, 43). Например, одна убиквитинлигаза F-box E3, SCF Fbxw1 , специфически распознает этот сайт для разрушения синтетического фермента поверхностно-активного вещества в эпителиальных клетках легких (45). Интересно, что PRMT4 содержит этот мотив, 132TXXXS, и GSK-3β также катализирует фосфорилирование T132.Возможно, что протеасомная деградация убиквитина PRMT4 происходит через убиквитинлигазу F-box E3. Следует отметить, что GSK-3β-опосредованное фосфорилирование в PRMT4 стабилизирует белок от убиквитинирования, что означает, что GSK3β-опосредованное фосфорилирование также может действовать как сигнал против убиквитинирования.

Убиквитиновая протеасомная система превращает большинство клеточных белков в живые клетки. В координации с транскрипцией генов механизм протеасомной деградации убиквитина строго регулирует доступность белка, чтобы гарантировать плавное выполнение разнообразных клеточных функций.Ферменты модификации гистонов представляют собой белковые субстраты, находящиеся под строгим контролем протеасомной системы убиквитина (48). Дерегулированная протеасомная деградация убиквитина ферментов модификации гистонов была документально подтверждена в широком диапазоне патофизиологических условий, включая легочные заболевания (45, 47, 48). Одно исследование включает продемонстрированное нарушение регуляции PRMT4 на уровне белка без определения конкретного молекулярного механизма (19). Здесь мы добавляем еще одну парадигму, согласно которой окислительный стресс запускает убиквитинирование PRMT4 и, следовательно, протеасомную деградацию через нарушение передачи сигналов GSK-3β.Окислительный стресс снижает уровень GSK-3β, который препятствует фосфорилированию PRMT4 T132. Мутант, имитирующий дефосфорилирование PRMT4, предрасположен к убиквитинированию по сравнению с мутантом, имитирующим фосфорилирование WT, PRMT4. Кроме того, обратимый ингибитор протеасом MG132 отменяет вызванное H 2 O 2 деградацию PRMT4. Убиквитинирование белков для протеасомной деградации представляет собой ферментативный каскад, в котором задействованы три фермента убиквитинирования: фермент активации убиквитина E1, фермент конъюгации убиквитина E2 и убиквитинлигаза E3.Среди ферментов убиквитинлигаза E3 является субстрат-специфичной для распознавания субстрата. Убиквитинлигаза E3, специфичная для убиквитинирования PRMT4, еще не подвергалась скринингу. Исследования детального молекулярного механизма (ов) того, как PRMT4 убиквитинируется и протеасомная деградация, продолжаются.

В заключение, в этом исследовании мы демонстрируем, что GSK-3β имеет решающее значение для поддержания стабильности белка PRMT4 в эпителиальных клетках легких. GSK-3β связывается с PRMT4 и способствует фосфорилированию PRMT4 в точке T132. Недостаток GSK-3β приводит к дефосфорилированию PRMT4 на T132, что увеличивает убиквитинирование PRMT4 и протеасомную деградацию. Наконец, окислительный реагент H 2 O 2 подавляет белок GSK-3β, дестабилизируя PRMT4 за счет убиквитинирования и деградации протеасом, что нарушает миграцию эпителиальных клеток легких, препятствуя процессу восстановления и регенерации после повреждения легких.

ГРАНТЫ

Работа поддержана грантом Национального института сердца, легких и крови R01 HL-125435 (C.Цзоу).

РАСКРЫТИЕ ИНФОРМАЦИИ

Авторы не заявляют о конфликте интересов, финансовом или ином.

ВЗНОС АВТОРА

C.Z. задуманное и спланированное исследование; X.L., Y.L., J.L. и M.Z. проведенные эксперименты; X.L. и Ч. проанализированные данные; X.L. и Ч. интерпретированные результаты экспериментов; X.L. и Ч. подготовленные фигурки; X.L. и Ч. составленная рукопись; Ю.Л. и Ч. отредактированная и исправленная рукопись. X.L., Y.L., J. L., M.Z. и C.Z. утверждена окончательная версия рукописи.

ССЫЛКИ

1. Анверса П., Кайстура Дж., Лери А., Лоскальцо Дж. Тканеспецифические взрослые стволовые клетки в легких человека. Нат Мед 17: 1038–1039, 2011. DOI: 10.1038 / nm.2463. [PubMed] [CrossRef] [Google Scholar] 2. Баргальи Э., Оливьери Ч., Беннетт Д., Прассе А, Мюллер-Кернхейм Дж., Роттоли П. Окислительный стресс в патогенезе диффузных заболеваний легких: обзор. Респир Мед 103: 1245–1256, 2009. DOI: 10.1016 / j.rmed.2009.04.014. [PubMed] [CrossRef] [Google Scholar] 3. Батут Дж., Дубое С., Вандель Л.Метилтрансферазы PRMT4 / CARM1 и PRMT5 по-разному контролируют миогенез у рыбок данио. PLoS One 6: e25427, 2011. doi: 10.1371 / journal.pone.0025427. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 5. Бхавсар П., Ахмад Т., Адкок И.М. Роль гистоновых деацетилаз при астме и аллергических заболеваниях. J Allergy Clin Immunol 121: 580–584, 2008. DOI: 10.1016 / j.jaci.2007.12.1156. [PubMed] [CrossRef] [Google Scholar] 6. Chen W, Xiong S, Li J, Li X, Liu Y, Zou C, Mallampalli RK. Лигаза убиквитина E3 SCF-FBXO24 распознает деацетилированную нуклеозиддифосфаткиназу A для усиления ее разложения.Mol Cell Biol 35: 1001–1013, 2015. DOI: 10.1128 / MCB.01185-14. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 7. Cheng D, Côté J, Shaaban S, Bedford MT. Аргининметилтрансфераза CARM1 регулирует сочетание транскрипции и процессинга мРНК. Mol Cell 25: 71–83, 2007. DOI: 10.1016 / j.molcel.2006.11.019. [PubMed] [CrossRef] [Google Scholar] 8. Череш П., Ким С.Дж., Туласирам С., Камп Д.В. Окислительный стресс и фиброз легких. Биохим Биофиз Акта 1832: 1028–1040, 2013. DOI: 10.1016 / j.bbadis.2012.11.021. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Червона Ю., Арита А, Коста М. Канцерогенные металлы и эпигеном: понимание влияния никеля, мышьяка и хрома. Металломика 4: 619–627, 2012. DOI: 10.1039 / c2mt20033c. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Кович М., Хасса П.О., Саккани С., Буэрки С., Мейер Н.И., Ломбарди С., Имхоф Р., Бедфорд М.Т., Натоли Дж., Хоттигер МО. Аргининметилтрансфераза CARM1 является промотор-специфическим регулятором экспрессии NF-kappaB-зависимого гена.EMBO J 24: 85–96, 2005. DOI: 10.1038 / sj.emboj.7600500. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 12. Эль-Мессауди С., Фаббрицио Е., Родригес С., Чучана П., Фокье Л., Ченг Д., Тейе С., Вандель Л., Бедфорд М. Т., Сардет К. Ассоциированная с коактиватором аргининметилтрансфераза 1 (CARM1) является позитивным регулятором гена циклина E1. Proc Natl Acad Sci USA 103: 13351–13356, 2006. DOI: 10.1073 / pnas.0605692103. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13. Эллис Б., Кэрчер Л., Снавели К., Чжао Ю., Цзоу К.Липополисахарид запускает ядерный импорт Lpcat1 для регулирования экспрессии индуцируемых генов в эпителии легких. Мир J Biol Chem 3: 159–166, 2012. DOI: 10.4331 / wjbc.v3.i7.159. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Фукс С.Ю., Шпигельман В.С., Кумар К.Г. Многоликая лигаза убиквитина бета-TrCP E3: отражение в волшебном зеркале рака. Онкоген 23: 2028–2036, 2004. DOI: 10.1038 / sj.onc.1207389. [PubMed] [CrossRef] [Google Scholar] 15. Холливелл Б., Клемент М.В., Лонг Л.Х. Перекись водорода в организме человека.FEBS Lett 486: 10–13, 2000. DOI: 10.1016 / S0014-5793 (00) 02197-9. [PubMed] [CrossRef] [Google Scholar] 16. Hassa PO, Covic M, Bedford MT, Hottiger MO. Белок аргининметилтрансфераза 1 коактивирует NF-kappaB-зависимую экспрессию гена синергетически с CARM1 и PARP1. Дж Мол Биол 377: 668–678, 2008. DOI: 10.1016 / j.jmb.2008.01.044. [PubMed] [CrossRef] [Google Scholar] 17. Хван Дж. У., Чунг С., Сундар И. К., Яо Х., Аруначалам Дж., Макберни М. В., Рахман И. Аутофагия, индуцированная сигаретным дымом, регулируется SIRT1-PARP-1-зависимым механизмом: участие в патогенезе ХОБЛ.Arch Biochem Biophys 500: 203–209, 2010. DOI: 10.1016 / j.abb.2010.05.013. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Ито К., Ито М., Эллиотт В.М., Косио Б., Карамори Дж., Кон О.М., Барчик А., Хаяши С., Адкок И.М., Хогг Дж.С., Барнс П.Дж. Снижение активности гистондеацетилазы при хронической обструктивной болезни легких. N Engl J Med 352: 1967–1976, 2005. DOI: 10.1056 / NEJMoa041892. [PubMed] [CrossRef] [Google Scholar] 19. Ким Д, Лим С., Пак М, Чой Дж, Ким Дж, Хан Х, Юн К., Ким К, Лим Дж, Пак С. Зависимая от убиквитинирования деградация CARM1 способствует Notch2-опосредованному апоптозу подоцитов при диабетической нефропатии.Сотовый сигнал 26: 1774–1782, 2014. doi: 10.1016 / j.cellsig.2014.04.008. [PubMed] [CrossRef] [Google Scholar] 20. Kim DI, Park MJ, Choi JH, Kim IS, Han HJ, Yoon KC, Park SW, Lee MY, Oh KS, Park SH. PRMT1 и PRMT4 регулируют вызванное окислительным стрессом повреждение пигментных эпителиальных клеток сетчатки в зависимости от SIRT1 и SIRT1-независимого характера. Oxid Med Cell Longev 2015: 617919, 2015. DOI: 10.1155 / 2015/617919. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Ким Ди, Пак MJ, Лим СК, Чой Дж.Х., Ким Дж.С., Хан Х.Дж., Кунду Т.К., Пак Джи, Юн К.С., Пак С.В., Пак Дж.С., Хео Ю.Р., Пак Ш.Вызванная высокой глюкозой экспрессия CARM1 регулирует апоптоз пигментных эпителиальных клеток сетчатки человека посредством диметилирования гистона 3 аргинина 17: роль в диабетической ретинопатии. Arch Biochem Biophys 560: 36–43, 2014. DOI: 10.1016 / j.abb.2014.07.021. [PubMed] [CrossRef] [Google Scholar] 22. Лоулесс М.В., О’Бирн К.Дж., Грей С.Г. Окислительный стресс, индуцированный раком легких и ХОБЛ: возможности эпигенетической терапии. J Cell Mol Med 13, 9A: 2800–2821, 2009. DOI: 10.1111 / j.1582-4934.2009.00845.x. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23.Lim Y, Lee E, Lee J, Oh S, Ким С. Подавление асимметричного метилирования аргинина во время репликации и преждевременного старения, индуцированного H 2 O 2 в диплоидных фибробластах человека WI-38. J Biochem 144: 523–529, 2008. DOI: 10.1093 / jb / mvn097. [PubMed] [CrossRef] [Google Scholar] 24. Марвик Дж. А., Киркхэм П. А., Стивенсон К. С., Данахай Х., Гиддингс Дж., Батлер К., Дональдсон К., Макни В., Рахман И. Сигаретный дым изменяет ремоделирование хроматина и индуцирует провоспалительные гены в легких крысы. Am J Respir Cell Mol Biol 31: 633–642, 2004.DOI: 10.1165 / rcmb.2004-0006OC. [PubMed] [CrossRef] [Google Scholar] 25. Маккуалтер Дж. Л., Юэн К., Уильямс Б., Бертончелло И. Доказательства иерархии эпителиальных стволовых / предшественников в легких взрослых мышей. Proc Natl Acad Sci USA 107: 1414–1419, 2010. DOI: 10.1073 / pnas.07107. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Новак Д., Антчак А., Крол М., Пьетрас Т., Шариати Б., Бяласевич П., Ечковски К., Кула П. Повышенное содержание перекиси водорода в выдыхаемом воздухе курильщиков сигарет.Eur Respir J 9: 652–657, 1996. DOI: 10.1183 / 036.96.052. [PubMed] [CrossRef] [Google Scholar] 27. О’Брайен К. Б., Альберих-Жорда М., Ядав Н., Кочер О., Дируссио А., Эбралидзе А., Левантини Э, Сан Нью-Джерси, Бхасин М., Карон Т., Ким Д., Стейдл Ю., Хуанг Дж., Халмос Б., Родиг С. Дж., Бедфорд MT, Тенен Д.Г., Кобаяши С. CARM1 необходим для надлежащего контроля пролиферации и дифференцировки легочных эпителиальных клеток. Разработка 137: 2147–2156, 2010. DOI: 10.1242 / dev.037150. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28.Пал С., Сиф С. Взаимодействие ремоделиров хроматина и протеин-аргинин-метилтрансфераз. J Cell Physiol 213: 306–315, 2007. DOI: 10.1002 / jcp.21180. [PubMed] [CrossRef] [Google Scholar] 29. Пандит К.В., Милошевич Дж., Камински Н. МикроРНК при идиопатическом фиброзе легких. Перевод Res 157: 191–199, 2011. DOI: 10.1016 / j.trsl.2011.01.012. [PubMed] [CrossRef] [Google Scholar] 30. Раджендрасожан С., Яо Х., Рахман И. Современные взгляды на роль модификаций хроматина и деацетилаз в воспалении легких при ХОБЛ.ХОБЛ 6: 291–297, 2009. DOI: 10.1080 / 154125509132. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Шефер М., Гуденаф С., Моосманн Б., Бел К. Ингибирование киназы гликогенсинтазы 3 бета участвует в устойчивости к окислительному стрессу в нейрональных клетках HT22. Brain Res 1005: 84–89, 2004. DOI: 10.1016 / j.brainres.2004.01.037. [PubMed] [CrossRef] [Google Scholar] 32. Schünemann HJ, Muti P, Freudenheim JL, Armstrong D, Browne R, Klocke RA, Trevisan M. Окислительный стресс и функция легких.Am J Epidemiol 146: 939–948, 1997. DOI: 10.1093 / oxfordjournals.aje.a009220. [PubMed] [CrossRef] [Google Scholar] 33. Schurter BT, Koh SS, Chen D, Bunick GJ, Harp JM, Hanson BL, Henschen-Edman A, Mackay DR, Stallcup MR, Aswad DW. Метилирование гистона h4 с помощью соактиватора-ассоциированной аргининметилтрансферазы 1. Биохимия 40: 5747–5756, 2001. DOI: 10.1021 / bi002631b. [PubMed] [CrossRef] [Google Scholar] 34. Scott JA, Duongh M, Young AW, Subbarao P, Gauvreau GM, Grasemann H. Асимметричный диметиларгинин при хронической обструктивной болезни легких (ADMA при ХОБЛ).Int J Mol Sci 15: 6062–6071, 2014. DOI: 10.3390 / ijms15046062. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Скотт Дж. А., Говро Г. М., Грасеманн Х. Асимметричный диметиларгинин и астма. Eur Respir J 43: 647–648, 2014. DOI: 10.1183 / 036.00080313. [PubMed] [CrossRef] [Google Scholar] 36. Скотт Дж.А., Грасеманн Х. Асимметричный диметиларгинин: маркер астмы? Грудь 144: 367–368, 2013. DOI: 10.1378 / Chess.13-0480. [PubMed] [CrossRef] [Google Scholar] 37. Сундар И.К., Яо Х., Рахман И.Окислительный стресс и ремоделирование хроматина при хронической обструктивной болезни легких и заболеваниях, связанных с курением. Антиоксидный окислительно-восстановительный сигнал 18: 1956–1971, 2013. DOI: 10.1089 / ars.2012.4863. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 38. Валаванидис А., Влачогианни Т., Фиотакис К., Лоридас С. Окислительный стресс в легких, воспаление и рак: вдыхаемые твердые частицы, волокнистая пыль и озон как основные причины канцерогенеза легких через механизмы активных форм кислорода. Int J Environ Res Public Health 10: 3886–3907, 2013.DOI: 10.3390 / ijerph20093886. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. ван Иден С.Ф., Син Д.Д. Окислительный стресс при хронической обструктивной болезни легких: легкое и системный процесс. Может Респир J 20: 27–29, 2013. DOI: 10.1155 / 2013/509130. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Wang L, Zhao Z, Meyer MB, Saha S, Yu M, Guo A, Wisinski KB, Huang W, Cai W, Pike JW, Yuan M, Ahlquist P, Xu W. CARM1 метилирует фактор ремоделирования хроматина BAF155 для ускорения прогрессирования опухоли и метастазирования.Раковая клетка 25: 21–36, 2014. DOI: 10.1016 / j.ccr.2013.12.007. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Xing HY, Cai YQ, Wang XF, Wang LL, Li P, Wang GY, Chen JH. Цитопротекторный эффект гиперозида против окислительного стресса опосредуется сигнальным путем Nrf2-ARE через инактивацию GSK-3β. PLoS One 10: e0145183, 2015. doi: 10.1371 / journal.pone.0145183. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 44. Zakrzewicz D, Zakrzewicz A, Preissner KT, Markart P, Wygrecka M.Белокаргининметилтрансферазы (PRMT): многообещающие мишени для лечения легочных заболеваний. Int J Mol Sci 13: 12383–12400, 2012. DOI: 10.3390 / ijms131012383. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Цзоу К., Батлер П.Л., Кун Т.А., Смит Р.М., Хаммен Дж., Чжао Ю., Чен Б.Б., Маллампалли Р.К. ЛПС нарушает синтез фосфолипидов, запуская опосредованное белком, содержащим бета-трансдуцин-повтор (beta-TrCP), полиубиквитинирование и деградацию поверхностно-активного фермента ацил-КоА: лизофосфатидилхолинацилтрансферазы I (LPCAT1).J Biol Chem 286: 2719–2727, 2011. DOI: 10.1074 / jbc.M110.192377. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Zou C, Chen Y, Smith RM, Snavely C, Li J, Coon TA, Chen BB, Zhao Y, Mallampalli RK. SCF (Fbxw15) опосредует связывание гистонацетилтрансферазы с комплексом распознавания источника (HBO1) убиквитин-протеасомная деградация для регулирования пролиферации клеток. J Biol Chem 288: 6306–6316, 2013. DOI: 10.1074 / jbc.M112.426882. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Zou C, Li J, Xiong S, Chen Y, Wu Q, Li X, Weathington NM, Han S, Snavely C, Chen BB, Mallampalli RK.Фактор смертности 4, подобный белку 1, опосредует гибель эпителиальных клеток в мышиной модели пневмонии. Sci Transl Med 7: 311ra171, 2015. DOI: 10.1126 / scitranslmed.aac7793. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 48. Zou C, Маллампалли РК. Регуляция ферментов, модифицирующих гистоны, убиквитин-протеасомной системой. Биохим Биофиз Акта 1843: 694–702, 2014. DOI: 10.1016 / j.bbamcr.2013.12.016. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 49. Zou C, Synan MJ, Li J, Xiong S, Manni ML, Liu Y, Chen BB, Zhao Y, Shiva S, Tyurina YY, Jiang J, Lee JS, Das S, Ray A, Ray P, Kagan VE, Mallampalli RK .ЛПС ухудшает утилизацию кислорода в эпителии, запуская деградацию митохондриального фермента Alcat1. J Cell Sci 129: 51–64, 2016. DOI: 10.1242 / jcs.176701. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Страница не найдена «Какой ортопедический имплант

Очевидные особенности:

Общая форма: любой … бумерангизогнутыйизогнутый, в форме банана плоский конический клин плавно изогнутый полусферический прямой прямой конический

Фиксация: любой…ЦементЦементная остеоинтеграция проксимального отдела HA

Конструкция (цементированная): любая … бесцементная композитная балка, конус, конус, скользящая фиксация, без цемента

Уровень фиксации (без цемента): любой … проксимальный весь стержень

Слот для вставки: любой … нет

Винты: любой … 0 или 5 нет

Номер отверстия: любой … 1245 нет

Средний воротник: любой…nosleeveyes

Боковой воротник: любой … нет

Зоны Груена:

Шея / Z7 Граница: любой …

Z7 Форма: любая … вогнутая вогнутая, манжета, малая вогнутая, прямая

Z7 Контур: любые … мягкие бордюры гладкие

Граница Z7 / Z6: любые … средние вогнутые соединения стержней малые вогнутые

Z6 Форма: любой…медленно вогнутая прямая

Z6 Контур: любой … гладкий

Граница Z6 / Z5: любой … медленный конвективный переход к цилиндрическому дистальному стержню

Z5 Форма: любой … вогнутый прямой

Контур Z5: любой … гладкий

Граница Z5 / Z4: любой …

Форма Z4: любой … изогнутый острие скругленный наклонный сбоку конус

Контур Z4: любой…блунт, по сравнению с ABG 2, который имеет форму пули, остроконечный, гладкий

Граница Z4 / Z3: любой …

Z3 Форма: любой … выпуклый прямой

Контур Z3: любой … гладкий

Граница Z3 / Z2: любой …

Z2 Форма: любая … угловая выпуклая прямая

Контур Z2: любой…гладкий

Граница Z2 / Z1: любой … переход от цилиндрической зоны 2 к широкой зоне 1 на боковом плавнике и спинном рукаве крыла на 15 градусов

Z1 Форма: любой … угловой выпуклыйбоковой плавникмалый выпуклыйпрямый прямой

Z1 Контур: любой … гладкий

Z1 / граница плеча: любой … большой боковой плавник острый

Форма плеча: любой…Острый уголкруглый уголкруглый угол

Контур плеча: любой … вставной слот вставной разъем гладкий

Индекс / wp-content / uploads / 2021/04

 Имя Последнее изменение Размер Описание 
Родительский каталог - 2021-NLD-Spring-Cook ..> 2021-04-23 05:24 5.6K 2021-NLD-Spring-Cook ..> 2021-04-23 05:24 11K 2021-NLD-Spring-Cook..> 2021-04-23 05:24 59K 2021-NLD-Spring-Cook ..> 2021-04-23 05:24 115K 2021-NLD-Spring-Cook ..> 2021-04-23 05:24 544K Браунси-2021-pdf-11 ..> 2021-04-14 10:53 7,0K Браунси-2021-pdf-23 ..> 2021-04-14 10:53 20K Браунси-2021-pdf-79 ..> 2021-04-14 10:53 169K Brownsea-2021-pdf.jpg 2021-04-14 10:53 307K Brownsea-2021.pdf 2021-04-14 10:53 875K Brownsea-troop-photo ..> 2021-04-14 12:13 27K Браунси-фотография войск..> 2021-04-14 12:13 74K Brownsea-troop-photo ..> 2021-04-14 12:13 50K Brownsea-troop-photo ..> 2021-04-14 12:13 181K Brownsea-troop-photo ..> 2021-04-14 12:13 93K Brownsea-troop-photo ..> 2021-04-14 12:13 938K Brownsea-troop-photo ..> 2021-04-14 12:04 9.2K Brownsea-troop-photo ..> 2021-04-14 12:04 45K Brownsea-troop-photo ..> 2021-04-14 12:04 24K Brownsea-troop-photo ..> 2021-04-14 12:04 120K Браунси-фотография войск..> 2021-04-14 12:04 58K Brownsea-troop-photo ..> 2021-04-14 12:04 239K Brownsea-troop-photo ..> 2021-04-14 12:04 116K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 275K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 12K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 43K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 409K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 27K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 92K Cub-Scout-OE-patch-d..> 2021-04-07 11:01 47K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 151K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 523K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 6.3K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 13K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 64K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 110K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 680K Cub-Scout-OE-patch-d ..> 2021-04-07 11:01 187K Eagle-Scout-BoR-Requ..> 2021-04-14 10:28 7,1K Eagle-Scout-BoR-Requ ..> 2021-04-14 10:28 19K Eagle-Scout-BoR-Requ ..> 2021-04-14 10:28 139K Eagle-Scout-BoR-Requ ..> 2021-04-14 10:28 252K Eagle-Scout-BoR-Requ ..> 2021-04-14 10:27 503K Глобус-Журнал-4-11 - ..> 2021-04-14 10:37 8.7K Глобус-Журнал-4-11 - ..> 2021-04-14 10:37 22K Глобус-Журнал-4-11 - ..> 2021-04-14 10:37 154K Глобус-Журнал-4-11 - ..> 2021-04-14 10:37 309K Глобус-Журнал-4-11-..> 2021-04-14 10:37 381K НЛД-Сосновый лес-Дерби-Г ..> 2021-04-20 10:56 5.3K NLD-Pinewood-Derby-G ..> 2021-04-20 10:56 10K NLD-Pinewood-Derby-G ..> 2021-04-20 10:56 59K NLD-Pinewood-Derby-G ..> 2021-04-20 10:56 106K NLD-Pinewood-Derby-G ..> 2021-04-20 10:56 237K T132-150x150.jpg 2021-04-30 10:53 6.6K [электронная почта защищена] 2021-04-30 10:53 17K T132-2-150x150.jpg 2021-04-30 10:53 7.2K [электронная почта защищена] 2021-04-30 10:53 16K Т132-2-300х296.jpg 2021-04-30 10:53 19K T132-2-310x270.jpg 2021-04-30 10:53 20K T132-2.jpg 2021-04-30 10:53 20K T132-224x300.jpg 2021-04-30 10:53 16K T132-300x270.jpg 2021-04-30 10:53 17K T132.jpg 2021-04-30 10:53 24K silver-beaver-nomina ..> 2021-04-13 07:39 13K silver-beaver-nomina ..> 2021-04-13 07:39 34K silver-beaver-nomina ..> 2021-04-13 07:39 27K серебряный бобр-номина..> 2021-04-13 07:39 73K серебряный бобр-номина ..> 2021-04-13 07:39 61K silver-beaver-nomina ..> 2021-04-13 07:39 112K t24-b2-150x150.jpg 2021-04-02 07:32 6.3K t24-b2-300x200.jpg 2021-04-02 07:32 15K t24-b2.jpg 2021-04-02 07:32 29K t24b4-150x150.jpg 2021-04-02 07:32 8,3K t24b4-300x200.jpg 2021-04-02 07:32 19K t24b4.jpg 2021-04-02 07:32 35K

(PDF) T132.ДИСФУНКЦИИ РЕТИНАЛЬНЫХ ГАНГЛИЙНЫХ КЛЕТК У ПАЦИЕНТОВ ШИЗОФРЕНИИ

SIRS 2020 Аннотации

Стендовая сессия III S281

Функциональные реакции сетчатки фоторецепторов и RGC у больных шизо-

контрольной группы по сравнению со здоровыми пациентами с френией.

Методы: fERG, проведенный в скотопическом (адаптированный к темноте 0,01 и темный-a-

dapted 3,0 ERG) и фотопических условиях (адаптированный к свету 3,0 ERG), и

pERG были зарегистрированы у больных шизофренией (n = 29) и здоровых контролирует

(n = 29).PERG обеспечивает измерения двух волн: волны P50, которая

возникает в RGC с участием биполярных клеток и относится к пространственному распределению и плотности тел RGC, и волна N95, которая

представляет активность ганглиозных клеток. .

Результаты: результаты fERG показали уменьшение амплитуды b-волны (t (51) = –

3,4, p <0,05, d = 0,63) (адаптированная к темноте 0,01 ERG), амплитуда a-волны (t ( 48) = 4,7,

p <0,001, d = 1,33) (адаптировано к темноте 3.0 ERG), амплитуда b-волны (t (48) = - 2,8,

p <0,005, d = 0,78) (адаптированная к темноте 3,0 ERG), амплитуда a-волны (t (52) = 2,8,

p <0,001, d = 0,29) (адаптированная к свету 3,0 ЭРГ) у больных шизофренией

по сравнению с контролем. Мы также обнаружили значительное уменьшение неявного времени a-волны

(t (52) = – 2,5, p <0,05, d = 1,19) (адаптированная к свету 3,0 ЭРГ) у пациентов с шизофренией

. по сравнению с контролем. Результаты pERG показали значительное увеличение P50 на

(t (55) = 2.1, p <0,05, d = 0,55) и значительное увеличение на

неявного времени N95 у пациентов с шизофренией по сравнению с контрольной группой

(t (55) = 4,2; p <0,001, d = 0,66).

Обсуждение: Наши результаты повторяют предыдущие открытия относительно фоторецепторов

и дисфункции биполярных клеток у пациентов с шизофренией. Результаты pERG демонстрируют задержку передачи потенциалов действия ганглиозными клетками

вдоль зрительного пути через зрительный нерв и латеральную коленчатую клетку nu-

в зрительную кору у пациентов с шизофренией, что может поддерживать

изменений. в мозговой зрительной обработке при шизофрении.

T133. НЕЙРОННЫЕ КОРРЕЛАТЫ ЭМОЦИОНАЛЬНЫХ

ОБРАБОТКА В РИСКЕ ПСИХОЗА И НАСТОЯЩЕМУ –

АССИСТЕМАТИЧЕСКИЙ ОБЗОР И МЕТА-АНАЛИЗ

ИЗ FMRI ИССЛЕДОВАНИЙ

Паулина Луков * 1,

, Психология и нейробиология, Королевский колледж

Лондон; 2 King’s College London

Общие сведения: поведенческие данные показывают, что отклонения в обработке эмоций

, обычно наблюдаемые при установленной шизофрении, уже присутствуют у пациентов с первым эпизодом психоза (FEP)

.Доказательства

.

были менее последовательными у людей с высоким клиническим риском психоза (CHRp).

В то время как в нескольких исследованиях сообщалось о неизменных поведенческих характеристиках при идентификации эмоций

у людей в CHRp по сравнению со здоровыми людьми из контрольной группы,

некоторые исследования показали более низкое распознавание отрицательных эмоций. Растущее число

исследований функционального магнитного резонанса (фМРТ) исследовали реакцию мозга на обработку эмоций

, чтобы выяснить механизмы, лежащие в основе этих процессов у пациентов с FEP и пациентов с CHRp.Несмотря на заметное расширение этого поля за последние два десятилетия на

, на сегодняшний день ни один системный обзор или метаанализ не предпринял попыток синтезировать свидетельства о

нейронных базах обработки эмоций в этих группах как потенциальных. маркеры

уязвимости и выраженности психоза.

Методы: в базах данных PubMed и Ovid MEDLINE был произведен поиск

опубликованных англоязычных статей с применением задачи обработки эмоций

во время фМРТ в образце FEP и / или CHRp по сравнению со здоровыми людьми из контрольной группы.

Ссылки на включенные статьи также были просмотрены. В исследования CHRp были включены только

тех, которые включали участников по основному или ослабленному признаку –

критериям.

Методология и результаты отдельных исследований были извлечены и систематизированы.

систематически проанализированы. Кроме того, в настоящее время от авторов исследования собираются статистические параметрические карты con-

trast-карт («Т-карты»), которые будут подвергаться метаанализу с использованием метода d-картирования на основе семян.Контрасты

, проанализированные метаанализом, будут теми, о которых чаще всего сообщают в исследованиях, выявленных

, то есть всех эмоций по сравнению с условиями сравнения и негативных эмоций

по сравнению с нейтральными условиями. Они будут подвергнуты метаанализу отдельно,

, поскольку поведенческие данные предполагают, что эффективность распознавания эмоций в

этих популяциях может быть специфичной для валентности.

Результаты: Для систематического обзора 4 389 статей были идентифицированы с помощью поиска

.Было идентифицировано 19 соответствующих документов фМРТ, и их ссылки

были проверены. 17 статей были включены после полнотекстового просмотра. Шесть из

двенадцати исследований фМРТ в популяции FEP сообщили о более низкой активации мозга

для задач обработки эмоций по сравнению со здоровыми людьми из контрольной группы. В четырех статьях

сообщалось о гипер- и гипоактивации, зависящей от региона, а в двух исследованиях

не было обнаружено значительных различий. Из семи исследований в популяции CHRp в одном исследовании

и

сообщалось о более низкой реакции мозга на эмоции по сравнению со здоровыми людьми в контрольной группе,

, в двух исследованиях была обнаружена гиперактивация, в одном исследовании было обнаружено, что

увеличивается и уменьшается в зависимости от региона, а в двух исследованиях не сообщалось об отсутствии существенная разница.

Наиболее последовательным результатом в исследованиях была активация нижней миндалины

у участников FEP (n = 6). Напротив, в популяции CHRp одна статья

обнаружила увеличение реакции миндалины на эмоции с возрастом, последовательно

с одной другой статьей, но контрастирует с другим исследованием, показывающим, что активность

снижается в этой области.

Обсуждение: Насколько нам известно, ни один предыдущий систематический обзор или мета-анализ

не синтезировали результаты фМРТ обработки эмоций у

человек в CHRp и FEP.Настоящий систематический обзор показывает, что, хотя

более устойчивых гипоактиваций обнаруживаются в популяции FEP, результаты

менее согласованы в исследованиях CHRp. В ходе текущего метаанализа

количественно синтезируют эти результаты. Выяснение природы отклонений в обработке эмоций

при раннем психозе может помочь понять функциональные изменения как в фазах уязвимости, так и в фазах появления симптомов

и дать информацию для молекулярных исследований лежащих в их основе механизмов.

Т134. РОЛЬ РЕЖИМА ПО УМОЛЧАНИЮ

СЕТЬ В ШИЗОФРЕНЕ И

АУДИТОРИЧЕСКИЕ ГАЛЛЮЦИНАЦИИ – AN

ИССЛЕДОВАНИЕ ДИНАМИЧЕСКОГО FMRI ВОССТАНОВЛЕНИЯ

ГОСУДАРСТВЕННАЯ ПОДКЛЮЧЕНИЕ

,

, Эриксон-Джон, 1 Севдалина Кандиларова3,

Дроздстой Стоянов3, Кристина Компус4, Кеннет Хугдал5

1 Институт биологической и медицинской психологии, Университет

Берген; 2 Университетская больница Хокеланда, Бергенский университет;

3Медицинский университет Пловдива; 4Университет Бергена, Университет

Тарту; 5University of Bergen

Предыстория: Имеется множество свидетельств, показывающих аберрантную функциональную

связность (FC) при шизофрении, но со значительной вариабельностью в результатах

в разных исследованиях.Динамический FC является расширением традиционной статической

FC, поскольку такой анализ позволяет исследовать временные изменения в связности

. Таким образом, они также предоставляют более подробную информацию о нарушениях активности при психических расстройствах, таких как шизофрения.

Методы. В данном исследовании изучали динамический ФК на выборке из

80 пациентов с шизофренией и 80 здоровых контрольных субъектов.

Кроме того, были изучены отношения со слуховыми вербальными галлюцинациями (AVH),

, основным симптомом шизофрении.Были использованы две меры AVH

, одна мера текущей серьезности AVH, оцененная в день сканирования

, и одна характеристика-мера, где AVH оценивалась повторно в течение

в течение одного года.

Результаты: По сравнению со здоровыми контрольными пациентами, пациенты с шизофренией показали увеличение времени пребывания на

в состояниях с высокой степенью связи в пределах сети режима

(DMN) по умолчанию. Текущая степень тяжести АВГ не показала значимой связи с динамическим ФК.Тем не менее, показатель склонности AVH

в течение одного года показал значительную связь с динамическим FC. Пациенты

с высокой предрасположенностью к AVH проводили меньше времени в состояниях подключения, характеризуемых

сильной антикорреляцией между DMN и сетями положительных задач.

Обсуждение: результаты предоставляют дополнительные доказательства дисфункции DMN

при шизофрении, которая может быть связана с нарушениями мышления, связанными с повышенным внутренним фокусом когнитивной обработки.Эффекты

Загружено с https://academic.oup.com/schizophreniabulletin/article-abstract/46/Supplement_1/S280/5839289 гостем 18 июня 2020 г.

2 -___ a / __ Peiker acustic GmbH & KG




























 ТЕСТ ОТЧЕТ
№: 6-0491-14-1-23f
В соответствии с:
Правила FCC
Часть 2.1091
IC-правила
RSS-102, Выпуск 4
для
peiker acustic GmbH & Co.КГ
Устройство GSM / W-CDMA / LTE
Банкомат-01 T1-RoW-4G
FCC-ID: QWY-ATM-T-132
IC: 6588A-ATMT132
Аккредитация лабораторий и списки
Рег. №: 736496
MRA US-EU 0003
Промышленность Канады
Добровольный контроль за
Электромагнитное излучение
Рег. №: 3462D-1
Рег. №: 3462D-2
Рег. №: 3462D-3
Рег. Нет.:
Р-2666 С-2914,
Т-1967, Г-301
аккредитован согласно DIN EN ISO / IEC 17025
CETECOM GmbH
Лабораторная радиосвязь и электромагнитная совместимость
Im Teelbruch 116 • 45219 Эссен • Германия
Зарегистрировано в Эссене, Германия, рег.№: HRB Essen 8984
Тел .: + 49 (0) 20 54/95 19-954 • Факс: + 49 (0) 20 54/95 19-964
Электронная почта: [email protected]tecom.com • Интернет: www.cetecom.com
Страница 1 из 26
Результаты тестирования относятся только к отдельным элементам, которые были протестированы. Этот отчет не может быть воспроизведен по частям без
письменное разрешение испытательной лаборатории
© Авторские права: Все права защищены CETECOM
Отчет об испытаниях 6-0491-14-1-23f, страница 2 из 26
Оглавление
1. ОБЗОР РЕЗУЛЬТАТОВ ИСПЫТАНИЙ .......................................................................................... ............................ 3
1.1. Режим TX, обзор тестов FCC Часть 2.1091 и Канадские стандарты IC (RSS) ................................... .............. 3
1.2. Аттестация: ................................................ .................................................. .................................................. ... 3
2. АДМИНИСТРАТИВНЫЕ ДАННЫЕ .............................................. .................................................. ............................... 4
2.1. Идентификация испытательной лаборатории ............................................. .................................................. .............. 4
2.2. Место проведения испытаний ................................................ .................................................. .................................................. 4
2.3. Организационные вопросы ................................................ .................................................. ...................................... 4
2.4. Реквизиты заявителя ................................................ .................................................. ......................................... 4
2.5. Данные производителя ................................................ .................................................. ................................... 4
3. ИСПЫТАТЕЛЬНОЕ ОБОРУДОВАНИЕ (EUT) .......................................... .................................................. ..................... 5
3.1. ТЕХНИЧЕСКОЕ ОПИСАНИЕ ГЛАВНОГО ИО ........................................... .................................................. 5
3.2. EUT: тип, серийный номер и т. Д. И краткие описания, использованные в этом отчете об испытаниях ................................. ............................... 7
3.3. Вспомогательное оборудование (AE): тип, серийный номер и т. Д. И краткие описания .................................. ................................ 7
3.4. Установки EUT .............................................. ............................................................................. .......................... 8
3.5. Режимы работы EUT ............................................... .................................................. ..................................... 9
3.6. Конфигурация кабелей, используемых для тестирования ............................................ .................................................. ............ 10
4. ИЗМЕРЕНИЯ ............................................... ........................................................................................... ... 11
4.1. Оценка воздействия радиочастоты §2.1091 ............................................ .................................................. 11
4.2. Результаты по фиксированным и мобильным операциям ............................................ .................................................. ............ 13
4.3. Максимально допустимое усиление антенны для данной длины кабеля и потерь в печатной плате ...................................... ............... 19
4.4. Вывод о максимально допустимом усилении антенны, включая потери в печатной плате................................................... ...... 19
4.5. Погрешности измерения ................................................ .................................................. ............................ 20
5. СОКРАЩЕНИЯ, ИСПОЛЬЗУЕМЫЕ В ДАННОМ ОТЧЕТЕ ........................................... .................................................. .... 20
6. АККРЕДИТАЦИОННЫЕ ДАННЫЕ ЛАБОРАТОРИЙ И ИСПЫТАТЕЛЬНЫХ ПЛОЩАДЕЙ CETECOM ......................... 21
7. ПРИБОРЫ И ДОПОЛНИТЕЛЬНОЕ ОБОРУДОВАНИЕ .................................................................... ............................................ 22
7.1. Б / у оборудование «СТС» ............................................. .................................................. .................................... 22
Таблица приложения
Всего страниц
Приложение 1: Внешние фотографии EUT - отдельный документ TR6-0491-14-1-23-A1
Приложение 2: Внутренние фотографии EUT - отдельный документ TR6-0491-14-1-23-A2
Перечисленные приложения являются неотъемлемой частью данного отчета.
TR6-0491-14-1-23f
Отчет об испытаниях 6-0491-14-1-23f, страница 4 из 26
2.Административные данные
2.1. Идентификация испытательной лаборатории
Название компании:
Адрес:
CETECOM GmbH
Im Teelbruch 116
45219 Эссен - Кетвиг
Германия
Ответственный за испытательную лабораторию:
Дипл. Инж. Нильс Йес
Заместитель:
Дипл. Инж. Рашид Ачаркауи
2.2. Место проведения испытания
2.2.1. Испытательная лаборатория «СТС»
Название компании:
см. главу 2.1. Идентификация испытательной лаборатории
2.3. Организационные элементы
Ответственный за отчет об испытаниях:
Ответственный руководитель проекта:
Мартин Нунье
Дипл. Инж. К. Лоренц
Получение EUT:
2014-06-30
Дата (даты) испытания:
2014-06-30 по 2014-08-22
Дата отчета:
2014-09-15
-------------------------------------------------- -------------------------------------------------- -------------------------------------------------
Версия шаблона:
13.01
2.4. Реквизиты заявителя
Имя заявителя:
peiker acustic GmbH & Co. KG
Адрес:
Max-Planck-Straße 28-32
61381 Фридрихсдорф
Германия
Контактное лицо:
Г-н Филипп Сегуре
2.5. Реквизиты производителя
Название производителя:
пожалуйста, смотрите информацию о заявителе
Адрес:
пожалуйста, смотрите информацию о заявителе
TR6-0491-14-1-23f
Отчет об испытаниях 6-0491-14-1-23f, страница 5 из 26
3. Тестируемое оборудование (EUT)
3.1. ТЕХНИЧЕСКОЕ ОПИСАНИЕ ГЛАВНОГО ИО
Характеристики GSM
Основная функция
Тип
Диапазон частот GSM
(Группы из США / Канады)
Тип модуляции
Модуль GPRS / W-CDMA / LTE (NA-LTE NAD)
V1140-104
GSM 850: 824-849 МГц (восходящий канал), 869-894 МГц (нисходящий канал)
GSM1900: 1850-1910 МГц (восходящий канал), 1930-1990 МГц (нисходящий канал)
GSM, GPRS, GMSK
EGPRS-режим: 8-PSK
Количество каналов
GSM 850: 128 - 251, 125 каналов
(Группы из США / Канады)
GSM1900: 512-810, 300 каналов
Частоты тестового канала
GSM / E-GPRS Диапазон 850 МГц: канал 128/192/251
GSM / E-GPRS Диапазон 1900 МГц: канал 512/661/810
Обозначение выбросов
GSM850: 246 кг x Вт
EDGE850: 246 кг7 Вт
GSM1900: 246 кгXW
EDGE1900: 245 кг7 Вт
Тип антенны
 Интегрированный
 Внешний, без ВЧ-разъема
 Внешний, отдельный RF-разъем
Усиление антенны (заявленное заявителем) Информация о усилении отсутствует
МАКСИМАЛЬНАЯ выходная мощность [дБм]:
Провел GPRS 850: 32.1 (ПК)
31,9 (AV)
Проводимый EDGE 850: 29,6 (ПК)
26,4 (AV)
Проведено GPRS1900: 29,5 (ПК)
29,4 (AV)
Проведено EDGE1900: 28,8 (ПК)
25,6 (AV)
FCC-ID
QWY-ATM-T-132
Источник питания
 Питание от постоянного тока: 14,0 В
Специальные компоненты EMI
-Тип образца EUT
 Производство
 Подготовка к производству
 Инжиниринг
Наклейка FCC прикреплена
 да  нет
TR6-0491-14-1-23f
Отчет об испытаниях 6-0491-14-1-23f, страница 6 из 26
Характеристики W-CDMA:
TX-частотный диапазон
Тип модуляции
FDD Band V: 826,4-846,6 МГц (восходящий канал), 869-894 МГц (нисходящий канал)
FDD-Mode Release99: QPSK
FDD Mode Release 5 + 6: 16QAM дополнительно
FDD Band V: диапазон UARFCN 4132 - 4183 - 4233
Количество каналов
Возможность подключения UMTS-HSPA
Тестовые каналы
Группа V
Обозначение выбросов
Тип антенны
Усиление антенны
МАКСИМАЛЬНАЯ выходная мощность [дБм]:
Проведенный
FDD-режим 5
 Скорость восходящего канала: 5.76 Мб / с (категория 6)
 Скорость восходящего канала:
Канал 4132
Канал 4183
Канал 4233
РЕЖИМ FDD V: 4M17F9W
 Интегрированный
 Внешний, без ВЧ-разъема
 Внешний, отдельный RF-разъем
Нет информации о приросте
26,6 (ПК)
22,9 (AV)
Характеристики LTE:
TX-частотный диапазон
(Рабочие диапазоны E-UTRA)
Тип модуляции
Скорость передачи данных
Количество каналов
- Таблица 5.4.4-1 соглас. 3GPP
TS36.521-1
Обозначение выбросов
LTE-режим 5
Диапазон LTE 5: 824-849 МГц (восходящий канал), 869-894 МГц (нисходящий канал)
Диапазон LTE 7: 2500 - 2570 МГц (восходящий канал), 2620 - 2690 МГц (нисходящий канал)
QPSK, 16-QAM
Cat3, нисходящий канал: макс.100 Мбит / с, восходящий канал: макс. 50 Мбит / с
LTE Band 5: диапазон UARFCN 20400-20649
См. Примечание о каналах
Диапазон LTE 7: диапазон UARFCN 20750 - 21449
не использоваться
в зависимости от канала
пропускная способность
Канал
Модуляция QPSK:
Модуляция 16-QAM
пропускная способность
1,4 МГц
1M08G7D
1M07W7D
3 МГц
2М68Г7Д
2M68W7D
5 МГц
4М46Г7Д
4M46W7D
10 МГц
8М92Г7Д
8M92W7D
LTE-режим 7
5 МГц
4М46Г7Д
4M47W7D
10 МГц
8М94Г7Д
8M94W7D
15 МГц
13М3Г7Д
13M3W7D
20 МГц
17М8Г7Д
17M8W7D
Тип антенны
 Интегрированный
 Внешний, без ВЧ-разъема
 Внешний, отдельный RF-разъем: основной TX + вторичный RX разъем
Коэффициент усиления антенны (заявленный заявителем) Нет информации от заказчика
МАКСИМАЛЬНАЯ выходная мощность [дБм]:
Проведенный
LTE-режим 5
28.85 (ПК)
22,42 (AV)
LTE-режим 7
TR6-0491-14-1-23f
29.01 (ПК)
23.11 (АВ)
Отчет об испытаниях 6-0491-14-1-23f, страница 7 из 26
3.2. EUT: тип, серийный номер и т. Д. И краткие описания, используемые в этом отчете об испытаниях.
короткий
описание * 1)
EUT
Тип
S / N
серийный номер
(IMEI)
HW
аппаратное обеспечение
положение дел
ЮЗ
статус программного обеспечения
EUT A
GSM / W-CDMA / LTE
Банкомат-01 T1-RoW-4G
Устройство * 2)
0000500312
(351

-000078-6) 202.005.005 001.014.004 EUT B GSM / W-CDMA / LTE Банкомат-01 T1-RoW-4G Устройство * 2) 0000500309 (351

-000068-7) 202.005.005 001.014.004 Примечание: * 1) Краткое описание EUT используется для упрощения идентификации EUT в этом отчете об испытаниях.* 2) EUT, содержащее беспроводной модуль LTE-NAD V1140-104 3.3. Вспомогательное оборудование (AE): тип, серийный номер и т. Д. И краткие описания AE короткая описание *) Вспомогательное оборудование Тип S / N серийный номер AE 1 Громкоговоритель KL3 / 4 Ом - - - AE 2 Микрофон Мне 39 - - - AE 3 Антенна TRX установлен на земле самолет Антенна Fender от Hirschmann - - - - - - - - - AE 4 AE 5 Антенна DRX установлен на земле самолет Антенна GPS установлен на земле самолет HW ЮЗ статус оборудования статус программного обеспечения 920325-102 Бамперный телефон антенна от Hirschmann 920337-101 Навилок NL-69AT *) Краткое описание AE используется для упрощения идентификации вспомогательного оборудования в этом отчете об испытаниях.TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 8 из 26 3.4. Установки EUT Настройка EUT нет.*) Комбинация EUT и AE Замечания установленный. 1 EUT A + AE 1 + AE 2+ AE 3+ AE 4 + AE 5 Настройка для испытаний на излучение, результаты не используются в этом отчете. Пожалуйста. см. комментарий к глава 4.1.4 установленный. 2 EUT B + AE 1 + AE 2+ AE 3+ AE 4 + AE 5 Настройка для испытаний на излучение, результаты не используются в этом отчете. Пожалуйста. см. комментарий к Глава 4.1.4 установленный. 3 EUT A + AE 1 + AE 2 Настройка для проведенных тестов, результаты не используются в этом отчете.Пожалуйста. см. комментарий к глава 4.1.4. установленный. 4 EUT B + AE 1 + AE 2 Настройка для проведенных тестов, результаты не используются в этом отчете. Пожалуйста. см. комментарий к глава 4.1.4. *) № наладки EUT. используется для упрощения идентификации установки EUT в этом отчете об испытаниях. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 9 из 26 3.5. Режимы работы EUT EUT действующий № режима *) op. 1 op. 2 op. 3 op. 4 op. 5 Описание режимы работы Дополнительная информация GPRS 850 Между мобильной станцией и тестируемой установкой устанавливается связь. Режим ТКП симулятор.Преобразователь работает с максимальной номинальной мощностью. TCH = 128/192/251 мощность: 33 дБм (класс мощности 4; уровень управления мощностью 5). USF_Duty CYCLE установлен на 100%, схема кодирования CS-1 для модуляции GMSK, слот 3 активен, Гамма восходящего канала: 3 (33 дБм). Входной сигнал приемника модулируется нормальной тестовой модуляцией. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь. EGPRS 850 Между мобильной станцией и тестируемой установкой устанавливается связь. Режим ТКП симулятор.Преобразователь работает с максимальной номинальной мощностью. TCH = 128/192/251 мощность: 33 дБм (класс мощности 4; уровень управления мощностью 5). USF_Duty CYCLE установлен на 100%, схема кодирования MCS-5 для модуляции 8PSK, слот 3 активен, Гамма восходящего канала: 6 (27 дБм). Входной сигнал приемника модулируется нормальной тестовой модуляцией. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь. GPRS 1900 Между мобильной станцией и тестируемой установкой устанавливается связь. Режим ТКП симулятор.Преобразователь работает с максимальной номинальной мощностью. TCH = 512/661/810 мощность: 30 дБм (класс мощности 1; уровень управления мощностью 0). USF_Duty CYCLE установлен на 100%, схема кодирования CS-1 для модуляции GMSK, слот 3 активен, Гамма восходящего канала: 3 (30 дБм). Входной сигнал приемника модулируется нормальной тестовой модуляцией. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь EGPRS 1900 Между мобильной станцией и тестируемой установкой устанавливается связь. Режим ТКП симулятор.Передатчик работает с максимальной номинальной выходной мощностью: PCL = 0 (макс. 30 дБм (класс мощности 1; уровень управления мощностью 0). USF_Duty CYCLE установлен на власть) 100%, схема кодирования MCS-5 для модуляции 8-PSK, слот 3 активен, восходящий канал TCH = 512/661/810 гамма: 5 (26 дБм). Входной сигнал приемника модулируется нормальной тестовой модуляцией. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь FDD режим V Линия связи устанавливается между мобильной станцией (UE) и тестовый тренажер.Преобразователь работает на максимальной номинальной мощности. RMC99-режим класс мощности: 24 дБм. Входной сигнал приемника модулируется нормальной тестовой модуляцией. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь в соответствии с таблицей E5.1 / Таблица E5.1A, как описано в 3GPP TS34.121, Приложение E. op. 6 LTE-диапазон 5 Режим RMC op. 7 LTE-диапазон 7 Режим RMC Линия связи устанавливается между мобильной станцией (UE) и тестовый тренажер.Преобразователь работает на максимальной номинальной мощности. класс мощности: номинальная 23 дБм. Входной сигнал приемника модулируется нормальной тестовой модуляцией: QPSK или модуляция 16-QAM. Уровень полезного входного РЧ-сигнала на приемник мобильной станции устанавливается до уровня, обеспечивающего стабильную связь. *) № режима работы EUT. используется для упрощения протокола испытаний. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 10 из 26 3.6. Конфигурация кабелей, используемых для тестирования Кабель количество Элемент Тип S / N серийный номер HW состояние оборудования Длина кабеля Кабель 1 Антенная линия TRX - - - 2.70 кв.м. Кабель 2 Антенная линия DRX - - - 4,00 м Кабель 3 Уменьшенный жгут проводов - - - 1,80 м TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 11 из 26 4. Измерения 4.1. Оценка воздействия радиочастоты §2.1091 4.1.1. Место проведения испытаний и оборудование (номера позиций см. В главе «Список испытательного оборудования») место проведения испытаний  CETECOM Essen (Глава 2.2.1)  См. Главу. 2.2.2 Для оценки инструменты не нужны. Результаты определяются расчетным путем.  См. Главу. 2.2.3 4.1.2. Требования FCC: §1.1310 FCC § 2.1091 Микросхема RSS-102 Выпуск 4 Критерии, используемые для оценки воздействия радиочастотного излучения на человека, приведены в таблице 1 согласно FCC. §1.1310 и глава 4.2 таблицы стандарта RSS-102, и он подлежит оценке радиочастотного воздействия до авторизация оборудования. Поскольку мобильное оборудование разрешено в соответствии с Частью 22 (Подчасть H) и Частью 24 Правил FCC, оно подлежит для оценки воздействия радиочастотного излучения до получения разрешения на оборудование. Дополнительную информацию об оценке соответствия этим ограничениям можно найти в бюллетене FCC OST / OET. Номер 65, «Оценка соответствия требованиям Федеральной комиссии связи США по воздействию радиочастоты на человека. Радиация.’’ Для целей этих требований мобильные устройства определяются FCC как передатчики, предназначенные для использования. в других местах, кроме фиксированных, и, как правило, использоваться таким образом, чтобы расстояние разделения не менее 20 сантиметры обычно сохраняются между излучающими структурами и телом пользователя или находящихся поблизости людей. Эти устройства обычно оцениваются на предмет потенциального воздействия по отношению к пределам ПДВ, приведенным в таблице 1. Приложения А. «..Излагает требования и методы измерения, используемые для оценки радиочастотного (РЧ) воздействия. соответствие устройств радиосвязи, предназначенных для использования в непосредственной близости от человеческого тела » Таблица 1: ПРЕДЕЛЫ МАКСИМАЛЬНО ДОПУСТИМОГО ВОЗДЕЙСТВИЯ (ПДВ) Диапазон частот [МГц) 30–300 300–1500 1500–100 000 0.3 - 1,34 1,34 - 30 30–300 300–1500 1500 - 100,0 Напряженность электрического поля Напряженность магнитного поля Плотность Powe [В / м] [Являюсь] [мВт / см²] 61,4 0,163 1.0 f / 300 (B) Пределы для населения в целом / неконтролируемого воздействия 614 1,63 * (100) 824 / ж 2,19 / ж * (180 / f²) 27,5 0,073 0,2 f / 1500 1.0 Время усреднения [минуты] 30 30 30 30 30 Для данного предела плотности мощности на одной частоте (согласно Таблице 1 Пределы) максимальное усиление антенны может быть рассчитано. Используемое уравнение для прогнозирования плотности мощности в дальней зоне одной излучающей антенны может быть выполнено следующим образом: следующее уравнение: S EIRP P  G  4R 2 4R 2 GNUMERIC  S  4R 2 TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 12 из 26 4.1.3. Общие ограничения: FCC: FCC: §1.1307 FCC §1.1307 FCC §1.1310 Сотовая радиотелефонная служба (подраздел H части 22) Антенны, не устанавливаемые в зданиях: высота над уровнем земли до самой нижней точки антенны <10 м и общая мощность всех каналов> 1000 Вт ERP (1640 Вт EIRP) Услуги персональной связи (часть 24) Широкополосная АСУ ТП (подраздел E): антенны, не устанавливаемые в здании: высота над уровнем земли до самой нижней точки антенна <10 м и общая мощность всех каналов> 2000 Вт ERP (3280 Вт EIRP) ПРЕДЕЛЫ МАКСИМАЛЬНО ДОПУСТИМОГО ВОЗДЕЙСТВИЯ (ПДВ) Таблица 1 (B) Пределы для населения в целом / неконтролируемого воздействия 300–1500 МГц: f / 1500 мВт / см² 1500–100 000 МГц: 1.0 мВт / см² FCC §2.1091 Регулярная оценка требуется, если устройство работает на частотах 1,5 ГГц или ниже и их эффективная излучаемая мощность (ERP) составляет 1,5 Вт или более, или если они работают на частотах выше 1,5 ГГц и их ERP составляет 3 Вт и более. FCC §24.232 (a) Базовые станции ограничены пиковой эквивалентной изотропно излучаемой мощностью 1640 Вт (э.и.и.м.) с высота антенны до 300 метров HAAT. б) Мобильные / портативные станции ограничены до 2 Вт э.и.и.м. Пиковая мощность, … FCC §22.913 (а) Максимальный ERP. Эффективная излучаемая мощность (ERP) базовых передатчиков и сотовых ретрансляторов не должна превышают 500 Вт. ERP мобильных передатчиков и вспомогательных тестовых передатчиков не должен превышать 7 Вт. FCC §27.50 (С) (10) (10) Переносные станции (портативные устройства) ограничены до 3 Вт ERP. Федеральная комиссия связи, §27.50 (d) (4) Фиксированные, мобильные и переносные (переносные) станции, работающие в диапазоне 1710-1755 МГц, ограничены 1 ватт EIRP. Федеральная комиссия связи, §27.50 (h) (2) Мобильные и другие пользовательские станции. Количество мобильных станций ограничено 2.0 Вт EIRP. Все пользовательские станции ограничены до 2,0 Вт выходная мощность передатчика. 4.1.4. Метод измерения Действительно для режима GSM / GPRS / EDGE: • Мощность тестировалась на 3 частотах (самая низкая / средняя / самая высокая) в каждом рабочем диапазоне, и результаты по сравнению с заявленными заявителями значениями мощности (информация о настройке). • Были измерены средняя пакетная мощность (мощность слота) и пиковая (см. Отдельный отчет для GSM / GPRS / E-GPRS). технология) • Был измерен только один слот восходящей линии связи (1 TX). Для этого устройства максимально возможны 4 слота TX, которые рассчитываются как худший случай • Коэффициент коррекции рабочего цикла 10 * log10 (макс.количество возможных активных слотов / 8 слотов). В следующих таблицах приведены расчеты, основанные на информации о настройке заявителей (документ LTENAD_V1140-104_Tune_Up_Information, Rev. 1.0, от 2014-07-02, внутренний идентификатор продукта: 2189-140104-xx) для значений мощности. Также рассчитано максимально допустимое усиление антенны для показанного приложения, не превышающее MPE. лимит для фиксированных и мобильных операций. Действительно для режима W-CDMA / LTE: • Мощность проверялась на 3 частотах (самая низкая / средняя / самая высокая) в каждом рабочем диапазоне FDD (см. Отдельные отчет по технологии W-CDMA) и сравнение результатов с заявленными заявителем значениями мощности (информация о настройке).Использовался среднеквадратичный детектор. • Поправочный коэффициент рабочего цикла не применяется. В следующих таблицах приведены расчеты, основанные на информации о настройке заявителей (документ LTENAD_V1140-104_Tune_Up_Information, Rev. 1.0, от 2014-07-02, внутренний идентификатор продукта: 2189-140104-xx) для значений мощности. Также рассчитано максимально допустимое усиление антенны для показанного приложения, не превышающее MPE. лимит для фиксированных и мобильных операций. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 13 из 26 4.2. Результаты по фиксированным и мобильным операциям 4.2.1. Результаты для нижнего рабочего диапазона: GSM850, WCDMA Band V и LTE Band 5 4.2.1.1. Результаты MPE Для расчета MPE потери в печатной плате и на внешнем тракте учитываются в соответствии с предоставленной информацией заявитель. Считается, что минимальная длина кабеля составляет 1 м, поскольку она приводит к максимальному значению MPE. Значение потерь на трассе составляет 1,2 дБ в этом случае. Операционная Режим GSM / GPRS (ПК) GSM / GPRS (Средняя мощность импульса) Частота на канале Заявлено m axim um проведенный выход власть (МГц) (дБм) 824.2 32,50 Максимум. Максим эм Объявленная пошлина Эквивалент положительный выходной цикл мощности Максимальный кондуктивный выход толерантность (заявлено + проведенный власть согласно Настройка) выход (м аксим эм м производитель власть кондуктивный выход мощность вкл. рабочий цикл) (дБ) (дБм) [W] (м Вт) 34.00 1255,94 837 32,50 2,5119 1255,94 848,8 32,50 34.00 2,5119 1255,94 824,2 32,50 34.00 2,5119 1255,94 2,5119 1255,94 2,5119 1255,94 0,7943 397,16 0,7943 397,16 0,7943 397,16 0,7943 397,16 0,7943 397,16 1,50 34.00 2,5119 837 32,50 848,8 32.50 34.00 824,2 26,50 29.00 837 26,50 848,8 26,50 29.00 824,2 26,50 29.00 837 26,50 848,8 26,50 29.00 0,7943 397,16 WCDMA FDD Band 5 (Среднеквадратичное значение) 826,4 23.00 25.00 0,3162 316,23 836,4 23.00 25.00 0,3162 316,23 846,6 23.00 25.00 0,3162 316,23 LTE Band 5 (QPSK, # RB = 1, RMSValue) 824,7 23.00 25.00 0,3162 316,23 836,5 23.00 25.00 0,3162 316,23 848,3 23.00 25.00 0,3162 316,23 LTE Band 5 (16QAM, # RB = 1, RMS-значение) 824,7 23.00 25.00 0,3162 316,23 836,5 23.00 25.00 0,3162 316,23 848,3 23.00 0,3162 316,23 КРАЙ (ПК) КРАЙ (Сред.2] Примечание: на основе усиления антенны 0 дБд и дополнительных потерь на тракте 1,2 дБ. Канадский стандарт RSS-102 требует значение радиочастотного воздействия в единицах Вт / м2:, поэтому значение определяется в Единицу измерения мВт / см2 следует умножить на 10, чтобы получить требуемую единицу. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 14 из 26 4.2.1.2. Максимум. расчет усиления антенны На основе действующих лимитов ERP / EIRP и макс. MPE - максимальное усиление антенны, которое можно использовать для рассчитывается конкретное приложение. Рекомендации по максимальному усилению антенны для работы фиксированной / мобильной связи для соблюдения ограничений: POUT Максимальная подача мощности на RF-Pad от модуля, вкл.Продолжительность включения [мВт]: (Средн. Импульсная мощность или среднеквадратичное значение) 1255,94 Аттен-Pad Затухание - потеря в тракте магистрали ATM / печатная плата [дБ] -0,7 Аттен / м Затухание для длины кабеля на 1 м [дБ] -0,5 Длина Длина кабеля между RF-Port EUT и излучающим элементом [м] (информация от заявителя) 1.0 2,4 3.9 AttenC Затухание для конкретной длины кабеля [дБ] -0,50 -1,20 -1,95 Брюки Полученная мощность на входе антенны [мВт] 952,73 810,91 682,29 Безопасное расстояние [см]: 20.00 Предел ПДВ в соотв. §1.1310 и RSS-102 для неконтролируемого воздействия [мВт / см²]: (FCC использует мВт / см², а IC - Вт / м²) 0.55 G1 Максимальное усиление антенны для соответствия пределу MPE [дБи]: 4,62 5,32 6,07 (Для G1 самый низкий измеряемый канал для достижения минимального значения мурав. Усиление выбрано) Предел мощности ERP согласно §2.1091 [Вт]: (Средн. Импульсная мощность или среднеквадратичное значение) G2 Максимум. Коэффициент усиления антенны должен соответствовать пределу, вкл. Рабочий цикл [дБи]: 1,50 4,12 4.82 5,57 7,75 8,45 9.20 4,12 4.82 5,57 1,97 2,67 3,42 (Для G2 выберите макс. Среднюю импульсную мощность или среднеквадратичное значение, включая рабочий цикл) Предел мощности ERP согласно §22.913 [W ERP]: G3 Максимум. Коэффициент усиления антенны должен соответствовать пределу [дБи]: 7.00 (Для G3 выберите максимальное значение средней импульсной мощности без учета рабочего цикла) G 850 МГц-диапазон Суммарно полученные результаты: TR6-0491-14-1-23f Мин. (G1, G2, G3) [дБи] Макс. муравей. усиление для мобильной работы в диапазоне 850 МГц для соответствия MPE и Ограничения ERP, вкл. Потери на внешнем тракте для приложения show n не должны превышать [дБд]: Отчет об испытаниях 6-0491-14-1-23f, страница 15 из 26 4.2.2. Результаты для верхнего рабочего диапазона: GSM1900 4.2.2.1. Результаты MPE Для расчета MPE потери в печатной плате и на внешнем тракте учитываются в соответствии с предоставленной информацией заявитель.Считается, что минимальная длина кабеля составляет 1 м, поскольку она приводит к максимальному значению MPE. Значение потерь на трассе составляет 1,9 дБ в этом случае. Операция Режим Частота на канале GSM / GPRS (PK-Burst ценить) GSM / GPRS (Вспышка AV Власть) Заявлено m axim um проведенный выход власть Максимум. положительный толерантность согласно м производитель Заявлено m axim um выходная мощность (Измерено + Настройка) (МГц) (дБм) (дБ) (дБм) 1850,2 29,5 31.00 1880,0 29,5 31.00 1909,8 29,5 31.00 1850,2 29,5 31.00 1880,0 29,5 1909,8 29,5 31.00 28.00 КРАЙ (PK-Burst ценить) 1850 г.2 25,5 1880,0 25,5 1909,8 КРАЙ (Вспышка AV Власть) 1850,2 1880,0 25,5 1909,8 25,5 1,50 1,50 2,50 31.00 28.00 Рабочий цикл 50% 50% 50% Заявлено Эквивалент Максим эм кондуктивный выход проводимая мощность (макс. мкм выходная мощность кондуктивный выход мощность х долг цикл) (м Вт) (Вт) 1,259 629,46 1,259 629,46 1,259 629,46 1,259 629,46 1,259 629,46 1,259 629,46 0,631 315,48 0,631 315,48 25,5 28.00 0,631 315,48 25,5 28.00 0,631 315,48 0,631 315,48 0,631 315,48 2,50 28.00 28.00 50% Максимальное расчетное значение ПДВ: MPE-Lim это: [мВт / см ^ 2] Наивысший ПДВ ценить: 0.2] Примечание: на основе усиления антенны 0 дБи и дополнительных потерь на трассе 1,9 дБ Канадский стандарт RSS-102 требует значение радиочастотного воздействия в единицах Вт / м2:, поэтому значение определяется в Единицу измерения мВт / см2 следует умножить на 10, чтобы получить требуемую единицу. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 16 из 26 4.2.2.2. Максимум. расчет усиления антенны На основе действующих лимитов ERP / EIRP и макс. MPE - максимальное усиление антенны, которое можно использовать для рассчитывается конкретное приложение. Рекомендации по максимальному усилению антенны для работы на фиксированной дистанции и дальности полета с учетом ограничений: POUT Максимальная подача мощности на RF-Pad от модуля, вкл.Рабочий цикл (мВт): (Средн. Импульсная мощность или среднеквадратичное значение) 629 Аттен-Pad Затухание - потеря в тракте магистрали ATM / печатная плата [дБ] -1,0 Аттен / м Затухание для длины кабеля на 1 м [дБ] -0,9 Длина Длина кабеля между RF-Port EUT и излучающим элементом [м] (информация от заявителя) 1.0 2,4 3.9 AttenC Затухание для конкретной длины кабеля [дБ] -0,9 -2,2 -3,5 Брюки Полученная мощность на входе антенны [мВт] 406 304 223 Безопасное расстояние [см] Предел ПДВ в соотв. §1.1310 и RSS-102 для неконтролируемого воздействия (мВт / см²): (FCC использует мВт / см², а IC - Вт / м²) 1.00 1,00 1,00 G1 Максимальное усиление антенны для соответствия пределу MPE (дБи): 10,92 12,18 13,53 10,83 12.09 3,91 5,17 5,52 3,91 5,17 5,52 3,91 5,17 5,52 20 (Для G1 самый низкий измеряемый канал для достижения минимального значения мурав. Усиление выбрано) Предел мощности ERP согласно §2.1091 [Вт]: (Средн. Импульсная мощность или среднеквадратичное значение) G2 Максимум. Усиление антенны для соответствия этому пределу, вкл. Рабочий цикл (дБи): 3,00 13,44 (Для G2 выберите макс. Среднюю импульсную мощность или среднеквадратичное значение, включая рабочий цикл) Предел мощности EIRP согласно §24.232 [Вт]: G3 Максимум. Усиление антенны для соответствия этому пределу (дБи): 2.00 (Для G3 выберите максимальное значение средней импульсной мощности без учета рабочего цикла) G диапазон 1900 МГц Суммарно полученные результаты: TR6-0491-14-1-23f Мин. (G1, G2, G3) (дБи) Макс. муравей. усиление для мобильной работы в диапазоне 1900 МГц для соответствия MPE и EIRP лимиты вкл. Потери на внешнем тракте для показанного приложения не должны превышать (дБи): Отчет об испытаниях 6-0491-14-1-23f, страница 17 из 26 4.2.3.Результаты для верхнего рабочего диапазона: LTE Band 7 4.2.3.1. Результаты MPE Для расчета MPE потери в печатной плате и на внешнем тракте учитываются в соответствии с предоставленной информацией заявитель.Считается, что минимальная длина кабеля составляет 1 м, поскольку она приводит к максимальному значению MPE. Значение потерь на трассе составляет 2,2 дБ в этом случае. Операция Режим Частота на канале Заявлено m axim um проведенный выход власть (МГц) Максимум. положительный толерантность согласно м производитель Заявлено m axim um выходная мощность (Измерено + Настройка) (дБ) (дБм) Рабочий цикл (дБм) LTE Band 7 (QPSK, # 1RB, RMS-значение) LTE Band 7 (16QAM, # 1RB, RMS-значение) 2502,5 23.00 25.00 2535,0 23.00 2567,5 23.00 25.00 2502,5 23.00 25.00 2535,0 23.00 2567,5 23.00 2.2] Примечание: на основе усиления антенны 0 дБи и дополнительных потерь на тракте 2,2 дБ. Канадский стандарт RSS-102 требует значение радиочастотного воздействия в единицах Вт / м2:, поэтому значение определяется в Единицу измерения мВт / см2 следует умножить на 10, чтобы получить требуемую единицу. TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 18 из 26 4.2.3.2. Максимум. расчет усиления антенны На основе действующих лимитов ERP / EIRP и макс. MPE - максимальное усиление антенны, которое можно использовать для рассчитывается конкретное приложение. Рекомендации по максимальному усилению антенны для работы на фиксированной дистанции и дальности полета с учетом ограничений: POUT Максимальная подача мощности на RF-Pad от модуля, вкл.Рабочий цикл (мВт): (Средн. Импульсная мощность или среднеквадратичное значение) 316 Аттен-Pad Затухание - потеря в тракте магистрали ATM / печатная плата [дБ] -1,2 Аттен / м Затухание для длины кабеля на 1 м [дБ] -1,0 Длина Длина кабеля между RF-Port EUT и излучающим элементом [м] (информация от заявителя) 1.0 2,4 3.9 AttenC Затухание для конкретной длины кабеля [дБ] -1,0 -2,4 -3,9 Брюки Полученная мощность на входе антенны [мВт] 191 138 98 Расстояние (см): 20 Предел ПДВ в соотв. §1.1310 и RSS-102 для неконтролируемого воздействия (мВт / см²): (FCC использует мВт / см², а IC - Вт / м²) 1.00 G1 Максимальное усиление антенны для соответствия пределу MPE (дБи): 14.21 15,61 17.11 (Для G1 самый низкий измеряемый канал для достижения минимального значения мурав. Усиление выбрано) Предел мощности ERP согласно §2.1091 [Вт]: (Средн. Импульсная мощность или среднеквадратичное значение) G2 Максимум. Усиление антенны для соответствия этому пределу, вкл. Рабочий цикл (дБи): 3,00 14,12 15,52 17.02 10.21 11,61 13.11 10.21 11,61 13.11 10.21 11,61 13.11 (Для G2 выберите макс. Среднюю импульсную мощность или среднеквадратичное значение, включая рабочий цикл) Предел мощности EIRP согласно §27.50h (h) [Вт]: G3 Максимум. Усиление антенны для соответствия этому пределу (дБи): 2.00 (Для G3 выберите максимальное значение средней импульсной мощности без учета рабочего цикла) G Диапазон 1700 МГц Суммарно полученные результаты: TR6-0491-14-1-23f Мин. (G1, G2, G3) (дБи) Макс. муравей. усиление для мобильной работы в диапазоне 2600 МГц для соответствия MPE и Пределы EIRP, вкл. Потери на внешнем тракте для показанного приложения не должны превышать (дБи): Отчет об испытаниях 6-0491-14-1-23f, страница 19 из 26 4.3. Максимально допустимое усиление антенны для данной длины кабеля и потерь в печатной плате Длина кабеля согласно представленному применению: 1 метр 2,4 метра 3.9 метров Максимум. Усиление в нижнем рабочем диапазоне (850 МГц) [дБд] 1,97 дБд 2,67 дБд 3,42 дБд Максимум. Усиление в более высоком рабочем диапазоне (1900 МГц) [дБи] 3,91 дБи 5,17 дБи 5,52 дБи Максимум. Усиление в более высоком рабочем диапазоне (2600 МГц) 10,21 дБи 11,61 дБи 13,11 дБи [дБи] Примечание: расчеты не включают другие, возможно, расположенные поблизости вторые передатчики (совместное размещение) 4.4. Вывод о максимально допустимом усилении антенны, включая потери в печатной плате Максимум. Усиление в нижнем рабочем диапазоне (850 МГц) [дБд] 1,47 дБд (3,62 дБи) Максимум. Усиление в более высоком рабочем диапазоне (1900 МГц) [дБи] 3.01 дБи Максимум. Усиление в более высоком рабочем диапазоне (2600 МГц) 9,21 дБи [дБи] Примечание: расчеты не включают другие, возможно, расположенные поблизости вторые передатчики (совместное размещение) TR6-0491-14-1-23f Отчет об испытаниях 6-0491-14-1-23f, страница 20 из 26 4.5. Погрешности измерения Сообщенные неопределенности рассчитываются на основе стандартной неопределенности, умноженной на соответствующую коэффициент охвата k, при котором достигается уровень достоверности приблизительно 95%. Для определения погрешности учитывались все компоненты конкретной измерительной установки. и это вклад в общую неопределенность согласно рассчитанному статистическому распределению.В следующей таблице показаны ожидаемые погрешности для каждого типа выполненных измерений. RF-измерения Диапазон частот Расчетная погрешность на основе на уровне уверенности 95% Примечания: Выходная мощность проведена Излучаемая мощность Кондуктивные излучения на портах антенны 9 кГц .. 20 ГГц 30 МГц .. 4 ГГц 9 кГц .. 20 ГГц 150 кГц .. 30 МГц 30 МГц .. 1 ГГц 1 ГГц .. 20 ГГц 9 кГц .. 4 ГГц 1.0 дБ 3,17 дБ 1.0 дБ 5,0 дБ 4,2 дБ 3,17 дБ 0,1272 частей на миллион (дельта-маркер) -Метод подстановки -Магнитное поле Электронное поле Метод подстановки Ошибка частоты 1.0 дБ 0,1272 частей на миллион (дельта-маркер) 1.0 дБ 0,0636 частей на миллион 4,0 дБ 3,6 дБ Власть Ошибка частоты Власть --- Корпус для излучаемых выбросов Занятая полоса пропускания 9 кГц .. 4 ГГц Пропускная способность излучения Стабильность частоты Проведенные выбросы на порте сети переменного тока (UCISPR) 9 кГц .. 20 ГГц 9 кГц .. 150 кГц 150 кГц .. 30 МГц Таблица: погрешности измерения, действительные для кондуктивных / излучаемых измерений 5. Сокращения, использованные в этом отчете. Сокращения ANSI AV, AVG, CAV EIRP EGPRS EUT FCC IC нет данных Операционный режим ПК RBW РФ RSS Rx ТКП Tx QP VBW ERP TR6-0491-14-1-23f Американский национальный институт стандартов Детектор среднего Эквивалентная изотропно излучаемая мощность, определяемая в рамках отдельного измерения Расширенная служба пакетной радиосвязи общего назначения Тестируемое оборудование Федеральная комиссия связи США Промышленность Канады непригодный Режим работы оборудования Пик полоса разрешения Радиочастота Спецификация радиостандартов, документы Министерства промышленности Канады Получатель Канал трафика Передатчик Квазипиковый детектор Пропускная способность видео Эффективная излучаемая мощность Отчет об испытаниях 6-0491-14-1-23f, страница 21 из 26 6.Детали аккредитации лабораторий и испытательных центров CETECOM Ref. No. Аккредитация Сертификат D-PL12047-01-01 Действительно для лабораторной или испытательной площадки Все лаборатории и испытательные центры CETECOM GmbH, Эссен 337 Измерения излучения от 30 МГц до 1 ГГц, 3 м / 10 м (OATS) 487 Измерения излучения от 30 МГц до 1 ГГц, 3 м (SAR) 558 736496 Измерения излучаемого излучения на частотах выше 1 ГГц, 3 м (FAR) 348 Сетевые порты Измерения проводимых помех 348 Измерение помех на телекоммуникационных портах. 337 3462D-1 Измерения излучения от 30 МГц до 1 ГГц, 3 м / 10 м (OATS) 487 3462D-2 Измерения излучения от 30 МГц до 1 ГГц, 3 м (SAR) 550 3462D-2 Измерения излучения от 1 ГГц до 6 ГГц, 3 м (SAR) 558 3462D-3 Измерения излучаемого излучения на частотах выше 1 ГГц, 3 м (FAR) 487 R-2666 Измерения излучения от 30 МГц до 1 ГГц, 3 м (SAR) 550 G-301 Измерения излучения от 1 ГГц до 6 ГГц, 3 м (SAR) 348 С-2914 Сетевые порты Измерения проводимых помех 348 Т-1967 Измерение помех на телекоммуникационных портах.OATS = открытая площадка для испытаний, SAR = полубезэховая комната, FAR = полностью безэховая комната TR6-0491-14-1-23f Орган по аккредитации DAkkS, Deutsche Akkreditierungsstelle GmbH FCC, Федеральная связь Комиссия Лабораторный отдел, США (MRA US-EU 0003) IC, Сертификация Министерства промышленности Канады и инженерное бюро VCCI, Добровольный контрольный совет за информационное вмешательство Технологическое оборудование, Япония Отчет об испытаниях 6-0491-14-1-23f, страница 22 из 26 7. Инструменты и вспомогательное оборудование 7.1. Б / у оборудование «СТС» «Справочный номер» в левом столбце следующих таблиц позволяет однозначно идентифицировать лабораторию. оборудование.Реф. № 7.1.1. Тестовое программное обеспечение и прошивка оборудования Оборудование 001 012 013 017 053 119 140 261 262 263 264 Приемник EMI Test Генератор сигналов (EMS-конд.) Измеритель мощности (УСЛ. Усл.) Цифровой тестер радиосвязи Аудио анализатор Анализатор гармоник RT dig. Фликерметр Генератор сигналов Датчик тепловой мощности Сил-о-Метр Генератор сигналов Анализатор спектра ESS SMY 01 НРВД CMD 60 M UPA3 B10 СМХУ NRV-Z55 NRV-S SMP 04 ФСЕК 30 825132/017 839069/027 839111/003 844365/014 860612/022 G60547 831314/006 825083/0008 825770/0010 826190/0007 826939/005 295 Набор для тестирования цифрового радио Racal 6103 1572 298 Univ.Тестер радиосвязи CMU 200 832221/091 323 331 335 340 355 365 366 371 377 378 383 389 Цифровой тестер радиосвязи Климатическая испытательная камера -40 / + 80 Град. CTC-EMS-Проведено Цифровой тестер радиосвязи Сил-о-Метр Вставка 10 В, 50 Ом Ультракомпактный симулятор Bluetooth-тестер Приемник EMI Test Широкополосный радиочастотный монитор поля Генератор сигналов Цифровой мультиметр CMD 55 HC 4055 Проведена СЭМ системы CMD 55 URV 5 URV5-Z2 UCS 500 M4 CBT32 ESCS 30 RadiSense III МСБ 03 Кейтли 2000 825878/0034 43146 849709/037 8/027 100880 V0531100594 100153 100160 03D00013SNO-08 842 828/034 0583926 392 Тестер радиосвязи MT8820A 6K00000788 436 Univ.Тестер радиосвязи CMU 200 103083 441 442 Потери в кабеле CTC-SAR-EMI CTC-SAR-EMS 443 CTC-FAR-EMI-RSE Spuri 7.2.5 или EMC 32 Ver. 8,53 444 Поле CTC-FAR-EMS Поле EMI ​​системы (SAR) Поле системы EMS (SAR) Система CTC-FAR-EMIRSE Система-EMS-Поле (FAR) Фирма = 1,21, OTP = 2,0, GRA = 2,0 Фирма = V 2.02 Фирма. = V 1.51 Прошивка = V 3.52. 22.01.99, DECT = D2.87 13.01.99 Фирма. V 4.3 Фирма = V 3.1DHG Фирма = 3,21 СППЗУ-Дата 02.12.04, ГП ВЭ 1 Б Фирма = 2,6 Фирма = 3,21 Биос = 2.1, Анализатор = 3.20 Прошивка UNIT = 4.04, SW-Main = 4.04, SW-BBP = 1.04, SW-DSP = 1.02, Hardboot = 1.02, Softboot = 2.02 Прошивка R&S Test Firmware = 3.53 / 3.54 (текущая версия Testsoftw. F. вся группа использовалась Фирма. = 3.52. 22.01.99 TSI 1.53 ЭМС 32 В 8,52 Фирма. = 3.52. 22.01.99 Фирма = 1,31 Данные Eprom = 31.03.08 Фирма. UCS 500 = 001925 / 3.06a02, rc = ISMIEC 4.10 CBT V5,30 + SW-опция K55, K57 Фирма. = 2.30, OTP = 02.01, GRA = 02.36 Фирма. = V.03D13 Фирма = 4,61 Фирма. = A13 (материнская плата) A02 (дисплей) Фирма. = 4.50 # 005, IPL = 4.01 # 001, OS = 4.02 # 001, GSM = 4.41 # 013, W-CDMA = 4.54 # 004, сценарий = 4.52 # 002 База микропрограмм R&S Test = 5.14, Mess-Software = GSM: 5,14 WCDMA: 5,14 (текущее тестирование программного обеспечения. F. все диапазоны EMC 32 Версия 8.52 EMC 32 Версия 8.40 460 Univ. Тестер радиосвязи CMU 200 108901 489 491 524 526 527 528 Приемник EMI Test Симулятор электростатического разряда dito Симулятор падения напряжения Генератор пакетов Генератор микроимпульсов Симулятор загрузки дампа ESU40 ESD dito VDS 200 EFT 200 А MPG 200 B LD 200B 1000-30 dito307022 0196-16 0496-06 0496-05 0496-06 546 Univ. Тестер радиосвязи CMU 200 106436 547 Univ. Тестер радиосвязи CMU 200 835390/014 584 Анализатор спектра БСС 8 100248 597 Univ.Тестер радиосвязи CMU 200 100347 598 620 642 Анализатор спектра Приемник EMI Test Тестер широкополосной радиосвязи ФСЭМ 30 (Резерв) ESU 26 CMW 500 831259/013 100362 126089 692 Bluetooth-тестер КПТ 32 100236 EMC 32 Версия 8.40 База микропрограмм R&S Test = 5,14, GSM = 5,14 WCDMA = 5,14 (текущая версия Testsoftw., F. Весь диапазон, который будет использоваться, Прошивка = 4.43 SP3, Bios = V5.1-16-3, Спец. = 01.00 В 2.30 Номер программного обеспечения: 000037 Версия V4.20a01 Программное обеспечение Nr. 000034 Версия V2.32 Программное обеспечение-Nr. 000030 Версия V2.43 Программное обеспечение-Nr.000031 Версия V2.35a01 База микропрограмм R&S Test = 5,14, GSM = 5,14 WCDMA = 5,14 (текущая версия Testsoftw., F. Весь диапазон, который будет использоваться База микропрограмм R&S Test = V5.1403 (текущая версия Testsoftw., f. используется весь диапазон, GSM = 5,14 WCDMA: = 5,14 2.82_SP3 База микропрограмм R&S Test = 5.01, GSM = 5.02 WCDMA = не установлен, материнская плата = µP1 = V.850 Прошивка Биос 3.40, Анализатор 3.40 Sp 2 4.43_SP3 Настройка V03.26, компонент программы тестирования V03.02.20 CBT V 5.40, FW: V.2.41 (цифровая FPGA, FPGA V. 3.09 РФ) TR6-0491-14-1-23f Тип Серийный номер. Версия прошивки или программного обеспечения во время теста Отчет об испытаниях 6-0491-14-1-23f, страница 23 из 26 001 005 007 009 016 020 021 030 033 057 060 Приемник EMI Test AC - LISN (50 Ом / 50 мкГн, испытательный полигон 1) Однолинейная V-сеть (50 Ом / 5 мкГн) Измеритель мощности (EMS-излучение) Сеть моделирования импеданса линии Рупорная антенна 18 ГГц (Subst 1) Рамочная антенна (H-поле) Петлевая антенна (H-поле) Пробник ВЧ-тока (100 кГц-30 МГц) реле-переключатель (система EMS) усилитель мощности (DC-2кГц) 066 режекторный фильтр (WCDMA; FDD1) 086 087 DC - блок питания, 0-10 А DC - блок питания, 0-5 А 090 Катушка Гельмгольца: 2х10 катушки последовательно 091 099 100 110 119 136 140 248 249 252 256 257 260 261 262 263 264 265 266 267 270 271 272 273 274 275 276 279 287 291 298 300 301 302 303 331 341 342 347 348 354 355 356 357 371 373 376 377 389 392 431 436 439 USB-LWL-конвертер пассивный пробник напряжения пассивный пробник напряжения USB-LWL-конвертер Анализатор гармоник RT dig.Фликерметр регулируемая дипольная антенна (диполь 1) Генератор сигналов аттенюатор аттенюатор аттенюатор аттенюатор гибридный гибридный соединитель Датчик тепловой мощности Сил-о-Метр Генератор сигналов Анализатор спектра датчик пиковой мощности Датчик пиковой мощности режекторный фильтр GSM 850 прекращение прекращение аттенюатор (20 дБ) 50 Вт аттенюатор (10 дБ) 100 Вт аттенюатор (10 дБ) 50 Вт Блок постоянного тока Блок постоянного тока делитель мощности предварительный усилитель 25 МГц - 4 ГГц фильтр высоких частот GSM 850/900 Univ. Тестер радиосвязи AC LISN (50 Ом / 50 мкГн, 1-фазный) аттенюатор (20 дБ) 50 Вт, 18 ГГц рупорная антенна 40 ГГц (Измерение 1) рупорная антенна 40 ГГц (Subst 1) Климатическая испытательная камера -40 / + 80 Град. Цифровой мультиметр Цифровой мультиметр сайт лаборатории сайт лаборатории DC - Блок питания 40A Сил-о-Метр датчик мощности датчик мощности Bluetooth-тестер Однолинейная V-сеть (50 Ом / 5 мкГн) Рупорная антенна 6 ГГц Приемник EMI Test Цифровой мультиметр Тестер радиосвязи Модель 7405 Univ.Тестер радиосвязи Антенна UltraLog 441 Потери в кабеле CTC-SAR-EMI TR6-0491-14-1-23f Тип ESS ЭШ3-З5 ЭШ4-З6 NRV Соч. 24-Д 3115 6502 HFH-Z2 ЭШ3-З1 RSU PAS 5000 WRCT 1900 / 2200-5 / 4010EEK СПГ 50-10 EA-3013 S Катушка Гельмгольца: 2х10 катушек в МЛС-1 ЭШ3-З3 Зонд ТК 9416 МЛС-1 B10 3121C-DB4 СМХУ SMA 6 дБ 2 Вт SMA 10 дБ 10 Вт N 6 дБ 12 Вт SMA 3 дБ 2 Вт 4031C 4032C NRV-Z55 NRV-S SMP 04 ФСЕК 30 NRV-Z33, модель 04 NRV-Z31, модель 04 WRCA 800 / 960-6EEK 1418 с.ш. 1418 с.ш. Модель 47 Модель 48 Модель 47 (10 дБ) 50 Вт Модель 7003 (N) Модель 7006 (SMA) 1515 (SMA) АМФ-2Д-100М4Г-35-10П WHJ 2200-4EE CMU 200 ЭШ4-З5 47-20-33 BBHA9170 BBHA9170 HC 4055 Fluke 112 Вольткрафт М-4660А радиолаборатория.EMI провел NGPE 40/40 URV 5 NRV-Z1 NRV-Z1 CBT32 ЭШ4-З6 BBHA9120 E ESCS 30 Кейтли 2000 MT8820A Набор пробников ближнего поля CMU 200 HL 562 Поле EMI ​​системы (SAR) Кабель Серийный номер. Производитель Замечание Оборудование Интервал калибровка Реф. № 7.1.2. Единые приборы и испытательные системы Cal в связи 825132/017 861741/005 892563/002 863056/017 B6366 9107-3699 9206-2770 879604/026 879581/18 494440/002 B6363 Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Шпитценбергер + Шпионы EMCO EMCO Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Шпитценбергер + Шпионы 12 млн 12 млн 12 млн 24 млн 36 млн 36/12 млн 36 млн 36 млн 24 млн pre-m 1а 31.03.2015 31.03.2015 31.03.2015 31.03.2015 31.03.2016 31.03.2017 31.03.2015 31.03.2015 31.03.2015 Wainwright GmbH 12 млн 1 г 31.07.2015 Heinzinger Electronic Elektro Automatik pre-m pre-m RWTÜV 12 млн 007/2006 299,78 10,52 без G60547 9105-0697 831314/006 04491 11342 825083/0008 825770/0010 826190/0007 826939/005 840414/009 843383/016 BB6935 BE6384 BF6239 BF9229 BG0321 C5129 C7061 LH855 379418 14 832221/091 892 239/020 AW0272 155 156 43146 81650455 IB 255466 448 8/027 882322/014 861761/002 100153 100535 BBHA 9120 E 179 100160 0583926 6K00000788 9305-2457 103083 100248 Ing.Büro Scheiba Rohde & Schwarz Шварцбек Ing. Büro Scheiba BOCONSULT EMCO Rohde & Schwarz Radiall Radiall Radiall Radiall Нарда Нарда Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Wainwright GmbH Weinschel Weinschel Weinschel Weinschel Weinschel Weinschel Weinschel Weinschel Miteq Wainwright GmbH Rohde & Schwarz Rohde & Schwarz Лукас Вайншель Шварцбек Шварцбек Heraeus Vötsch Fluke Вольткрафт Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz R&S Rohde & Schwarz Шварцбек Rohde & Schwarz Кейтли Анрицу EMCO Rohde & Schwarz Rohde & Schwarz 36 млн 36 млн 36 млн 36 млн 24 млн pre-m pre-m pre-m pre-m pre-m pre-m 24 млн 24 млн 36 млн 12 млн 24 млн 24 млн pre-m pre-m pre-m pre-m pre-m pre-m pre-m pre-m pre-m 12 млн 12 млн pre-m 12 млн pre-m 36 млн 36 млн 24 млн 24 млн 24 млн pre-m 24 млн 24 млн 24 млн 24 млн 24 млн 12 млн 12 млн 24 млн 12 млн 12 млн 36 млн 1c 1c CETECOM 12 млн 31.03.2015 31.03.2015 31.03.2015 31.03.2016 31.03.2015 31.03.2016 31.03.2016 31.03.2016 31.03.2016 31.03.2015 31.03.2016 31.03.2016 31.07.2015 31.07.2015 31.03.2015 31.03.2017 31.03.2017 30.11.2014 31.03.2016 31.03.2015 31.03.2016 31.03.2015 31.03.2015 31.03.2016 31.03.2016 31.03.2015 31.03.2015 31.03.2015 31.03.2015 31.03.2015 31.03.2017 31.10.2014 Тип Серийный номер. 487 Система CTC NSA-Verification SAR-EMI 489 Приемник EMI Test 502 полосовой фильтр 503 полосовой фильтр отклонения 512 режекторный фильтр GSM 850 517 523 529 530 546 547 548 549 552 матрица переключателей реле Цифровой мультиметр 6 дБ Широкополосный резистивный делитель мощности Широкополосный резистивный делитель мощности 10 дБ Univ.Тестер радиосвязи Univ. Тестер радиосвязи Цифровой барометр Журнал на каждую антенну фильтр высоких частот 2,8-18 ГГц 558 Система CTC FAR S-VSWR 574 584 597 598 600 601 602 611 612 613 616 617 618 619 620 621 625 Гибридная антенна Biconilog Анализатор спектра Univ. Тестер радиосвязи Анализатор спектра Сил-о-Метр диодный датчик средней чувствительности датчик пиковой мощности источник постоянного тока источник постоянного тока Аттенюатор Цифровой мультиметр Разветвитель / сумматор мощности Разветвитель / сумматор мощности Разветвитель / сумматор мощности Приемник EMI Test Ступенчатый аттенюатор 0-139 дБ Стандартная тестовая нагрузка USB Система CTC-FAR-EMIRSE WRCT 1850.0 / 2170.05 / 40WRCT 824.0 / 894.0-5 / 408SSK HM 205-3 EA 3013 S EA-PS 2032-50 CMU 200 HP3245A Fluke 112 Fluke 112 Fluke 112 AS-47 NRVS Матрица фильтра SAR 1 АМФ-5Д-02501800-2510П Поле EMI ​​системы (SAR) АНБ ESU40 WRCG 1709/17861699 / 1796WRCG 824 / 849-814 / 859WRCA 800 / 960-02 / 406EEK ВЧ реле Кейтли L4411A Модель 1515 416110000 рэнд CMU 200 CMU 200 2300 фунтов стерлингов HL025 WHKX 2,8 / 18G-10SS Система CTC FAR SVSWR БТА-Л БСС 8 CMU 200 ФСЭМ 30 (Резерв) НРВД (Резерв) NRV-Z5 (резерв) NRV-Z32 (Резерв) E3632A E3632A R416120000 20 дБ 10 Вт Fluke 177 ZFSC-2-2-S + 50ПД-634 50ПД-634 ESU 26 RSP Стандартная тестовая нагрузка USB 627 Регистратор данных OPUS 1 634 636 Анализатор спектра Тепловизионная камера 637 Высокоскоростной HDMI с Ethernet 1 м 638 640 641 642 644 670 671 678 683 Кабель HDMI с кабелем Ethernet 1,5 м Кабель HDMI, длина 2 м Кабель HDMI с Ethernet Тестер широкополосной радиосвязи Усилитель Univ.Тестер радиосвязи Источник питания постоянного тока 0-5 А Сил-о-Метр Анализатор спектра FSM (HF-блок) Ti32 Кабель HDMI с Ethernet 1 мес. Кабель HDMI с Ethernet Кабель HDMI, длина 2 м Сертифицированный кабель HDMI с CMW 500 ZX60-2534M + CMU 200 EA-3013S NRP БСС 26 686 Полевой анализатор EHP-200A 160WX30702 687 688 692 693 Генератор сигналов Предусилитель Bluetooth-тестер TS8997 SMF 100A JS-18004000-40-8P КПТ 32 СТС-Радиолаборатория 1_TS8997 102073 1750117 100236 443 CTC-FAR-EMI-RSE 448 режекторный фильтр WCDMA_FDD II 449 режекторный фильтр WCDMA FDD V 454 456 459 460 463 466 467 468 477 480 482 Осциллограф Источник питания постоянного тока 0-5 А DC -Источник питания 0-5 А, 0-32 В Univ.Тестер радиосвязи Универсальный источник Цифровой мультиметр Цифровой мультиметр Цифровой мультиметр Переизлучение GPS-системы измеритель мощности (Fula) матрица фильтров 484 предусилитель 2,5 - 18 ГГц TR6-0491-14-1-23f Производитель ETS-Lindgren / CETECOM Инструменты Wainwright GmbH Замечание Оборудование Интервал калибровка Реф. № Отчет об испытаниях 6-0491-14-1-23f, страница 24 из 26 Cal в связи 12 млн 31.07.2015 12 млн 1c 31.07.2015 31.07.2015 Wainwright 12 млн 1c 9210-П 29661 207810 2 108901 2831A03472 89210157 89680306

455 838392/031 Hameg Elektro Automatik Elektro Automatik Rohde & Schwarz Agilent Fluke США Fluke США Fluke США Автомобильные минусы.Финк Rohde & Schwarz CETECOM (Brl) pre-m pre-m 12 млн 24 млн 36 млн 36 млн 24 млн 1д 1244554 Miteq 12 млн 31.07.2015 24 млн 30.06.2015 12 млн 31.03.2015 31.03.2015 31.03.2016 31.03.2015 31.03.2015 31.03.2015 1000-30 ETS Lindgren / CETECOM Rohde & Schwarz SN 9 Wainwright pre-m SN 5 Wainwright pre-m SN 24 Wainwrght 12 млн 1c SE 04 MY46000154 LH 855 ЛОТ 9828 106436 835390/014 без 1000060 Кейтли Agilent Weinschel R&S Rohde & Schwarz Greisinger GmbH Rohde & Schwarz Wainwright pre-m 24 млн pre-m pre-m 12 млн 12 млн 36 млн 36/12 млн 12 млн 1c CTC 24 млн 31.07.2015 980026L 100248 100347 831259/013 834501/018 8435323/003 835080 KR 75305854 MY 40001321 Много. 9828 88
9 S F987001108 600994 600995 100362 100017 201.0999.9302.6.4.1.4 826188/010 Ti32-12060213 Франкония Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Rohde & Schwarz Agilent Agilent Radiall Fluke Мини-схемы JFW Industries США JFW Industries, США Роде-Шварц Rohde & Schwarz CETECOM 36/12 млн pre-m 36 млн 24 млн 24 млн 24 млн 24 млн pre-m pre-m pre-m 24 млн 12 млн pre-m 31.03.2016 G. Lufft GmbH 36 млн 30.05.2015 Rohde & Schwarz Корпорация Fluke pre-m 36 млн 31.07.2015 KogiLink 126089 SN865701299 106833 101638 200571 Райхельт Райхельт PureLink Rohde & Schwarz Мини-схемы Rohde & Schwarz Elektro Automatik Rohde & Schwarz Rohde & Schwarz Тест безопасности Нарды Решения Rohde & Schwarz Miteq Rohde & Schwarz Rohde & Schwarz 12 млн 12 млн pre-m pre-m 12 млн 24 млн 18.07.2015 12 млн pre-m 12 млн 12 млн 27.11.2014 31.07.2015 31.03.2015 12.02.2015 31.03.2015 30.06.2015 31.03.2015 31.07.2015 31.03.2016 13.01.2015 31.03.2015 31.03.2015 31.03.2015 31.03.2016 31.03.2015 31.03.2015 31.03.2015 26.11.2014 31.03.2015 30.11.2014 Отчет об испытаниях 6-0491-14-1-23f, страница 25 из 26 7.1.3. Легенда Примечание / примечания Интервал калибровки TR6-0491-14-1-23f Откалибровано во время калибровки системы: 1а Система CTC-SAR-EMS (Ref. No. 442) 1b Система-CTC-EMS-Conducted (Ref. No. 335) 1c Система CTC-FAR-EMI-RSE (Ref.-No. 443) 1д Система CTC-SAR-EMI (Ref.-No. 441) 1e Система CTC-OATS (излучаемые EMI) (Ref.-Нет. 337) 1f Система CTC-CTIA-OTA (Ref.-No. 420) 1 г Система CTC-FAR-EMS (Ref.-No. 444) Калибровка или проверка оборудования непосредственно перед измерением Оборудование, обслуживаемое нормативными документами, для функциональной проверки или поддержки калибровка этого оборудования нет эффекта онмеханический результат измерения Вспомогательное оборудование без калибровка например оборудование или оборудование для мониторинга Тестовая система 12 млн 12 месяцев 24 млн 24 мес 36 млн 36 мес 24/12 млн Калибровка каждые 24 месяца, между ними каждые 12 месяцев внутренняя проверка 36/12 млн Калибровка каждые 36 месяцев, между ними каждые 12 месяцев внутренняя проверка Pre-m Проверьте перед началом измерения Без калибровки Отчет об испытаниях 6-0491-14-1-23f, страница 26 из 26 7.1.4. Легенда Примечание / примечания Интервал калибровки Откалибровано во время калибровки системы: 1а Система CTC-SAR-EMS (Ref. No. 442) 1b Система-CTC-EMS-Conducted (Ref. No. 335) 1c Система CTC-FAR-EMI-RSE (Ref.-No. 443) 1д Система CTC-SAR-EMI (Ref.-No. 441) 1e Система CTC-OATS (излучаемые EMI) (Ref. No. 337) 1f Система CTC-CTIA-OTA (Ref.-No. 420) 1 г Система CTC-FAR-EMS (Ref.-No. 444) Калибровка или проверка оборудования непосредственно перед измерением Оборудование, обслуживаемое нормативными документами, для функциональной проверки или поддержки калибровка этого оборудования нет эффекта онмеханический результат измерения Вспомогательное оборудование без калибровка е.грамм. оборудование или оборудование для мониторинга Тестовая система 12 млн 12 месяцев 24 млн 24 мес 36 млн 36 мес 24/12 млн Калибровка каждые 24 месяца, между ними каждые 12 месяцев внутренняя проверка 36/12 млн Калибровка каждые 36 месяцев, между ними каждые 12 месяцев внутренняя проверка Pre-m Проверьте перед началом измерения Без калибровки 8. Версии отчетов об испытаниях (история изменений) Название отчета TR6-0491-14-1-23f --- TR6-0491-14-1-23f Дата 2014-09-15 --- Автор Лор --- Примечания: Первая версия

Расход дизельного топлива: Fiat – Ducato – Carado T132

Дизель, 2015 год, 109 кВт (148 л.с.), механическая коробка передач

Пользователь: Volvo242

Расход: 10,81 л / 100 км 25.520 км и 2,758 л
CO 2 выбросы: 285 г / км 25,520 км и 7,281 кг
Расходы на топливо: 12,92 EUR / 100 км 25.520 км и 3,297 евро

Записи 78-49 из 78
Дата Одометр Расстояние Кол-во евро Ø
12.09.2021 25,527 708,0 72,41

99,85 10,23
31.08.2021 24,819 270,0 29,65

41,78 10,98
23.07.2021 24,549 490,0 60,09

78,66 12,26
17.07.2021 24,059 237,0 66,27

92,71 10,34
28.04.2021 Налог 240,00
16.10.2020 23,822 795,0 40,42

42,40
01.06.2020 23,027 676,0 71,48

72,12 10,57
28.04.2020 Налог 240,00
29.12.2019 22,351 587,0 62,76

84,66 10,69
02.07.2019 21,764 570,0 65,83

84,20 11,55
30.06.2019 21,194 515,0 53,66

75,75 10,42
24.06.2019 20,679 715,0 71,89

91,95 10,05
20.06.2019 19.964 678,0 77,86

100,36 11,48
28.04.2019 Налог 240,00
17.04.2019 19,850 Техническое обслуживание 537,74
17.04.2019 19,850 Поменять резину 50,94
17.04.2019 19,850 Наблюдательный совет 206,90
01.01.2019 Страхование 646,72
28.12.2018 19,286 631,0 68,07

82,30 10,79
25.10.2018 19,274 Поменять резину 50,94
14.10.2018 18,655 488,0 51,34

68,74 10,52
22.09.2018 18,167 793,0 81,09

123,18 10,23
09.09.2018 17,374 461,0 48,40

70,62 10,50
08.09.2018 16,913 494,0 51,24

69,13 10,37
29.07.2018 Аксессуары 24,80
18.07.2018 16,356 Аксессуары 284,90
31.05.2018 16,419 564,0 63,50

82,49 11,26
23.05.2018 16,356 Техническое обслуживание 65,00
28.04.2018 Налог 240,00
10.04.2018 16,278 Поменять резину 50,94
<Предыдущая | 1 | 2 | 3 | Далее>

Литой под давлением и игрушечный транспорт Игрушки и хобби VIRAGES T132 НАКЛЕЙКИ 1/43 ЛОГОТИПЫ “REPSOL” FLUO 8spades.com

Литые под давлением игрушки и игрушки для хобби VIRAGES T132 НАКЛЕЙКИ 1/43 ЛОГОТИПЫ “REPSOL” FLUO 8spades.com
  1. Дом
  2. Игрушки и хобби
  3. Литье под давлением и игрушечные автомобили
  4. Прочие транспортные средства
  5. НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “REPSOL” FLUO

Pièce détachée, Non Marque:: Eamaged: VIRAGES , неиспользованный, Найдите много отличных новых и подержанных опций и получите лучшие предложения на НАКЛЕЙКИ 1/43 ЛОГОТИПОВ “REPSOL” FLUO – VIRAGES T132 по лучшим онлайн-ценам на.Эшелль:: 1/43: Номер изготовителя:: T132. Состояние :: Новое: Совершенно новый, См. Все определения условий: Échelle:: 1:43, См. Подробную информацию в списке продавца, неоткрытый, включая предметы ручной работы, Оригинальный Emballage:: Emballage d’origine: Тип:: Аксессуары. Бесплатная доставка для многих товаров.








перейти к содержанию

НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “REPSOL” FLUO

1/2 Chessex полфунта свободных многогранных кубиков из Pound O Dice Lot D&D, Vics Resins 39/40 Ford 4-дверный корпус из смолы для седана, мини-карбоновый комплект FPV Quad Frame 235 мм с рычагом 4 мм для RC Drone Part, 4 шт. Pokemon Sword & Shield Vivid Voltage Elite Trainer Box НОВЫЙ И ЗАПЕЧАТАННЫЙ. НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “REPSOL” FLUO , BIZARRE BZ16 WM n ° 5 CHASSEUIL-BALLOT 24H Le Mans 1976, Alloy Air Bus Model Kids Дети оттягивают назад Авиалайнер Пассажирский самолет Игрушка в подарок BH. ex Gavia Admiral 1/48 Поликарпов U-2 “Кукурузник” # 4807, Yamaha OX99-11 Presentation 1992 Red S4991 Spark 1:43 Новое в коробке !, НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “РЕПСОЛ” FLUO . KYLE BUSCH 2004 NBS # 5 LOWE’S GLADIATOR KENTUCKY WIN NASCAR 1/24 НАКЛЕЙКИ KB43, набор из 4 предметов 0,4–2 мм Инструменты для моделирования Аксессуар Scriber Crafts Инструмент Scribe Line долото, Беверли Кристалл 3D стоячая головоломка Мыслитель 43 шт. Япония.Набор из 4 пазлов, по 12 шт. Каждая, Гадкий Я, НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПОВ “REPSOL” FLUO , h2 10 пар 100 мм JST Connector Plug Cable Male + Female для RC Gift Batter H7L3,


НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “REPSOL” FLUO

НАКЛЕЙКИ VIRAGES T132 1/43 ЛОГОТИПЫ “REPSOL” FLUO

НАКЛЕЙКИ 1/43 ЛОГОТИПЫ “REPSOL” FLUO VIRAGES T132, Бесплатная доставка для многих продуктов, Найдите много отличных новых и подержанных опций и получите лучшие предложения на НАКЛЕЙКИ 1/43 LOGOS “REPSOL” FLUO – VIRAGES T132 по лучшим онлайн-ценам на , Вот ваши любимые товары, Покупайте здесь онлайн, Доставка по всему миру, Мы предлагаем бесплатную доставку для всех наших клиентов.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *